Skip to main content
NCBI home page
Journal of Lipid Research logoLink to Journal of Lipid Research
. 2015 May;56(5):1006–1013. doi: 10.1194/jlr.M057851

Bis(monoacylglycero)phosphate: a secondary storage lipid in the gangliosidoses

Zeynep Akgoc *, Miguel Sena-Esteves †, Douglas R Martin §, Xianlin Han **, Alessandra d’Azzo ††, Thomas N Seyfried *,1
PMCID: PMC4409277  PMID: 25795792

Abstract

Bis(monoacylglycero)phosphate (BMP) is a negatively charged glycerophospholipid with an unusual sn-1;sn-1′ structural configuration. BMP is primarily enriched in endosomal/lysosomal membranes. BMP is thought to play a role in glycosphingolipid degradation and cholesterol transport. Elevated BMP levels have been found in many lysosomal storage diseases (LSDs), suggesting an association with lysosomal storage material. The gangliosidoses are a group of neurodegenerative LSDs involving the accumulation of either GM1 or GM2 gangliosides resulting from inherited deficiencies in β-galactosidase or β-hexosaminidase, respectively. Little information is available on BMP levels in gangliosidosis brain tissue. Our results showed that the content of BMP in brain was significantly greater in humans and in animals (mice, cats, American black bears) with either GM1 or GM2 ganglioside storage diseases, than in brains of normal subjects. The storage of BMP and ganglioside GM2 in brain were reduced similarly following adeno-associated viral-mediated gene therapy in Sandhoff disease mice. We also found that C22:6, C18:0, and C18:1 were the predominant BMP fatty acid species in gangliosidosis brains. The results show that BMP accumulates as a secondary storage material in the brain of a broad range of mammals with gangliosidoses.

Keywords: brain lipids, gangliosides, phospholipids, storage diseases, fatty acid, lysosomal, Sandhoff disease, GM1-gangliosidosis, gene therapy

Bis(monoacylglycero)phosphate (BMP) is a negatively charged glycerophospholipid that is mainly localized in late endosomes/lysosomes (1–3). Many cell types have low amounts of BMP, which comprises less than 1% of total cellular phospholipid content. However, BMP content is higher in alveolar macrophages (18% of total phospholipids) than in other cell types (4). BMP is a structural isomer of phosphatidylglycerol (PG) and is synthesized through a series of acylation and deacylation steps involving a transacylase, which reorients the glycerol backbone (5). This reorientation gives BMP its unusual sn-1;sn-1′ structural configuration (based on the phosphate-linked glycerol carbon), which is not observed in other phospholipids (5, 6) (Fig. 1). This unusual configuration is thought to play a role in the resistance of BMP to many phospholipases, and its stability in late endosomes/lysosomes (7, 8). BMP stimulates the degradation of glycosphingolipids in coordination with lipid binding proteins (saposins) in lysosomes (9).

Fig. 1.

Fig. 1.

Open in a new tab

Structure of 2,2′ diacyl-sn-1:sn-1′ BMP as previously described (56).

Lysosomal storage diseases (LSDs) are a group of inherited disorders that are caused by defective/deficient lysosomal enzymes (10). Sandhoff disease (SD) and GM1 gangliosidosis are caused by genetic deficiencies of lysosomal β-hexosaminidase (Hexβ) and acid β-galactosidase (β-gal), respectively (10–14). SD is characterized by the storage of ganglioside GM2 and its asialo derivative GA2, whereas GM1 gangliosidosis involves the storage of ganglioside GM1 and its asialo derivative GA1 (11–14). Elevated levels of BMP are observed in many LSDs, including mucopolysaccharidosis, Niemann-Pick disease type A/B/C, Gaucher disease, and Fabry disease (15–26). However, this elevation is not present in all LSDs, such as the Spielmeyer-Sjögren type of neuronal ceroid-lipofuscinosis (20). Previous studies showed that BMP was elevated in the brain tissue of a SD human patient, and in serum obtained from GM2 gangliosidoses patients (20, 27). However, a detailed study of BMP content in the GM2 and GM1 gangliosidoses brain is lacking (28). We found that the levels of BMP were significantly higher in humans and animals with either GM1 or GM2 gangliosidoses than in brain tissue from species-matched control samples. The data indicated that BMP is a secondary storage material along with gangliosides in the gangliosidosis brain.

MATERIALS AND METHODS

Mice

The SV/129 Hexβ (+/−) mice were obtained from Dr. Richard Proia (National Institutes of Health). β-gal (+/−) mice were derived by homologous recombination and embryonic stem cell technology, as previously described (29, 30). Homozygous (−/−) mouse pups were derived from crossing heterozygous females with heterozygous male mice. Genotypes were determined as described previously (31, 32). Cortex brain samples were collected at humane end point and stored at −80°C. Humane end point for Hexβ (−/−) mice (SD) was about 100 days and for β-gal (−/−) (GM1 gangliosidosis) mice was about 180 days. All mice were propagated in the Boston College Animal Care Facility and were housed in plastic cages with filter tops containing Sani-Chip bedding (P. J. Murphy Forest Products Corp., Montville, NJ). The room was maintained at 22°C on a 12 h light/12 h dark cycle. Food (PROLAB R/M/H/3000 Lab Chow; Agway, St. Louis, MO) and water were provided ad libitum. All animal experiments were carried out with ethical committee approval in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals and were approved by the Institutional Animal Care Committee.

Cats

SD and GM1 cats were obtained from the Baker colony at Auburn University, AL, and result from naturally occurring mutations as previously described (33–38). SD cats had <3% normal hexosaminidase activity in the cerebral cortex (39). GM1 cats had <10% of β-gal activity. Both feline models showed stereotypical clinical disease progression including corresponding ganglioside storage (GM2 for SD cats and GM1 for GM1 cats). Feline models also showed all brain and peripheral organ pathologies of the ganglioside disease and represented an authentic model to study disease progression (34, 40). According to the recommendations of the American Veterinary Medical Association Panel on Euthanasia, animals were euthanized by pentobarbital overdose, followed by transcardial perfusion with heparinized cold saline (0.9% NaCl) until jugular perfusate was clear. Cerebral cortex samples were collected at humane endpoint from gangliosidosis cats (SD, 4–5 months; GM1, 7–8 months) and from age-matched normal cats. Samples were frozen in liquid nitrogen and stored at −80°C. The Auburn University Institutional Animal Care and Use Committee approved all performed animal procedures.

Bears

American black bears with GM1 gangliosidosis were found in the Northeastern United States. The bears were in poor clinical condition at 10–14 months in age and humanely euthanized, as previously described (41). The bear brain tissue was obtained as a gift from Joseph Alroy, Tufts University, Boston, MA.

Humans

SD human cortex samples and their age-matched control were obtained from the National Institute of Child Health and Development Brain and Tissue Bank for Developmental Disorders at the University of Maryland, Baltimore.

Adeno-associated viral vector design, preparation, and delivery to brain

The following vectors were used in this study: adeno-associated viral (AAV)1-CBA-Hexα, and AAV1-CBA-Hexβ. AAV vectors encoding α- or β-subunits of human Hexβ were constructed by PCR amplification of the respective cDNAs in the Mammalian Gene Collection clones 14125 (IMAGE 3353424; Genbank: BC018927) and 1725 (IMAGE: 2967035; Genbank: BC017378) obtained from the American Type Culture Collection (Manassas, VA). The primers used for PCR amplification were: HexA-1:ATCC ACTAG­T GGAGCACCATGACAAGTTCCAGGCTTTGGT; HexA-2:AAT­T CTCGAG TCAGGTCTGTTCAAACTCCTGCTCAC; Hexβ-1:AT­CC ACTAGT GGAGCACCATGGAGCTGTGCGGGCTGG; Hexβ-2:A­ATT CTCGAG TTACATGTTCTCATGGTTACAATATC. PCR products were digested with Spe I and Xho I (sequences underlined in the primers above) and cloned into pAAV-CBA-MBG-W (42) in place of the mouse β-gal cDNA. All vectors used in this study carry the woodchuck hepatitis virus posttranscriptional regulatory element. AAV1 vector stocks were produced as described (42).

Six-week-old SD mice were injected with 2 μl of a 1:1 formulation of AAV1-CBA-Hexα + AAV1-CBA-Hexβ vectors (7.2 × 1012 gc/ml for each vector in the formulation) stereotaxically into left and right thalamus (n = 4) (coordinates from bregma in millimeters: anteroposterior, −2.0; medial lateral, ±1.5; dorsal ventral, −2.5) at a rate of 0.2. μl·min−1 as previously described (43).

Lipid isolation, purification, and quantification

Total lipid extraction.

Total lipids were extracted from the cortexes of lyophilized whole brains with chloroform and methanol (1:1, v/v). Samples were further purified and prepared for column chromatography using previously described procedures (44, 45).

Column chromatography.

DEAE-Sephadex (A-25; Pharmacia Biotech, Uppsala, Sweden) columns were used to separate neutral and acidic lipids (46). Total lipid extract was applied to the DEAE-Sephadex column that was equilibrated in solvent A (chloroform:methanol:water, 30:60:8, v/v/v). Neutral lipids were eluted with solvent A. Acidic lipids, including gangliosides, were eluted with solvent B, comprised of chloroform:methanol:0.8 M Na acetate (30:60:8, v/v/v)

Ganglioside purification.

Acidic lipids were dried by rotary evaporation and further separated to acidic lipid and ganglioside fractions by Folch partitioning, as previously described (45, 47). An aliquot was taken from the ganglioside fraction for sialic acid determination and sialic acid was quantified by resorcinol assay. Gangliosides were further purified with base treatment and desalting, as previously described (12, 13, 45). Treatment of gangliosides with mild base is needed to remove contaminating phospholipids and any ganglioside internal esters or salt forms that might arise as artifacts of the lipid isolation procedures (48, 49).

BMP purification.

After Folch partitioning, the lower phase, including the acidic phospholipid fraction, was dried under nitrogen and resuspended in 10 ml of chloroform:methanol (1:1, v/v). This fraction was composed of BMP, cardiolipin, sulfatides, phosphatidyglycerol, phosphatidylserine, phosphatidylinositol, and phosphatidic acid. High-performance TLC (HPTLC) was used to separate and visualize BMP. No BMP was detected in the Folch upper phase, indicating that all BMP partitioned into the lower phase.

HPTLC.

HPTLC was used to separate and visualize acidic and neutral lipids as previously described (12, 45, 50) BMP was purchased from Avanti Polar Lipids (Alabaster, AL). Lipid standards were either purchased from Matreya Inc. (Pleasant Gap, PA), Sigma (St. Louis, MO), or were the courtesy of Dr. Robert Yu (Medical College of Georgia, Augusta, GA). For BMP visualization, plates were run by a single ascending run with chloroform:methanol:ammonium hydroxide (30% by volume) (65:35:5, v/v/v) for 5 min and visualized by charring with 3% cupric acetate in 8% phosphoric acid solution, followed by heating in an oven at 165°C for 7 min. The Camag HPTLC scanner with Wincats software (Wilmington, NC) was used to estimate individual band densities. Concentrations of individual lipids were calculated based on standard curve obtained by standard lanes on HPTLC.

The amount of gangliosides spotted per lane was equivalent to 1.5 μg of sialic acid. Gangliosides were separated by a solution of chloroform:methanol:CaCl2 (0.02%) (55:45:10, v/v/v) and visualized by spraying the dried plates with the resorcinol reagent, followed by heating at 95°C. Following quantification of ganglioside bands, total brain gangliosides were normalized to 100%, and sialic acid values were quantified by percent distribution of each ganglioside band (51).

Sialic acid quantification.

The Folch upper phase, including the ganglioside fraction, was desalted and the amount of sialic acid was measured before and after desalting by the resorcinol assay, as previously described (13, 39). Three aliquots of each ganglioside sample were dried under vacuum. A resorcinol:dH2O (1:1, v/v) solution (resorcinol reagent-HCl:0.2 M resorcinol:dH2O:0.1 M CuSO4, 40:5:5:0.125, v/v/v/v) was added to each sample, followed by submersion in a boiling water bath for 17 min. After cooling on ice, the reaction was stopped with butyl acetate:N-butanol, (85:15, v/v). Each sample was vortexed and centrifuged at 700 g for 2 min. The absorbance of the upper aqueous layer was recorded at 580 nm using a Shimadzu UV-1601 spectrophotometer (Shimadzu, Torrance, CA). Sialic acid values were fit to a standard curve using N-acetylneuraminic acid as a standard (52).

Gas chromatography

Preparative HPTLC was used to separate BMP with chloroform:methanol:ammonium hydroxide (30% by volume) (65:35:5, v/v/v). Lipids were detected after spraying HPTLC with acetone:water (80:20, v/v) containing 5% primulin. The BMP fraction was scraped from the plate and esterified with acetyl chloride:methanol (1:4, v/v), and neutralized with K2CO3 (4%) in a sealed borosilicate tube under nitrogen. Separation of fatty acid methyl esters was carried out using gas-liquid chromatography (HP 6890) using a 30 m × 0.25 mm × 0.25 μm Omegawax 250 fused silica capillary column (Supelco). Area under the curve values were used to calculate the percentages of individual fatty acids compared with sum area of all fatty acids.

Mass spectrometry

Preparative HPTLC, using the solvent system chloroform:methanol:ammonium hydroxide (30%) (65:35:5, v/v/v), was used to separate BMP from other phospholipids. Shotgun lipidomics analyses of BMP were performed on a triple-stage quadrupole mass spectrometer (Thermo Scientific, San Jose, CA) equipped with an ionspray ion source, as previously described (53).

Statistical analysis

Statistical significance of data was analyzed by the two-tailed Student’s t-test between the normal and the diseased samples. Interquartile range was approximated between the maximum and minimum elements in the data set divided by two.

RESULTS

BMP accumulates in the brains of mice, cats, bears, and humans with GM2 (Sandhoff disease) or GM1 gangliosidoses

Our objective was to evaluate the content and fatty acid composition of BMP in the brains of mice, cats, bears, and humans with GM2 (Sandhoff disease) and/or GM1 gangliosidosis. BMP accumulation (up to 32-fold increase) was found in all samples of gangliosidosis brain tissue (Fig. 2, Table 1), showing that BMP accumulates as a secondary storage material in the gangliosidosis brain. BMP levels were also higher in juvenile [postnatal day 15 (p15)] β-gal (−/−) (GM1 gangliosidosis) mouse brains than in age-matched β-gal (+/−) (normal) brains. We also observed that BMP was stored in the livers of Hexβ (−/−) (SD mice) (Table 1), but not in the livers of β-gal (−/−) GM1 gangliosidosis mice (data not shown).

Fig. 2.

Fig. 2.

Open in a new tab

HPTLC analysis of acidic lipids in the brains of mice, cats, humans, and bears with ganglioside storage disease. The normal (N), Sandhoff disease (SD), and GM1 mice represent the Hexβ (+/−), Hexβ (−/−), and β-gal (−/−) mice, respectively. The HPTLC was developed for 5 min with chloroform:methanol:ammonia (30% aqueous solution) (65:35:5, v/v/v). The amount of acidic lipid spotted per lane was equivalent to 200 μg of tissue dry weight. The bands were visualized by charring with 3% cupric acetate in 8% phosphoric acid solution. Std, standard is a mixture of purified acidic lipids including BMP, cardiolipin (CL), phosphatidic acid (PA), sulfatides (SULF), phosphatidylserine (PS), and phosphatidylinositol (PI).

TABLE 1.

BMP levels in the brains of mice, cats, bears, and humans with ganglioside storage disease

Species Age Phenotype Tissue n BMPa Fold Increase
Mouse Adult Normal Brain 6 42.7 ± 11.5
Adult SD Brain 3 148.6 ± 22.6c 3
Adult GM1 Brain 3 256.0 ± 11.9c 6
Juvenileb Normal Brain 3 17.9 ± 2.0
Juvenileb SD Brain 2 109.0 ± 9.4 6
Adult Normal Liver 3 Trace
Adult SD Liver 3 243.9 ± 171.0 >10
Cat Adult Normal Brain 3 12.0 ± 17.3
Adult SD Brain 3 219.6 ± 16.0c 18
Adult GM1 Brain 2 370.4 ± 61.1c 31
Bear Adult Normal Brain 1 12.2
Adult GM1 Brain 1 184.2 15
Human Adult Normal Brain 1 29.5
Adult SD Brain 1 451.1 15
Open in a new tab
a

BMP levels are represented as micrograms per 100 mg of tissue dry weight.

b

Juvenile mouse brains are analyzed at age of p 15.

c

Significantly different than normal sample in the same group using Student’s t-test (P < 0.05).

Fatty acyl species of BMP

We analyzed the fatty acyl species of BMP by gas chromatography. Major fatty acid species in BMP from gangliosidoses brain samples included stearic acid (C18:0), oleic acid (C18:1), arachidonic acid (20:4), and DHA (22:6) (Table 2). C22:6 was the predominant (57–62%) fatty acid present in the brains of GM1 and GM2 gangliosidoses mice and in GM1 gangliosidosis American black bears. These species contained 16–22% of C18:0 and C18:1. In contrast, C18:0 and C18:1 were the predominant (37–57%) fatty acids in the brains of GM1 and GM2 gangliosidosis cats and GM2 gangliosidosis humans. These species had lower amounts (17–37%) of C22:6.

TABLE 2.

Fatty acid distribution of brain BMP from mice, cats, bears, and humans with ganglioside storage disease

Fatty Acid Mouse Cat Bear Human
SD (n = 3) GM1 (n = 3) SD (n = 3) GM1 (n = 2) GM1 (n = 1) SD (n = 1)
C16:0 9.0 ± 1.8 5.4 ± 0.5 5.4 ± 1.1 10.9 ± 0.6 3.5 4.3
C18:0 10.4 ± 1.8 8.7 ± 0.8 15.4 ± 2.7 24 ± 0.9 5.4 33.0
C18:1 11.5 ± 1.9 11.7 ± 0.6 21.7 ± 3.3 22.6 ± 0.9 10.7 24.2
C18:2n-6 1.5 ± 0.4 1.2 ± 0.1 5.2 ± 0.4 2.0 ± 0.5 3.0 4.9
C20:2 2.0 ± 0.6 2.6 ± 1.2 0.5 ± 0.4 1.6 ± 0 0.6 4.2
C20:4n-6 7.2 ± 0.4 8.0 ± 0.4 6.6 ± 0.7 5.9 ± 0.2 13.8 5.9
C20:5n-3 ND 4.4 ± 1.7 8.5 ± 3.0 0.4 ± 0.2 0.3 ND
C22:6n-3 58.4 ± 4.8 57.9 ± 2.4 36.7 ± 2.9 32.7 ± 1.4 62.6 17.2
C24:0 ND ND ND ND 9.6 6.3
Open in a new tab

ND, not detected.

BMP separates from its structural isomer PG by HPTLC and mass spectrometry

BMP has the same molecular weight as PG, therefore it is challenging to separate BMP from PG in mass spectrometry without an initial chromatography procedure. In our solvent system, BMP (Rf = 0.71) separated from PG (Rf = 0.57) clearly. In order to further validate BMP as a separate lipid from PG, we analyzed the isolated BMP from HPTLC plates by a triple-stage quadrupole mass spectrometer. Analysis of commercial standards from Avanti showed BMP to have a distinct peak around m/z 92, while PG standard had two distinct peaks at m/z 171 and m/z 227. The BMP isolated from GM2 gangliosidosis mouse brains also showed the distinct peak at m/z 92, while these samples had very low peaks at m/z 171 and m/z 227 (data not shown). Also, the predominant BMP species in GM2 gangliosidosis mice had a molecular weight of 865.5 corresponding to 22:6-22:6 BMP (data not shown), which correlates well with the gas chromatography data showing that 22:6 is the predominant BMP fatty acid species in mice with GM2 gangliosidosis.

AAV-mediated gene therapy reduces storage of brain BMP and ganglioside content

The relationship of BMP storage to ganglioside storage was evaluated in the brains of Hexβ (+/−) (normal), Hexβ (−/−) (SD) mice that were treated or not treated with AAV gene therapy. Both GM2 and BMP levels were lower in the AAV-treated SD mice than in the untreated SD mice (Table 3). GM2 content was significantly correlated with the BMP content in the 13 brain samples analyzed (r = 0.9822, P < 0.01). For the correlation analysis, an arbitrary value of 0.5 μg sialic acid/100 mg of tissue dry weight was used to represent trace amounts on the HPTLC plate.

TABLE 3.

Influence of AAV gene therapy on the content of GM2 and BMP in Sandhoff disease mouse brain

Sample Phenotype Treatment GM2a BMPb
1 Normal None Trace 66.8
2 Normal None Trace 72.1
3 Normal None Trace 61.9
4 SD None 357.7 180.0
5 SD None 376.7 162.5
6 SD None 347.8 179.3
7 SD None 391.1 187.5
8 SD AAV 4.4 74.3
9 SD AAV 16.4 74.5
10 SD AAV 34.9 81.8
11 SD AAV 23.0 81.4
12 SD AAV 39.1 85.2
13 SD AAV 4.1 70.2
Open in a new tab
a

GM2 values are expressed as micrograms of sialic acid per 100 mg of tissue dry weight.

b

BMP values are expressed as micrograms per 100 mg of tissue dry weight.

DISCUSSION

Although BMP comprises a small portion of total phospholipids in normal tissues, BMP levels increase in many LSDs, such as Niemann-Pick, neuronal ceroid lipofuscinoses, mucopolysaccharidosis (MPS I and II), Fabry disease, and Gaucher disease (16, 17, 19–25). However, no detailed studies of BMP content and composition have been conducted in the brains of ganglioside storage diseases (28). We observed a dramatic increase of BMP levels in GM1 and GM2 gangliosidoses brain samples in humans, American black bears, cats, and mice compared with their nondiseased counterparts. LSDs frequently involve a secondary storage material in addition to the primary storage material (28, 54). Examples include a secondary ganglioside storage in Gaucher disease and mucopolysaccharidosis, and secondary cholesterol storage in Niemann-Pick disease (55). We found that BMP was stored as a secondary material in the brains of GM1 and GM2 gangliosidoses. An explanation for the secondary storage of BMP in gangliosidosis brain has not been established (56). Because BMP is localized to endosomal/lysosomal membranes (57), a lysosomal expansion from stored gangliosides could simply increase the amount of a lipid localized in these compartments. However, BMP does not increase proportionally with lysosomal size, and it is not stored as a secondary material in all LSDs (56). Hence, lysosomal expansion might not be the only mechanism for BMP elevation (20, 56).

It is also unlikely that BMP storage is linked directly to the primary enzyme deficiency in LSDs, as BMP storage was not observed in the livers of GM1 gangliosidosis [β-gal (−/−)] mice despite the presence of ganglioside storage in the brains of these mice (data not shown). GM1 is not stored in the livers of β-gal (−/−) mice, as GM1 synthesis does not occur in mouse liver (58). On the other hand, BMP storage was observed in the livers of SD mice (Table 1), where N-glycolylneuraminic acid-GM2 is also stored (58). This observation indicates that BMP co-accumulates with ganglioside storage, rather than as a downstream by-product of a nonfunctional enzyme.

Kobayashi and colleagues showed that BMP plays a role in the formation, structure, and trafficking of endosomal/lysosomal compartments in cells under normal conditions (3, 57, 59). Late endosomes/lysosomes form multivesicular bodies under normal conditions, but form multilamellar vesicles in pathological cases such as the gangliosidoses (60, 61). Both gangliosides and BMP are thought necessary for the formation of these aberrant lamellar bodies. It is possible that the high BMP levels we observed in the brains from the GM1 and GM2 gangliosidoses contribute to the formation of these multilamellar storage vesicles.

Glycosphingolipids are degraded in lysosomes with the aid of hydrolases and lysosomal lipid binding proteins, e.g., saposins (7, 62). The lipid composition of lysosomes is thought to be important in this degradation, and anionic phospholipids such as BMP are thought to facilitate the degradation of glycosphingolipids in the limiting membrane of endosomal/lysosomal compartments (63). BMP facilitates cholesterol transport, and the application of anti-BMP antibodies leads to cholesterol accumulation in lysosomes, mimicking the Niemann-Pick phenotype (64). BMP becomes limiting in Niemann-Pick disease fibroblasts, and exogenous feeding of BMP decreases excessive cholesterol storage (65). Also Hein, Duplock, and Fuller (15) show that selective decrease of BMP reduces the storage material, glucosylceramide, in THP-1 Gaucher macrophages. Further studies will be needed to determine whether modulation of BMP levels can decrease ganglioside storage in the GM1 and GM2 gangliosidoses.

Inflammation is a hallmark of the gangliosidoses (66). Inflammation is observed with the onset of behavioral symptoms (about 2.5 months) in SD [Hexβ (−/−)] mice and GM1 gangliosidosis [β-gal (−/−)] mice (66, 67). Because BMP is a major lipid in alveolar macrophages, it is possible that microglia/macrophage infiltration could contribute, in part, to the increased BMP levels observed in the brains of the gangliosidoses. To address this possibility, we analyzed BMP levels in young Hexβ (−/−) mice at p15, well before the onset of behavioral symptoms and inflammation. However, GM2 ganglioside storage is observable in the p15 Hexβ (−/−) mice (58). We found that brain levels of BMP were higher in the p15 Hexβ (−/−) mice than in the normal age-matched controls. These findings suggest that BMP storage is not likely associated with inflammation, but is associated with ganglioside storage.

AAV gene therapy has been successfully used to treat GM1 and GM2 gangliosidosis in both mice and cats (42, 43, 68). Vectors expressing the deficient enzymes needed for corresponding ganglioside degradation are delivered intracranially. AAV treatments can successfully restore the deficient enzymatic activity and eliminate most of the corresponding ganglioside storage (42, 43, 68). We observed that AAV treatment also eliminated secondary storage of BMP in SD mouse brains. A significant positive correlation was observed between BMP storage and GM2 storage in the AAV-treated and untreated mice. These results show that AAV therapy that targets the primary storage successfully clears the secondary BMP storage as well.

Another property of BMP is its unique fatty acid composition. C18:1 is a major BMP fatty acid in many cell types (69–74). In alveolar macrophages, BMP predominantly contains n-6 fatty acids, such as linoleic acid (18:2) and arachidonic acid (20:4) (75, 76). Interestingly, DHA (C22:6, n-3) comprises a significant portion of BMP fatty acids in many cell types in drug-induced phospholipidosis, and also in many LSDs (22, 70–73, 77–82). We also found that DHA was a major fatty acid species in BMP from the brains of mice, cats, and bears with gangliosidosis. This predominance was most dramatic in mouse and bear samples where DHA comprised 57–62% of the BMP fatty acids. The reason for this high DHA percentage is unclear. Polyunsaturated fatty acids can influence membrane fluidity, which might be important for control of endosomal sorting and membrane fusion. Bouvier et al. (73) showed that 22:6/22:6 BMP can be oxidized in the presence of oxygen radicals, thus protecting cholesterol from oxidation. However, the specific function of 22:6 in LSDs remains unclear (56).

Here we analyzed the content and fatty acid composition of BMP in humans and in animals (mice, cats, and American black bears) with either GM1 or GM2 ganglioside storage disease. Our results showed that BMP was a significant secondary storage material in the gangliosidoses. BMP storage might be linked to lysosomal size, or might have a functional role in clearing excess storage material. Further studies will be needed to address these issues.

Acknowledgments

The authors would like to thank Julian Arthur for subcellular fractionation and lipid analysis of p15 mice. The authors also want to thank Sonia Iosim, Karie Heinecke, Rena Baek, Hannah Rockwell, and Sam Eaton for assistance with lipid analysis and Joseph Alroy for gifting bear brain tissues.

Footnotes

Abbreviations:

AAV
adeno-associated viral
BMP
bis(monoacylglycero)phosphate
β-gal
β-galactosidase
Hexβ
β-hexosaminidase
HPTLC
high-performance TLC
LSD
lysosomal storage disease
p15
postnatal day 15
PG
phosphatidylglycerol
SD
Sandhoff disease

This work was supported in part by National Institutes of Health Grant NS-055195, Boston College Research Expense Fund, and the National Tay-Sachs and Allied Diseases Association, Inc.

REFERENCES

  • 1.Gruenberg J. 2003. Lipids in endocytic membrane transport and sorting. Curr. Opin. Cell Biol. 15: 382–388. [DOI] [PubMed] [Google Scholar]
  • 2.van der Goot F. G., Gruenberg J. 2006. Intra-endosomal membrane traffic. Trends Cell Biol. 16: 514–521. [DOI] [PubMed] [Google Scholar]
  • 3.Kobayashi T., Startchev K., Whitney A. J., Gruenber J. 2001. Localization of lysobisphosphatidic acid-rich membrane domains in late endosomes. Biol. Chem. 382: 483–485. [DOI] [PubMed] [Google Scholar]
  • 4.Hostetler K. Y. 1982. Polyglycerophospholipids: phosphatidyl­glycerol, diphosphatidylglycerol and bis (monoacylglycero) phosphate. In: New Comprehensive Biochemistry 4. 215–261. [Google Scholar]
  • 5.Thornburg T., Miller C., Thuren T., King L., Waite M. 1991. Glycerol reorientation during the conversion of phosphatidylglycerol to bis(monoacylglycerol)phosphate in macrophage-like RAW 264.7 cells. J. Biol. Chem. 266: 6834–6840. [PubMed] [Google Scholar]
  • 6.Brotherus J., Renkonen O., Fischer W., Herrmann J. 1974. Novel stereoconfiguration in lyso-bis-phosphatidic acid of cultured BHK-cells. Chem. Phys. Lipids. 13: 178–182. [DOI] [PubMed] [Google Scholar]
  • 7.Kolter T., Sandhoff K. 2005. Principles of lysosomal membrane digestion: stimulation of sphingolipid degradation by sphingolipid activator proteins and anionic lysosomal lipids. Annu. Rev. Cell Dev. Biol. 21: 81–103. [DOI] [PubMed] [Google Scholar]
  • 8.Schulze H., Kolter T., Sandhoff K. 2009. Principles of lysosomal membrane degradation: Cellular topology and biochemistry of lysosomal lipid degradation. Biochim. Biophys. Acta. 1793: 674–683. [DOI] [PubMed] [Google Scholar]
  • 9.Gallala H. D., Breiden B., Sandhoff K. 2011. Regulation of the NPC2 protein-mediated cholesterol trafficking by membrane lipids. J. Neurochem. 116: 702–707. [DOI] [PubMed] [Google Scholar]
  • 10.Neufeld E. F. 1991. Lysosomal storage diseases. Annu. Rev. Biochem. 60: 257–280. [DOI] [PubMed] [Google Scholar]
  • 11.Gravel R. A., Clarke J. T. R., Kaback M. M., Mahuran D., Sandhoff K., Suzuki K. 1995. The GM2 gangliosidoses. In The Metabolic and Molecular Basis of Inherited Disease. C. R. Schriver, A. L. Beaudet, W. S. Sly, et al., editors. McGraw-Hill, Inc., New York. 2839–2879. [Google Scholar]
  • 12.Kasperzyk J. L., El-Abbadi M. M., Hauser E. C., D’Azzo A., Platt F. M., Seyfried T. N. 2004. N-butyldeoxygalactonojirimycin reduces neonatal brain ganglioside content in a mouse model of GM1 gangliosidosis. J. Neurochem. 89: 645–653. [DOI] [PubMed] [Google Scholar]
  • 13.Hauser E. C., Kasperzyk J. L., d’Azzo A., Seyfried T. N. 2004. Inheritance of lysosomal acid beta-galactosidase activity and gangliosides in crosses of DBA/2J and knockout mice. Biochem. Genet. 42: 241–257. [DOI] [PubMed] [Google Scholar]
  • 14.Kasperzyk J. L., d’Azzo A., Platt F. M., Alroy J., Seyfried T. N. 2005. Substrate reduction reduces gangliosides in postnatal cerebrum-brainstem and cerebellum in GM1 gangliosidosis mice. J. Lipid Res. 46: 744–751. [DOI] [PubMed] [Google Scholar]
  • 15.Hein L. K., Duplock S., Fuller M. 2013. Selective reduction of bis(monoacylglycero)phosphate ameliorates the storage burden in a THP-1 macrophage model of Gaucher disease. J. Lipid Res. 54: 1691–1697. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Vanier M. T. 1983. Biochemical studies in Niemann-Pick disease. I. Major sphingolipids of liver and spleen. Biochim. Biophys. Acta. 750: 178–184. [DOI] [PubMed] [Google Scholar]
  • 17.Rouser G., Kritchevsky G., Knudson A. G., Jr, Simon G. 1968. Accumulation of a glycerolphospholipid in classical Niemann-Pick disease. Lipids. 3: 287–290. [DOI] [PubMed] [Google Scholar]
  • 18.Asumendi A., Morales M. C., Alvarez A., Arechaga J., Perez-Yarza G. 2002. Implication of mitochondria-derived ROS and cardiolipin peroxidation in N-(4-hydroxyphenyl)retinamide-induced apoptosis. Br. J. Cancer. 86: 1951–1956. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Harder A., Widjaja F., Debuch H. 1984. Studies on lipids from liver and spleen of a child (O.L.) with Niemann-Pick’s disease type C. J. Clin. Chem. Clin. Biochem. 22: 199–201. [PubMed] [Google Scholar]
  • 20.Kahma K., Brotherus J., Haltia M., Renkonen O. 1976. Low and moderate concentrations of lysobisphosphatidic acid in brain and liver of patients affected by some storage diseases. Lipids. 11: 539–544. [DOI] [PubMed] [Google Scholar]
  • 21.Käkelä R., Somerharju P., Tyynelä J. 2003. Analysis of phospholipid molecular species in brains from patients with infantile and juvenile neuronal-ceroid lipofuscinosis using liquid chromatography-electrospray ionization mass spectrometry. J. Neurochem. 84: 1051–1065. [DOI] [PubMed] [Google Scholar]
  • 22.Jabs S., Quitsch A., Käkelä R., Koch B., Tyynelä J., Brade H., Glatzel M., Walkley S., Saftig P., Vanier M. T., et al. 2008. Accumulation of bis(monoacylglycero)phosphate and gangliosides in mouse models of neuronal ceroid lipofuscinosis. J. Neurochem. 106: 1415–1425. [DOI] [PubMed] [Google Scholar]
  • 23.Vanier M. T., Rodriguez-Lafrasse C., Rousson R., Mandon G., Boue J., Choiset A., Peyrat M. F., Dumontel C., Juge M. C., Pentchev P. G., et al. 1992. Prenatal diagnosis of Niemann-Pick type C disease: current strategy from an experience of 37 pregnancies at risk. Am. J. Hum. Genet. 51: 111–122. [PMC free article] [PubMed] [Google Scholar]
  • 24.Besley G. T., Elleder M. 1986. Enzyme activities and phospholipid storage patterns in brain and spleen samples from Niemann-Pick disease variants: a comparison of neuropathic and non-neuropathic forms. J. Inherit. Metab. Dis. 9: 59–71. [DOI] [PubMed] [Google Scholar]
  • 25.Hobert J. A., Dawson G. 2007. A novel role of the Batten disease gene CLN3: association with BMP synthesis. Biochem. Biophys. Res. Commun. 358: 111–116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Clarke L. A., Winchester B., Giugliani R., Tylki-Szymanska A., Amartino H. 2012. Biomarkers for the mucopolysaccharidoses: discovery and clinical utility. Mol. Genet. Metab. 106: 395–402. [DOI] [PubMed] [Google Scholar]
  • 27.Meikle P. J., Duplock S., Blacklock D., Whitfield P. D., Macintosh G., Hopwood J. J., Fuller M. 2008. Effect of lysosomal storage on bis(monoacylglycero)phosphate. Biochem. J. 411: 71–78. [DOI] [PubMed] [Google Scholar]
  • 28.Walkley S. U., Vanier M. T. 2009. Secondary lipid accumulation in lysosomal disease. Biochim. Biophys. Acta. 1793: 726–736. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Sango K., Yamanaka S., Hoffmann A., Okuda Y., Grinberg A., Westphal H., McDonald M. P., Crawley J. N., Sandhoff K., Suzuki K., et al. 1995. Mouse models of Tay-Sachs and Sandhoff diseases differ in neurologic phenotype and ganglioside metabolism. Nat. Genet. 11: 170–176. [DOI] [PubMed] [Google Scholar]
  • 30.Hahn C. N., del Pilar Martin M., Schroder M., Vanier M. T., Hara Y., Suzuki K., Suzuki K., d’Azzo A. 1997. Generalized CNS disease and massive GM1-ganglioside accumulation in mice defective in lysosomal acid beta-galactosidase. Hum. Mol. Genet. 6: 205–211. [DOI] [PubMed] [Google Scholar]
  • 31.Hauser E. C., d’Azzo A., Seyfried T. N. 2002. Inheritance of brain beta-galactosidase activities and gangliosides in crosses of DBA/2J and knockout mice. J. Neurochem. 81(Suppl. 1): 11. [DOI] [PubMed] [Google Scholar]
  • 32.Galjaard H. 1980. Genetic Metabolic Disease: Diagnosis and Prenatal Analysis. Elsevier Science Publishers, Amsterdam. [Google Scholar]
  • 33.Cork L. C., Munnell J. F., Lorenz M. D., Murphy J. V., Baker H. J., Rattazzi M. C. 1977. GM2 ganglioside lysosomal storage disease in cats with beta-hexosaminidase deficiency. Science. 196: 1014–1017. [DOI] [PubMed] [Google Scholar]
  • 34.Cork L. C., Munnell J. F., Lorenz M. D. 1978. The pathology of feline GM2 gangliosidosis. Am. J. Pathol. 90: 723–734. [PMC free article] [PubMed] [Google Scholar]
  • 35.Baker H. J., Reynolds G. D., Walkley S. U., Cox N. R., Baker G. H. 1979. The gangliosidoses: comparative features and research applications. Vet. Pathol. 16: 635–649. [DOI] [PubMed] [Google Scholar]
  • 36.Martin D. R., Krum B. K., Varadarajan G. S., Hathcock T. L., Smith B. F., Baker H. J. 2004. An inversion of 25 base pairs causes feline GM2 gangliosidosis variant. Exp. Neurol. 187: 30–37. [DOI] [PubMed] [Google Scholar]
  • 37.Martin D. R., Rigat B. A., Foureman P., Varadarajan G. S., Hwang M., Krum B. K., Smith B. F., Callahan J. W., Mahuran D. J., Baker H. J. 2008. Molecular consequences of the pathogenic mutation in feline GM1 gangliosidosis. Mol. Genet. Metab. 94: 212–221. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Baker H. J., Jr, Lindsey J. R., McKhann G. M., Farrell D. F. 1971. Neuronal GM1 gangliosidosis in a Siamese cat with beta-galactosidase deficiency. Science. 174: 838–839. [DOI] [PubMed] [Google Scholar]
  • 39.Baek R. C., Martin D. R., Cox N. R., Seyfried T. N. 2009. Comparative analysis of brain lipids in mice, cats, and humans with Sandhoff disease. Lipids. 44: 197–205. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Baker H. J., Lindsey J. R. 1974. Animal model: feline GM1 gangliosidosis. Am. J. Pathol. 74: 649–652. [PMC free article] [PubMed] [Google Scholar]
  • 41.Muthupalani S., Torres P. A., Wang B. C., Zeng B. J., Eaton S., Erdelyi I., Ducore R., Maganti R., Keating J., Perry B. J., et al. 2014. GM1-gangliosidosis in American black bears: clinical, pathological, biochemical and molecular genetic characterization. Mol. Genet. Metab. 111: 513–521. [DOI] [PubMed] [Google Scholar]
  • 42.Broekman M. L., Baek R. C., Comer L. A., Fernandez J. L., Seyfried T. N., Sena-Esteves M. 2007. Complete correction of enzymatic deficiency and neurochemistry in the GM1-gangliosidosis mouse brain by neonatal adeno-associated virus-mediated gene delivery. Mol. Ther. 15: 30–37. [DOI] [PubMed] [Google Scholar]
  • 43.Baek R. C., Broekman M. L., Leroy S. G., Tierney L. A., Sandberg M. A., d’Azzo A., Seyfried T. N., Sena-Esteves M. 2010. AAV-mediated gene delivery in adult GM1-gangliosidosis mice corrects lysosomal storage in CNS and improves survival. PLoS ONE. 5: e13468. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Baek R. C., Kasperzyk J. L., Platt F. M., Seyfried T. N. 2008. N-butyldeoxygalactonojirimycin reduces brain ganglioside and GM2 content in neonatal Sandhoff disease mice. Neurochem. Int. 52: 1125–1133. [DOI] [PubMed] [Google Scholar]
  • 45.Seyfried T. N., Glaser G. H., Yu R. K. 1978. Cerebral, cerebellar, and brain stem gangliosides in mice susceptible to audiogenic seizures. J. Neurochem. 31: 21–27. [DOI] [PubMed] [Google Scholar]
  • 46.Macala L. J., Yu R. K., Ando S. 1983. Analysis of brain lipids by high performance thin-layer chromatography and densitometry. J. Lipid Res. 24: 1243–1250. [PubMed] [Google Scholar]
  • 47.Folch J., Lees M., Sloane-Stanley G. H. 1957. A simple method for the isolation and purification of total lipids from animal tissues. J. Biol. Chem. 226: 497–509. [PubMed] [Google Scholar]
  • 48.Seyfried T. N., Weber E. J., Yu R. K. 1977. Influence of trichloroacetic acid-phosphotungstic acid on the thin-layer chromatographic mobility of gangliosides. Lipids. 12: 979–980. [DOI] [PubMed] [Google Scholar]
  • 49.Gross S., Summers A., McCluer R. H. 1977. Formation of ganglioside internal esters by treatment with trichloroacetic acid-phosphotungstic acid reagent. J. Neurochem. 28: 1133–1136. [DOI] [PubMed] [Google Scholar]
  • 50.Ando S., Chang N. C., Yu R. K. 1978. High-performance thin-layer chromatography and densitometric determination of brain ganglioside compositions of several species. Anal. Biochem. 89: 437–450. [DOI] [PubMed] [Google Scholar]
  • 51.Seyfried T. N., Yu R. K., Miyazawa N. 1982. Differential cellular enrichment of gangliosides in the mouse cerebellum: Analysis using neurological mutants. J. Neurochem. 38: 551–559. [DOI] [PubMed] [Google Scholar]
  • 52.Arthur J. R., Heinecke K. A., Seyfried T. N. 2011. Filipin recognizes both GM1 and cholesterol in GM1 gangliosidosis mouse brain. J. Lipid Res. 52: 1345–1351. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Yang K., Cheng H., Gross R. W., Han X. 2009. Automated lipid identification and quantification by multidimensional mass spectrometry-based shotgun lipidomics. Anal. Chem. 81: 4356–4368. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Phaneuf D., Wakamatsu N., Huang J. Q., Borowski A., Peterson A. C., Fortunato S. R., Ritter G., Igdoura S. A., Morales C. R., Benoit G., et al. 1996. Dramatically different phenotypes in mouse models of human Tay-Sachs and Sandhoff diseases. Hum. Mol. Genet. 5: 1–14. [DOI] [PubMed] [Google Scholar]
  • 55.Futerman A. H., van Meer G. 2004. The cell biology of lysosomal storage disorders. Nat. Rev. Mol. Cell Biol. 5: 554–565. [DOI] [PubMed] [Google Scholar]
  • 56.Hullin-Matsuda F., Luquain-Costaz C., Bouvier J., Delton-Vandenbroucke I. 2009. Bis(monoacylglycero)phosphate, a peculiar phospholipid to control the fate of cholesterol: Implications in pathology. Prostaglandins Leukot. Essent. Fatty Acids. 81: 313–324. [DOI] [PubMed] [Google Scholar]
  • 57.Kobayashi T., Beuchat M. H., Chevallier J., Makino A., Mayran N., Escola J. M., Lebrand C., Cosson P., Kobayashi T., Gruenberg J. 2002. Separation and characterization of late endosomal membrane domains. J. Biol. Chem. 277: 32157–32164. [DOI] [PubMed] [Google Scholar]
  • 58.Arthur J. R., Wilson M. W., Larsen S. D., Rockwell H. E., Shayman J. A., Seyfried T. N. 2013. Ethylenedioxy-PIP2 oxalate reduces ganglioside storage in juvenile Sandhoff disease mice. Neurochem. Res. 38: 866–875. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Kobayashi T., Stang E., Fang K. S., de Moerloose P., Parton R. G., Gruenberg J. 1998. A lipid associated with the antiphospholipid syndrome regulates endosome structure and function. Nature. 392: 193–197. [DOI] [PubMed] [Google Scholar]
  • 60.Hayakawa T., Hirano Y., Makino A., Michaud S., Lagarde M., Pageaux J. F., Doutheau A., Ito K., Fujisawa T., Takahashi H., et al. 2006. Differential membrane packing of stereoisomers of bis(monoacylglycero)phosphate. Biochemistry. 45: 9198–9209. [DOI] [PubMed] [Google Scholar]
  • 61.Reaves B. J., Row P. E., Bright N. A., Luzio J. P., Davidson H. W. 2000. Loss of cation-independent mannose 6-phosphate receptor expression promotes the accumulation of lysobisphosphatidic acid in multilamellar bodies. J. Cell Sci. 113: 4099–4108. [DOI] [PubMed] [Google Scholar]
  • 62.Sandhoff K. 2013. Metabolic and cellular bases of sphingolipidoses. Biochem. Soc. Trans. 41: 1562–1568. [DOI] [PubMed] [Google Scholar]
  • 63.Wendeler M., Hoernschemeyer J., John M., Werth N., Schoeniger M., Lemm T., Hartmann R., Kessler H., Sandhoff K. 2004. Expression of the GM2-activator protein in the methylotrophic yeast Pichia pastoris, purification, isotopic labeling, and biophysical characterization. Protein Expr. Purif. 34: 147–157. [DOI] [PubMed] [Google Scholar]
  • 64.Kobayashi T., Beuchat M. H., Lindsay M., Frias S., Palmiter R. D., Sakuraba H., Parton R. G., Gruenberg J. 1999. Late endosomal membranes rich in lysobisphosphatidic acid regulate cholesterol transport. Nat. Cell Biol. 1: 113–118. [DOI] [PubMed] [Google Scholar]
  • 65.Chevallier J., Chamoun Z., Jiang G., Prestwich G., Sakai N., Matile S., Parton R. G., Gruenberg J. 2008. Lysobisphosphatidic acid controls endosomal cholesterol levels. J. Biol. Chem. 283: 27871–27880. [DOI] [PubMed] [Google Scholar]
  • 66.Jeyakumar M., Thomas R., Elliot-Smith E., Smith D. A., van der Spoel A. C., d’Azzo A., Perry V. H., Butters T. D., Dwek R. A., Platt F. M. 2003. Central nervous system inflammation is a hallmark of pathogenesis in mouse models of GM1 and GM2 gangliosidosis. Brain. 126: 974–987. [DOI] [PubMed] [Google Scholar]
  • 67.Sano R., Tessitore A., Ingrassia A., d’Azzo A. 2005. Chemokine-induced recruitment of genetically modified bone marrow cells into the CNS of GM1-gangliosidosis mice corrects neuronal pathology. Blood. 106: 2259–2268. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Sargeant T. J., Wang S., Bradley J., Smith N. J., Raha A. A., McNair R., Ziegler R. J., Cheng S. H., Cox T. M., Cachon-Gonzalez M. B. 2011. Adeno-associated virus-mediated expression of beta-hexosaminidase prevents neuronal loss in the Sandhoff mouse brain. Hum. Mol. Genet. 20: 4371–4380. [DOI] [PubMed] [Google Scholar]
  • 69.Wherrett J. R., Huterer S. 1973. Bis-(monoacylglyceryl)-phosphate of rat and human liver: fatty acid composition and NMR spectroscopy. Lipids. 8: 531–533. [DOI] [PubMed] [Google Scholar]
  • 70.Luquain C., Dolmazon R., Enderlin J. M., Laugier C., Lagarde M., Pageaux J. F. 2000. Bis(monoacylglycerol) phosphate in rat uterine stromal cells: structural characterization and specific esterification of docosahexaenoic acid. Biochem. J. 351: 795–804. [PMC free article] [PubMed] [Google Scholar]
  • 71.Holbrook P. G., Pannell L. K., Murata Y., Daly J. W. 1992. Bis(monoacylglycero)phosphate from PC12 cells, a phospholipid that can comigrate with phosphatidic acid: molecular species analysis by fast atom bombardment mass spectrometry. Biochim. Biophys. Acta. 1125: 330–334. [DOI] [PubMed] [Google Scholar]
  • 72.Besson N., Hullin-Matsuda F., Makino A., Murate M., Lagarde M., Pageaux J. F., Kobayashi T., Delton-Vandenbroucke I. 2006. Selective incorporation of docosahexaenoic acid into lysobisphosphatidic acid in cultured THP-1 macrophages. Lipids. 41: 189–196. [DOI] [PubMed] [Google Scholar]
  • 73.Bouvier J., Zemski Berry K. A., Hullin-Matsuda F., Makino A., Michaud S., Geloen A., Murphy R. C., Kobayashi T., Lagarde M., Delton-Vandenbroucke I. 2009. Selective decrease of bis(monoacylglycero)phosphate content in macrophages by high supplementation with docosahexaenoic acid. J. Lipid Res. 50: 243–255. [DOI] [PubMed] [Google Scholar]
  • 74.Huterer S., Wherrett J. 1979. Metabolism of bis(monoacylglycero)phosphate in macrophages. J. Lipid Res. 20: 966–973. [PubMed] [Google Scholar]
  • 75.Mason R. J., Stossel T. P., Vaughan M. 1972. Lipids of alveolar macrophages, polymorphonuclear leukocytes, and their phagocytic vesicles. J. Clin. Invest. 51: 2399–2407. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Cochran F. R., Roddick V. L., Connor J. R., Thornburg J. T., Waite M. 1987. Regulation of arachidonic acid metabolism in resident and BCG-activated alveolar macrophages: role of lyso(bis)phosphatidic acid. J. Immunol. 138: 1877–1883. [PubMed] [Google Scholar]
  • 77.Nakashima S., Nagata K., Banno Y., Sakiyama T., Kitagawa T., Miyawaki S., Nozawa Y. 1984. A mouse model for Niemann-Pick disease: phospholipid class and fatty acid composition of various tissues. J. Lipid Res. 25: 219–227. [PubMed] [Google Scholar]
  • 78.Mortuza G. B., Neville W. A., Delaney J., Waterfield C. J., Camilleri P. 2003. Characterisation of a potential biomarker of phospholipidosis from amiodarone-treated rats. Biochim. Biophys. Acta. 1631: 136–146. [DOI] [PubMed] [Google Scholar]
  • 79.Baronas E. T., Lee J. W., Alden C., Hsieh F. Y. 2007. Biomarkers to monitor drug-induced phospholipidosis. Toxicol. Appl. Pharmacol. 218: 72–78. [DOI] [PubMed] [Google Scholar]
  • 80.Tjiong H. B., Lepthin J., Debuch H. 1978. Lysosomal phospholipids from rat liver after treatment with different drugs. Hoppe Seylers Z. Physiol. Chem. 359: 63–69. [DOI] [PubMed] [Google Scholar]
  • 81.Harder A., Debuch H. 1982. Effect of chloroquine treatment on the different phospholipid species of rat liver lysosomes. Hoppe Seylers Z. Physiol. Chem. 363: 717–723. [DOI] [PubMed] [Google Scholar]
  • 82.Stremmel W., Debuch H. 1976. Bis(monoacylglycero)phosphate–a marker lipid of secondary lysosomes [article in German]? Hoppe Seylers Z. Physiol. Chem. 357: 803–810. [PubMed] [Google Scholar]

Articles from Journal of Lipid Research are provided here courtesy of American Society for Biochemistry and Molecular Biology

RESOURCES