Skip to main content
Physiology and Molecular Biology of Plants logoLink to Physiology and Molecular Biology of Plants
. 2015 Mar 15;21(2):179–186. doi: 10.1007/s12298-015-0288-0

Quantitative expression analysis of drought responsive genes in clones of Hevea with varying levels of drought tolerance

Lisha P Luke 1, M B Mohamed Sathik 1,, Molly Thomas 1, Linu Kuruvilla 1, K V Sumesh 1, K Annamalainathan 1
PMCID: PMC4411388  PMID: 25964712

Abstract

In order to meet the ever rising global demand for natural rubber, cultivation of Hevea is being extended to non–traditional regions of India where extreme climatic conditions like drought and low temperature negatively influence the crop performance. In order to ensure maximum productivity, identification of drought tolerant clones of Hevea which can cope up with stress and give better crop yield is essential. Several attempts have been made previously to identify genes that are associated with drought tolerance in Hevea. In the present study, quantitative expression analysis was made using quantitative PCR for seven drought associated transcripts in four clones of Hevea with varying levels of drought tolerance. Among the seven genes studied, Mitogen Activated Protein (MAP) kinase, Myeloblastosis (Myb) transcription factor, C-repeat responsive element/Dehydration Responsive Element (CRT/DRE) binding factor and Nuclear Factor Y subunit A (NFYA) showed a positive association with drought tolerance. Transcripts of ascorbate peroxidase and heat shock protein 70 (HSP 70) did not show any correlation with drought tolerance. Interestingly, catalase gene was found down regulated in all the clones under drought condition. The possible role of these genes based on their level of gene expression in four different clones of Hevea with varying levels of drought tolerance is discussed.

Keywords: Hevea brasiliensis, Drought tolerance, Gene expression analysis, qPCR

Introduction

In India, cultivation of natural rubber (Hevea brasiliensis) is being extended to non-traditional regions like North Konkan, parts of Karnataka, Orissa, Madhya Pradesh which are drought prone during summer and north eastern states which are low temperature prone during winter. The drought prone areas experience soil and atmospheric drought, higher atmospheric temperatures combined with high solar light and low relative humidity (RH) during summer which affect the performance of the crop severely (Chandrasekhar et al. 1990; Devakumar et al. 1998). Drought tolerance capacity of Hevea has been reported to vary with different clones (Chandrasekhar 1997) and among the clones evaluated in the field conditions, clone RRIM 600 exhibited better growth and yield (Dey et al. 1998). In order to obtain maximum growth and yield performance in such non traditional regions, clones with better drought tolerance capacity have to be identified/developed, for which, it is essential to understand the molecular mechanisms involved in drought tolerance.

Plants undergo various alterations at the physiological, biochemical and molecular levels during environmental constraints like drought. To mitigate the effect of drought stress, plants respond inherently by altering their gene expression. An assortment of genes with diverse functions are induced or repressed by abiotic stresses (Shinozaki et al. 2003; Bartels and Sunkar 2005). Drought tolerance is a complex trait that is being influenced by multiple genes, interactions among genes and environmental cues (Tardieu and Tuberosa 2010). Perception of stress signals and activation of complex signaling pathways bring about drastic changes in the cellular gene expression which is a prerequisite for plants to acclimatize under extreme conditions (Kasuga et al. 1999; Tong et al. 2007). It is well established that almost all biotic and abiotic stresses induce oxidative stress by producing higher levels of reactive oxygen species (ROS) such as hydrogen peroxide (H2O2), superoxide anion (O2•−), hydroxyl radical (OH), singlet oxygen (1O2) and nitric oxide (NO). Increased ROS levels under stress conditions induces oxidation of cellular components thus becoming extremely deleterious which damages cellular membranes eventually leading to cell death (Mittler 2002; Dat et al. 2000; Kar 2011).

Studies on the molecular basis of plant responses to drought are critical in furthering our understanding of the regulatory mechanisms for tolerating environmental stresses which can be ultimately utilized to enhance stress tolerance through genetic manipulation (Xiong et al. 2002; Umezawa et al. 2006) or through molecular breeding. Many drought-inducible genes with varying roles have been identified through molecular and genomic analyses of Arabidopsis, rice and other species. Recently, the signal transduction and gene networks involved in the drought response and tolerance have been extensively reviewed (Golldack et al. 2014; Nakashima et al. 2014) in which signaling mechanism, transcriptional regulatory network and their cross-talk in various abiotic stress responses are discussed. Both the reviews highlight the central role of transcription factors (TFs) in abiotic stress response and tolerance mechanisms.

In Hevea, drought stress has been reported to influence its yield and general performance (Buttery and Boatman 1976; Sethuraj et al. 1984; Sreelatha et al. 2007, 2011). The metabolic activity of clone RRII 105 has been found to be severely affected during drought stress. The biochemical investigations on antioxidant system like super oxide dismutase (SOD) and peroxidase, C-serum invertase activity, C-serum thiols, sucrose and ATP levels also indicated its drought susceptibility (Sreelatha et al. 2007). The gas exchange parameters (CO2 assimilation rate and stomatal conductance) measured under drought stress indicated that clone RRIM 600 had least inhibition during summer proving that it is a drought tolerant clone while the clone RRII 414 was severely affected (Sumesh et al. 2011). The clones RRIM 600 and RRII 208 were reported to be surviving well under dry conditions (Singh et al. 2012) and also better yielding (Mydin 2014). All these reports indicate clones RRIM 600 and RRII 208 as drought tolerant and RRII 105 as a moderate clone while RRII 414 as drought susceptible clone.

In rubber, various studies were conducted previously to quantify the level of gene expression of several abiotic stress responsive transcripts (Thomas et al. 2011, 2012 and Sathik et al. 2011, 2012). Thomas et al. (2011) indicated the association of CRT/DRE binding factor (CRT/DRE bf) and ABC transporter protein with drought tolerance by comparing their expression in four different clones of Hevea. Genes such as peroxidase, WRKY transcription factor (WRKY) and Late Embryogenesis Abundant 5 (LEA 5)  protein were reported to have strong association with drought tolerance in Hevea (Sathik et al. 2011; Thomas et al. 2012). Even though tolerance/susceptibility of a particular clone is attributed to many factors, genes/factors that are directly involved in contributing for the drought tolerance have not been identified in Hevea. Hence in the present study, attempts were made to quantify the expression of selected genes specifically with regard to drought tolerance using quantitative real time PCR in four Hevea clones with varying levels of drought tolerance and to identify the candidate gene for drought tolerance.

Materials and methods

Plant material and stress induction

Four Hevea clones, RRII 105 (moderately drought tolerant), RRIM 600 and RRII 208 (drought tolerant) and RRII 414 (drought susceptible) were employed for the present study. The clones were generated by budding of seedlings raised from Hevea seeds at Rubber Research Institute of India (RRII) farm with clonal buds collected from Hevea budwood nursery maintained at RRII. The budded stumps were grown in polythene bags (65 × 35 cm) in open field conditions of RRII nursery. After growing for 6 months (two to three whorl stage) in open field conditions, the plants were transferred to glass house before imposing drought treatment. One set of plants from each clone was subjected to water stress by withholding irrigation for 10 days and the other set of plants was watered on alternate days.

Physiological parameters

The degree of impact of drought stress on young plants was assessed by measuring the net CO2 assimilation rate (A) and stomatal conductance (gs) using a portable photosynthesis system (LI-6400 XT), LI-COR, U.S.A. All the gas exchange measurements were made at a constant CO2 concentration of 400 ppm using a CO2 injector (LI-6400-01, LI-COR, USA) and at 500 μmol m−2 s−1 of light intensity using red LED source (with 10 % blue light) attached with the leaf chamber of LI-6400. Leaf samples from these plants were collected in liquid N2 and stored at -80 °C.

Gene expression analysis

Total RNA was extracted from the leaf samples using the Spectrum Plant Total RNA Kit (Sigma-Aldrich) and cDNA was synthesized using Superscript III reverse transcriptase (Invitrogen) following the manufacturer’s instructions. Suitable primers were designed with Primer 3 Express (Applied Biosystems, USA) and got synthesized by Sigma. The list of primer pairs used in this study is given in Table 1. Quantitative gene expression analysis was eventually carried out using Light Cycler 480 II, Roche Real Time PCR System. qPCR was performed in a 20 μl reaction mixture containing 1 μl from 1/10 dilution of first-strand cDNA reaction, 125 nM of each primer and 10 μl of Lightcycler 480 SYBR Green I Master (Roche Diagnostics Gmbh, Germany). qPCR was performed by incubating the mixture at 95 °C for 7 min, followed by 40 cycles of 95 °C for 20 s and 60 °C for 30 s. This was followed by a melt curve analysis (95 °C for 20 s, 60 °C for 1 min and 95 °C for about 5 min). Each experiment was repeated two to three times and each PCR reaction was performed in triplicate with no template controls (NTC). Reaction efficiency of both the target genes and the endogenous control was calculated based on the formula, Efficiency = 10 (−1/slope) – 1. The slope values of the primers were between −3.2 and −3.5. GAPDH was used as endogenous control for the qPCR analysis. The relative quantification (RQ) values were analyzed (using Light Cycler 480 Software; release 1.5.0) and the expression rate of these genes is represented as fold change.

Table 1.

List of genes and the corresponding primers used for qPCR analysis

Sl. no. Gene Forward primer (5′-3′) Reverse primer (5′-3′)
1 NFYA1 TTGGTGGAAGGATGTGTTTGC ACTCCTCTGGTGGTCAGCTAGAA
2 MAPK CTGTTGTGTGCAAGCAGGTTTT CCCTATGTATGACATGTCGCTCAT
3 CRT/DRE bf AGTCCCGGCATTGCAAAA GAGTCAGCGCCGGAGGAT
4 HSP 70 ATGCCTGAGAGCTCAAATTTGC GGAAACTGCTGGTGGTGTCA
5 MYB tf TGTGACCACTAGAACACCAACTCA TCCTGTGCTCTGCCTGATAAAA
6 APX GTAGAGGATGGTGCCGACAAC CCAAACTTCCCCAGTTACAAGAAA
7 CATALASE TCTCCTTTTCAATGACGCACTTC GCTGAGAGAACCCCACTTCCT
8 GAPDH GCCTGTGATAGTCTTCGGTGTTAG GCAGCCTTATCCTTGTCAGTGAAC

Data analysis

The 2−∆∆Ct method was adopted to analyze the relative changes in gene expression from qPCR experiments (Livak and Schmittgen 2001). The data are presented as the fold change in transcript level normalized to the GAPDH gene, relative to that in irrigated plants. Three biological replications were included in the qPCR analysis for each treatment. Statistical analysis was performed with the relative quantification data using ANOVA. The ratio with P-value <0.05 was adopted as significant for either down or up-regulation.

Results and discussion

In order to quantify the magnitude of expression of the genes, four clones of Hevea viz. RRII 414 (drought susceptible), RRII 105 (moderately tolerant clone), RRIM 600 and RRII 208 (drought tolerant) were exposed to water deficit stress by withholding irrigation. Stomatal conductance was found declining significantly in all the clones under drought stress measured on 10th day of withdrawing water while it was almost nil in RRII 414 (Fig. 1). Among the clones studied, RRIM 600 had better stomatal conductance under drought stress indicating its drought tolerance capacity. Similarly, A was also found significantly inhibited in all the drought imposed plants of all the clones (Fig. 2). While A was severely affected in relatively susceptible clone RRII 414, it was stable in both the tolerant clones (RRIM 600 and RRII 208). Interestingly, the moderate clone RRII 105 also was found to have photosynthetic activity on par with RRIM 600. These results confirmed the drought effect on these plants.

Fig. 1.

Fig. 1

Stomatal conductance (gs) in irrigated and drought imposed plants of four Hevea clones

Fig. 2.

Fig. 2

CO2 assimilation rate (A) in irrigated and drought imposed plants of four Hevea clones

In order to determine the association of the selected genes to drought tolerance/susceptibility and to evaluate their differential expression under stress conditions in various clones of Hevea, quantitative expression analyses were made by qPCR and the results are given in Fig. 3. Our previous investigations on quantitative gene expression analysis with different set of genes in Hevea had confirmed the existence of differential expression under drought stress (Thomas et al. 2012). Among the seven genes investigated in this study, APX was found significantly up regulated in the relatively tolerant clone RRIM 600 and slightly higher in RRII 105 whereas it was found down regulated in RRII 414 and RRII 208. Under drought stress conditions, ROS such as, singlet oxygen (1O2), superoxide (O2•−), hydrogen peroxide (H2O2), and hydroxyl radical (OH) are produced in higher quantities and only the cultivars/genotypes having an improved ROS detoxification process can protect the cells and their organelles from the toxic effect of these species (Apel and Hirt 2004; Mittler 2002; Caverzan et al. 2012). APX is the key enzyme that is involved in detoxification of hydrogen peroxide in plant chloroplasts, cytosol, mitochondria and peroxisomes (Asada 1992). APX activity has been reported to shoot up with other ROS scavenging enzymes such as catalase, SOD and glutathione reductase (GR) (Shigeoka et al. 2002) under stress conditions. The cytosolic APX1 (Koussevitzky et al. 2008), Populus peroxisomal ascorbate peroxidase (PpAPX) (Li et al. 2009) and tomato (Solanum lycopersicum) thylakoid-bound APX (StAPX) genes (Sun et al. 2010) have all shown to improve abiotic stress tolerance. Reduction of its expression in drought tolerant clone like RRII 208 needs to be revisited and involvement of other isoforms of this gene need to be investigated further.

Fig. 3.

Fig. 3

Expression analysis of seven genes in four clones of Hevea under drought condition. (Fold change in log2 ratio). Log 2 ratio >0 up regulated; < 0 down regulated. ± Error bars indicate standard error of three biological replicates

The results of gene expression analysis for CAT indicated down regulation in all the four clones analyzed. Catalases have high specificity for H2O2 and are unique that they do not require cellular reducing equivalent. CATs have a very fast turnover rate, but a much lower affinity for H2O2 than APX. They are known to remove H2O2 produced in the peroxisomes by photorespiration (Noctor et al. 2000), β-oxidation of fatty acids and other enzyme systems such as xanthine oxidase (XOD) coupled to SOD (Sharma et al. 2012). CAT activity has also been found to decrease under conditions that suppress photorespiration, such as elevated CO2 (Azevedo et al. 1998) and high light intensities (Shang and Feierabend 1999). The reduction in catalase expression found in all the clones in this study need to be further investigated.

Expression of MYB transcription factor (Myb) was found significantly higher in both the tolerant clones (RRII 208 and in RRIM 600), whereas it was found moderately up regulated in RRII 105 which is a moderately tolerant clone. But in clone RRII 414, it got significantly down regulated. This trend coincides with the in vivo performance of clones studied and surely indicates the existence of strong correlation between the Myb tf and stress tolerance. The Myb tfs are known to be induced by various abiotic stress factors such as dehydration, osmotic or salinity stress, ABA, wound signalling pathways, cold stress, salt stress, etc. Myb tfs interact with cis-elements in the promoter regions of several stress-related genes through ABA-dependent pathway of stress signalling for the upregulation of abiotic stress responsive genes. Overexpression of Myb tf results in improved drought and salt tolerance in Arabidopsis (Ding et al. 2009), osmotic tolerance (Abe et al. 2003), drought stress in tomato (Vannini et al. 2007) and drought and cold tolerance in the apple transgenic plants (Pasquali et al. 2008). Overexpression of a StMYB1R-1 transgene in potato plants improved tolerance to drought stress while not influencing significant effects on other agronomical traits (Shin et al. 2011). Higher levels of Myb tf in tolerant clones might be attributed to better tolerance found in tolerant clones.

MAP Kinase was found significantly upregulated in RRIM 600 followed by RRII 208 and RRII 105 where it got moderately upregulated when compared to RRII 414 in which  no much change was noticed. MAP kinases play pivotal role in signal transduction pathways. Protein phosphorylation is the most important mechanism for controlling many fundamental cellular processes in all living organisms including plants. A specific class of serine/threonine protein kinases, MAP kinases plays a central role in the transduction of various extra- and intracellular signals (Rodriguez et al. 2010). In a cascade of signalling event, MAPK is phosphorylated and activated by MAPK kinase (MAPKK), which itself is activated by MAPKK kinase (MAPKKK). MAPK signaling triggers expression of a cascade of genes that are involved in cellular protection, desiccation tolerance, ROS scavenging enzymes and DNA damage repair by activating corresponding transcription factors (Neill et al. 2002a, b; Hung et al. 2005; Desikan et al. 2000). Involvement of MAPKs in abiotic stress adaptation has been widely reported in many plant species (Yu et al. 2010; Ning et al. 2010). The distinct higher level of expression found in RRIM 600 and RRII 208, moderate up regulation in RRII 105 and no change in RRII 414 clearly indicate its strong association with drought tolerance. Probably this particular transcript can be employed for further use after proper validation in large number of clones with wide range of tolerance/susceptibility.

The transcript abundance of Nuclear Factor Y subunit A (NFYA) was found more in RRIM 600 and RRII 105 while it was moderate in RRII 208. But it got slightly down regulated in RRII 414. Nuclear Factor Ys are sequence-specific transcription factors with histone-like subunits and they activate transcription by recognizing the CCAAT- box cis-acting element present in about 30 % of eukaryotic promoters in a highly specific manner via the DNA binding domain present in the NFYA subunit. In the case of plants, the CCAAT-box is present mainly in the promoters of genes involved in photosynthesis. In Arabidopsis thaliana NFYA5 transcript is strongly induced by drought stress in an abscisic acid (ABA)-dependent manner (Li et al. 2008). They bind DNA at CCAAT sites as heterotrimeric complexes composed of single subunits and are reported to be regulating drought responses in many plant species (Stephenson et al. 2007; Hackenberg et al. 2012). NFYA’s expression is regulated at transcriptional and post transcriptional level by miR169 (Petroni et al. 2012) and has positive and negative effects on gene expression (González et al. 2012). Upregulation of NFYA in tolerant clones of Hevea in this study indicates its strong association with drought tolerance.

Heat shock protein 70 (HSP 70) was found significantly upregulated in both RRII 105 and in RRIM 600 while it got significantly down regulated in RRII 414 and RRII 208. HSPs perform fundamental role in protecting plant against abiotic stresses (Ahuja et al. 2010; Timperio et al. 2008). They act as molecular chaperones to prevent denaturation or aggregation of target proteins as well as facilitate protein refolding. Many studies have established the influence of Hsp 70 genes in enhancing the plant’s tolerance to environmental stresses (Ono et al. 2001; Rouch et al. 2004; Zhang et al. 2008; Al-Whaibi 2011). Expression of HSP 70 in this study did not exhibit any trend with tolerance or susceptibility of clones. HSP being a strong contributing gene for drought tolerance, its down regulation seen in RRII 208 does not support its relevance as candidate gene for drought tolerance.

Expression of CRT/DRE bf got up regulated in RRII 105, RRIM 600 and RRII 208 whereas it got down regulated in RRII 414. CRT/DRE bf has been reported to be upstream transcription factors that play vital regulatory roles in abiotic stress responses in plants. They bind to promoter cis-element CRT/DRE and activate the expression of downstream genes. Among the DRE binding proteins, the DREB2 subfamily has been reported to be induced by drought and high salinity stress. Transgenic Arabidopsis plants expressing DREB1 B/CBF1 or DREB1 A/CBF3 under the control of CaMV 35S promoter showed strong tolerance to freezing, drought and high salinity stresses suggesting that DREBs/CBFs target multiple genes (Jaglo-Ottosen et al. 1998; Liu et al. 1998; Kasuga et al. 1999). Microarray analyses have indicated that these factors target stress inducible genes containing the conserved DRE or DRE-related core motifs in their promoter regions (Maruyama et al. 2004). Significant upregulation of this particular transcript in the tolerant clones as well as moderate clone and significant down regulation in the susceptible clone indicate its strong association with drought tolerance in young plants of Hevea.

In this study, seven stress responsive transcripts selected specifically from the data of Hevea brasiliensis were validated for their association with drought stress tolerance by quantifying its expression in four different clones among which two are drought tolerant, one clone moderate and one drought susceptible clone. The data of gas exchange parameters also supported the tolerance level found in field conditions. Previous reports on Hevea also indicated RRIM 600 and RRII 208 as tolerant clones that are suitable for drought and cold prone regions (Priyadarshan et al. 2000; Sumesh et al. 2011; Mydin 2014). From the gene expression analysis data, four transcripts were identified to have stronger association with drought tolerance in clones of Hevea with different levels of drought tolerance.

The clone suitable for drought prone regions should have a better ROS scavenging system. As it is known that increased levels of ROS under drought conditions can induce oxidation of cellular components that damage cellular membranes eventually leading to cell death, only a clone with better ROS scavenging system can withstand the severity of summer in such drought prone regions. Among the various free radicals, H2O2 has been known as a potential ROS which is highly damaging especially in the presence of transition metal like Fe2+. H2O2 triggers MAPK signaling cascade that modulates expression of corresponding genes via activation of transcription factors (Neill et al. 2002a, b; Hung et al. 2005). These genes are basically involved in cell wall protection, desiccation tolerance, production of ROS scavenging enzymes and DNA damage repair (Desikan et al. 2000). Among the four transcripts having stronger association with drought tolerance, transcript of MAPK exhibited a perfect correlation with drought tolerance according to the level of drought tolerance they exhibit in the field condition. The level of MAPK expression was found 13, 7.06 and 3.6 fold increased in RRIM 600, RRII 208 and RRII 105 respectively and no change was noticed in clone RRII 414 conforming with our previous findings that RRIM 600 and RRII 208 are drought tolerant (Priyadarshan 2003) and RRII 105, a moderate performer.

In the case of MYB tf, 12, 2 and 1.6 fold upregulation was found in RRII 208, RRIM 600 and RRII 105 respectively while there was down regulation in RRII 414. The upregulation of Myb tf in clone RRIM 600 does not seem to be in proportion to its level in tolerant clone RRII 208, necessitating further investigation in more number of clones with varying levels of drought tolerance. In the case of CRT/DRE bf, higher magnitude of upregulation was found in RRIM 600 (7.4 fold) and RRII 105 (7.3 fold) while it got only 3.2 fold increase in RRII 208. But its expression got down regulated in the drought susceptible clone RRII 414 (0.2 fold times). In the case of transcript NFYA also, there was 6.6, 1.8 and 3.9 fold upregulation in clones RRIM 600, RRII 208 and RRII 105 respectively while there was 0.8 fold reduction in clone RRII 414. Among the four transcripts, though all of them got up regulated in tolerant clones and moderate clone, only MAPK exhibited a stronger correlation with the drought tolerance potential of the clones studied. In the case of APX and HSP 70, no definite trend could be observed while catalase got fully down regulated in all the clones. Catalase activity has been reported to be suppressed under elevated CO2 and high light intensity conditions. The overall down regulation of catalase in all the clones also necessitates further investigation.

This study focuses on expression pattern of seven drought responsive transcripts in young Hevea plants experiencing drought stress among which MAPK exhibited a strong correlation with drought tolerance. But to identify more drought tolerant genes, it is imperative to use a tool by which more number of genes could be screened at one go. The recent technological innovations in new generation sequencing methods such as Illumina column sequencing and larger screening method like microarray can be employed to identify the overall drought responsive transcripts. Moreover, more number of clones with varying levels of drought response/tolerance has to be incorporated in future experiments to narrow down on to the genes contributing for drought tolerance. It would also be possible to identify various isoforms of genes through new generation sequencing technology and subsequent validation of each isoform by microarray and quantitative PCR in order to establish their association with drought tolerance. More such modern approaches are necessary to arrive at the candidate gene/marker for drought tolerance to accomplish the target of identifying/developing drought tolerant clones suitable for non-traditional rubber growing regions with adverse climatic conditions.

Acknowledgments

The authors wish to thank Dr. R. Krishnakumar (Joint Director, RRII) and Dr. James Jacob (Director of Research, RRII) for their constant support and encouragement throughout the course of the work. Ms. Lisha P Luke is grateful to RRII, Rubber Board for the Senior Research Fellowship and financial assistance.

Abbreviations

ROS

Reactive oxygen species

GAPDH

Glyceraldehyde-3-phosphate dehydrogenase

qPCR

quantitative PCR

APX

Ascorbate peroxidase

CAT

Catalase

References

  1. Abe H, Urao T, Ito T, Seki M, Shinozaki K, et al. Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB) function as transcriptional activators in abscisic acid signaling. Plant Cell. 2003;15:63–78. doi: 10.1105/tpc.006130. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Ahuja I, de Vos RC, Bones AM, Hall RD. Plant molecular stress responses face climate change. Trends Plant Sci. 2010;15:664–674. doi: 10.1016/j.tplants.2010.08.002. [DOI] [PubMed] [Google Scholar]
  3. Al-Whaibi Plant heat-shock proteins: a mini review. J King Saud Univ Sci. 2011;23:139–150. doi: 10.1016/j.jksus.2010.06.022. [DOI] [Google Scholar]
  4. Apel K, Hirt H. Reactive oxygen species: metabolism, oxidative stress, and signal transduction. Annu Rev Plant Biol. 2004;55:373–399. doi: 10.1146/annurev.arplant.55.031903.141701. [DOI] [PubMed] [Google Scholar]
  5. Asada K. Ascorbate peroxidase –a hydrogen peroxide scavenging enzyme in plants. Physiol Plant. 1992;85:235–241. doi: 10.1111/j.1399-3054.1992.tb04728.x. [DOI] [Google Scholar]
  6. Azevedo RA, Alas RM, Smith RJ, Lea PJ (1998) Response of antioxidant enzymes to transfer from elevated carbon dioxide to air and ozone fumigation in the leaves and roots of wild-type and a catalase-deficient mutant of barley. Physiol Plant 104:280–292
  7. Bartels D, Sunkar R. Drought and salt tolerance in plants. Crit Rev Plant Sci. 2005;21:1–36. [Google Scholar]
  8. Buttery BR, Boatman SG. Water deficit and flow of latex. In: Kozlowski, editor. Water deficit and plant growth. New York: Academic; 1976. pp. 233–289. [Google Scholar]
  9. Caverzan A, Passaia G, Rosa SB, Ribeiro CW, Lazzarotto F, Margis-Pinheiro M. Plant responses to stresses: role of ascorbate peroxidase in the antioxidant protection. Genet Mol Biol. 2012;35:1011–1019. doi: 10.1590/S1415-47572012000600016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Chandrasekhar TR. Stomatal response of Hevea to atmospheric and soil moisture stress under dry subhumid climatic conditions. J Plant Crop. 1997;25:146–151. [Google Scholar]
  11. Chandrasekhar TR, Jana MK, Thomas J, Vijayakumar KR, Sethuraj MR (1990) Seasonal changes in physiological characteristics and yield in newly opened trees of Hevea brasiliensis in North Konkan. Indian J Nat Rub Res 3:88–97
  12. Dat J, Vandenabeele S, Vranová E, Van Montagu M, Inzé D, Van Breusegem F. Dual action of the active oxygen species during plant stress responses. Cell Mol Life Sci. 2000;57:779–795. doi: 10.1007/s000180050041. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Desikan R, Neill SJ, Hancock JT. Hydrogen peroxide-induced gene expression in Arabidopsis thaliana. Free Radic Biol Med. 2000;28:773–778. doi: 10.1016/S0891-5849(00)00157-X. [DOI] [PubMed] [Google Scholar]
  14. Devakumar AS, Sathik MBM, Jacob J, Annamalainathan K, Prakash P, Vijaykumar KR (1998) Effects of atmospheric and soil drought on growth and development of Hevea brasiliensis. J Rub Res 1:190–198
  15. Dey SK, Chandrasekhar TR, Nair DB, Vijaykumar KR, Jacob J, Sethuraj MR (1998) Effect of some agroclimatic factors on the growth of rubber (Hevea brasiliensis) in humid and dry subhumid location. Indian J Nat Rub Res 11:104–109
  16. Ding Z, Li S, An X, Liu X, Qin H, Wang D (2009) Transgenic expression of MYB15 confers enhanced sensitivity to abscisic acid and improved drought tolerance in Arabidopsis thaliana. J Genet Genomics 36:17–29 [DOI] [PubMed]
  17. Golldack D, Li C, Mohan H, Probst N. Tolerance to drought and salt stress in plants: unraveling the signaling networks. Front Plant Sci. 2014;5:151. doi: 10.3389/fpls.2014.00151. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. González MA, Ibarra-Laclette E, Cruz-Ramírez A, Herrera-Estrella L (2012) Functional and transcriptome analysis reveals an acclimatization strategy for abiotic stress tolerance mediated by Arabidopsis NF-YA family members. PLoS ONE 7(10):e48138. doi:10.1371/journal.pone.0048138 [DOI] [PMC free article] [PubMed]
  19. Hackenberg D, Wu Y, Voigt A, Adams R, Schramm P et al (2012) Studies on differential nuclear translocation mechanism and assembly of the three subunits of the Arabidopsis thaliana transcription factor NF-Y. Mol Plant 5:876–888 [DOI] [PubMed]
  20. Hung S-H, Yu C-W, Lin CH. Hydrogen peroxide functions as a stress signal in plants. Bot Bull Acad Sin. 2005;46:1–10. [Google Scholar]
  21. Jaglo-Ottosen KR, Gilmour SJ, Zarka DG, Schabenberger O, Thomashow MF. Arabidopsis CBF1 overexpression induces COR genes and enhances freezing tolerance. Science. 1998;280:104–106. doi: 10.1126/science.280.5360.104. [DOI] [PubMed] [Google Scholar]
  22. Kar RK. Plant responses to water stress. Role of reactive oxygen species. Plant Signal Behav. 2011;6:1741–1745. doi: 10.4161/psb.6.11.17729. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Kasuga M, Liu Q, Miura S, Yamaguchi-Shinozaki K, Shinozaki K. Improving plant drought, salt, and freezing tolerance by gene transfer of a single stress-inducible transcription factor. Nat Biotechnol. 1999;17:287–291. doi: 10.1038/7036. [DOI] [PubMed] [Google Scholar]
  24. Koussevitzky S, Suzuki N, Huntington S, Armijo L, Sha W, Cortes D, Shulaev V, Mittler R. Ascorbate peroxidase1 plays a key role in the response of Arabidopsis thaliana to stress combination. J Biol Chem. 2008;283:34197–34203. doi: 10.1074/jbc.M806337200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Li WX, Oono Y, Zhu J, He XJ, Wu JM, Iida K, Lu XY, Cui X, Jin H, Zhu JK. The Arabidopsis NFYA5 transcription factor is regulated transcriptionally and post transcriptionally to promote drought resistance. Plant Cell. 2008;20:2238–2251. doi: 10.1105/tpc.108.059444. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Li Y-J, Hai R-L, Du X-H, Jiang X-N, Lu H. Overexpression of a Populus peroxisomal ascorbate peroxidase (PpAPX) gene in tobacco plants enhances stress tolerance. Plant Breed. 2009;128:404–410. doi: 10.1111/j.1439-0523.2008.01593.x. [DOI] [Google Scholar]
  27. Liu Q, Kasuga M, Sakuma Y, Abe H, Miura S, Goda H, Shimada Y, Yoshida S, Shinozaki K, Yamaguchi-Shinozaki K. Two transcription factors, DREB1 and DREB2, with an EREBP/AP2 DNA binding domain separate two cellular signal transduction pathways in drought- and low-temperature-responsive gene expression, respectively, in Arabidopsis. Plant Cell. 1998;10:391–406. doi: 10.1105/tpc.10.8.1391. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real time quantitative PCR and the 2−∆∆Ct method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  29. Maruyama K, Sakuma Y, Kasuga M, Ito Y, Seki M, Goda H, Shimada Y, Yoshida S, Shinozaki K, Yamaguchi-Shinozaki K. Identification of cold-inducible downstream genes of the Arabidopsis DREB1A/CBF3 transcriptional factor using two microarray systems. Plant J. 2004;38:982–993. doi: 10.1111/j.1365-313X.2004.02100.x. [DOI] [PubMed] [Google Scholar]
  30. Mittler R. Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci. 2002;7:405–410. doi: 10.1016/S1360-1385(02)02312-9. [DOI] [PubMed] [Google Scholar]
  31. Mydin KK. Genetic improvement of Hevea brasiliensis: sixty years of breeding efforts in India. Rubber Sci. 2014;27:153–181. [Google Scholar]
  32. Nakashima K, Yamaguchi-Shinozaki K, Shinozaki K. The transcriptional regulatory network in the drought response and its crosstalk in abiotic stress responses including drought, cold, and heat. Front Plant Sci. 2014;5:170. doi: 10.3389/fpls.2014.00170. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Neill S, Desikan R, Hancock J. Hydrogen peroxide signaling. Curr Opin Plant Biol. 2002;5:388–395. doi: 10.1016/S1369-5266(02)00282-0. [DOI] [PubMed] [Google Scholar]
  34. Neill SJ, Desikan R, Clarke A, Hurst RD, Hancock JT. Hydrogen peroxide and nitric oxide as signalling molecules in plants. J Exp Bot. 2002;53:1237–1247. doi: 10.1093/jexbot/53.372.1237. [DOI] [PubMed] [Google Scholar]
  35. Ning J, Li X, Hicks LM, Xiong L. A Raf-like MAPKKK gene DSM1 mediated drought resistance through reactive oxygen species scavenging in rice. Plant Physiol. 2010;152:876–890. doi: 10.1104/pp.109.149856. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Noctor G, Veljovic-Jovanovic S, Foyer CH. Peroxide processing in photosynthesis: antioxidant coupling and redox signalling. Philos Trans R Soc Lond B. 2000;355:1465–1475. doi: 10.1098/rstb.2000.0707. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Ono K, Hibino T, Kohinata T, Suzuki S, Tanaka Y, Nakamura T, Takabe T. Overexpression of DnaK from a halotolerant cyanobacterium Aphanothece halophytica enhances the high-temperature tolerance of tobacco during germination and early growth. Plant Sci. 2001;160:455–461. doi: 10.1016/S0168-9452(00)00412-X. [DOI] [PubMed] [Google Scholar]
  38. Pasquali G, Biricolti S, Locatelli F, Baldoni E, Mattana M. Osmyb4 expression improves adaptive responses to drought and cold stress in transgenic apples. Plant Cell Rep. 2008;27:1677–1686. doi: 10.1007/s00299-008-0587-9. [DOI] [PubMed] [Google Scholar]
  39. Petroni K, Kumimoto RW, Gnesutta N, Calvenzani V, Fornari M, et al. The promiscuous life of plant NUCLEAR FACTOR Y transcription factors. Plant Cell. 2012;24:4777–4792. doi: 10.1105/tpc.112.105734. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Priyadarshan PM. Breeding Hevea brasiliensis for environmental constraints. Adv Agron. 2003;79:351–400. doi: 10.1016/S0065-2113(02)79007-X. [DOI] [Google Scholar]
  41. Priyadarshan PM, Sudhasoumyalatha MK, Sasikumar S, Dey SK, Varghese YA (2000) Evaluation of Hevea brasiliensis clones for yielding trends in Tripura. Indian J Nat Rub Res 11:67–72
  42. Rodriguez MC, Petersen M, Mundy J. Mitogen-activated protein kinase signaling in plants. Annu Rev Plant Biol. 2010;61:621–649. doi: 10.1146/annurev-arplant-042809-112252. [DOI] [PubMed] [Google Scholar]
  43. Rouch JM, Bingham SE, Sommerfeld MR. Protein expression during heat stress in thermo-intolerance and thermotolerance diatoms. J Exp Mar Biol Ecol. 2004;306:231–243. doi: 10.1016/j.jembe.2004.01.009. [DOI] [Google Scholar]
  44. Sathik MBM, Luke LP, Thomas M, Sumesh KV, Satheesh PR (2011) Identification of drought tolerant genes by quantitative expression analysis in Hevea brasiliensis IRRDB International Rubber Conference, 15 –16 Dec. Chiang Main, Thailand
  45. Sathik MBM, Kuruvilla L, Thomas M, Luke LP, Satheesh PR, Annamalainathan K, Jacob J. Quantitative expression analysis of stress responsive genes under cold stress in Hevea brasiliensis. Rubber Sci. 2012;25:199–213. [Google Scholar]
  46. Sethuraj MR, Rao CG, Raghavendra AS (1984) The pattern of latex flow from rubber tree (Hevea brasiliensis) in relation to water stress. J Cell Biochem Suppl 8B:236
  47. Shang W, Feierabend J. Dependence of catalase photoinactivation in rye leaves on light intensity and quality and characterization of a chloroplast-mediated inactivation in red light. Photosynth Res. 1999;59:201–213. doi: 10.1023/A:1006139316546. [DOI] [Google Scholar]
  48. Sharma P, Bhusan A, Dubey RS, Pessarakli M. Reactive oxygen species, oxidative damage, and antioxidative defense mechanism in plants under stressful conditions. J Bot. 2012;2012 [Google Scholar]
  49. Shigeoka S, Ishikawa T, Tamoi M, Miyagawa Y, Takeda T, Yabuta Y, Yoshimura K. Regulation and function of ascorbate peroxidase isoenzymes. J Exp Bot. 2002;53:1305–1319. doi: 10.1093/jexbot/53.372.1305. [DOI] [PubMed] [Google Scholar]
  50. Shin D, Moon SJ, Han S, Kim BG, Park SR, et al. Expression of StMYB1R-1, a novel potato single MYB-like domain transcription factor, increases drought tolerance. Plant Physiol. 2011;155:421–432. doi: 10.1104/pp.110.163634. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Shinozaki K, Yamaguchi-Shinozaki K, Seki M. Regulatory network of gene expression in the drought and cold stress responses. Curr Opin Plant Biol. 2003;6:410–417. doi: 10.1016/S1369-5266(03)00092-X. [DOI] [PubMed] [Google Scholar]
  52. Singh M, Chandrasekhar TR, Nazeer MA, Annamalainathan K, Mydin KK (2012) Performance of some clones of Hevea brasiliensis in the dry subhumid regions of North Konkan. International Rubber Conference, 28 –31 Oct 2012, Kovalam, India
  53. Sreelatha S, Simon SP, Kurup GM, Vijayakumar KR (2007) Biochemical mechanisms associated with low yield during stress in Hevea clone RRII 105. J Rub Res 10:107–150
  54. Sreelatha S, Mydin KK, Simon SP, Krishnakumar R, Jacob J, Annamalainathan K (2011) Seasonal variations in yield and associated biochemical changes in RRII 400 series clones of Hevea brasiliensis. Nat Rub Res 24:117–123
  55. Stephenson TJ, McIntyre CL, Collet C, Xue GP. Genome-wide identification and expression analysis of the NF-Y family of transcription factors in Triticum aestivum. Plant Mol Biol. 2007;65:77–92. doi: 10.1007/s11103-007-9200-9. [DOI] [PubMed] [Google Scholar]
  56. Sumesh KV, Satheesh PR, Annamalainathan K, Krishnakumar R, Thomas M, Jacob J (2011) Physiological evaluation of a few modern Hevea clones for intrinsic drought tolerance. Nat Rub Res 24:61–67
  57. Sun WH, Duan M, Shu DF, Yang S, Meng QW. Over-expression of StAPX in tobacco improves seed germination and increases early seedling tolerance to salinity and osmotic stresses. Plant Cell Rep. 2010;29:917–926. doi: 10.1007/s00299-010-0878-9. [DOI] [PubMed] [Google Scholar]
  58. Tardieu F, Tuberosa R. Dissection and modelling of abiotic stress tolerance in plants. Curr Opin Plant Biol. 2010;13:206–212. doi: 10.1016/j.pbi.2009.12.012. [DOI] [PubMed] [Google Scholar]
  59. Thomas M, Sathik MBM, Saha T, Jacob J, Schaffner AR, Luke LP, Kuruvilla L, Annamalainathan K, Krishnakumar R (2011) Screening of drought responsive transcripts of Hevea brasiliensis and identification of candidate genes for drought tolerance. J Plant Biol 38&39:111–118
  60. Thomas M, Sathik MBM, Luke LP, Sumesh KV, Satheesh PR, Annamalainathan K, Jacob J. Stress responsive transcripts and their association with drought tolerance in Hevea brasiliensis. J Plant Crop. 2012;40:180–187. [Google Scholar]
  61. Timperio AM, Egidi MG, Zolla L. Proteomics applied on plant abiotic stresses: role of heat shock proteins (HSP) J Proteome. 2008;71:391–411. doi: 10.1016/j.jprot.2008.07.005. [DOI] [PubMed] [Google Scholar]
  62. Tong S, Ni Z, Peng H, Dong G, Sun Q (2007) Ectopic overexpression of wheat TaSrg6 gene confers water stress tolerance in Arabidopsis. Plant Sci 172:1079–1086
  63. Umezawa T, Yoshida R, Maruyama K, Yamaguchi-Shinozaki K, Shinozaki K. Engineering drought tolerance in plants: discovering and tailoring genes to unlock the future. Curr Opin Biotechnol. 2006;17:113–122. doi: 10.1016/j.copbio.2006.02.002. [DOI] [PubMed] [Google Scholar]
  64. Vannini C, Campa M, Iriti M, Genga A, Faoro F et al (2007) Evaluation of transgenic tomato plants ectopically expressing the rice Osmyb4 gene. Plant Sci 173:231–239
  65. Xiong L, Schumaker KS, Zhu JK. Cell signalling during cold, drought and salt stress. Plant Cell. 2002;14:S165–S183. doi: 10.1105/tpc.010278. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Yu L, Nie J, Cao C, Jin Y, Yan M, Wang F, et al. Phosphatidic acid mediates salt stress response by regulation of MPK6 in Arabidopsis thaliana. New Phytol. 2010;188:762–773. doi: 10.1111/j.1469-8137.2010.03422.x. [DOI] [PubMed] [Google Scholar]
  67. Zhang JH, Wang LJ, Pan QH, Wang YZ, Zhan JC, Huang WD. Accumulation and subcellular localization of heat shock proteins in young grape leaves during cross-adaptation to temperature stresses. Sci Hortic. 2008;117:231–240. doi: 10.1016/j.scienta.2008.04.012. [DOI] [Google Scholar]

Articles from Physiology and Molecular Biology of Plants are provided here courtesy of Springer

RESOURCES