Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2015 Apr 28.
Published in final edited form as: J Med Virol. 2011 Oct;83(10):1799–1810. doi: 10.1002/jmv.22176

Detection and genetic diversity of human metapneumovirus in hospitalized children with acute respiratory infections in India

Sagarika Banerjee 1, Wayne M Sullender 2,3, Avinash Choudekar 1, Cherian John 1, Vikas Tyagi 1, Karen Fowler 2, Elliot J Lefkowitz 2, Shobha Broor 1,*
PMCID: PMC4412166  NIHMSID: NIHMS405873  PMID: 21837798

Abstract

Human metapneumovirus (hMPV) causes acute respiratory infections in children and adults. It is classified into two major genetic lineages and each lineage into two sublineages. The purpose of the study was to identify and characterize hMPV in children who presented to the All India Institute of Medical Sciences, New Delhi, India with acute respiratory infection from April 2005 to March 2007. By reverse-transcription polymerase chain reaction, hMPV was detected in 21 (3%) of the 662 nasopharyngeal samples from children with acute respiratory infection and in none of the 120 control children. Seven of the 21 (33%) children infected with hMPV required hospital admission for pneumonia or bronchiolitis. Most hMPV detections were during the winter and spring seasons. The majority (67%, 11/21) of children positive for hMPV were within 24 months of age. Phylogenetic analysis of partial F and N gene and the full G gene sequences showed three sub-lineages of hMPV circulated during the study period, B1, B2 and the novel sub-lineage A2b. The circulation pattern of hMPV genotypes varied by season. Comparison of the F and G genes of 8 strains revealed incongruencies in lineage assignments, raising the possibility that recombination had occurred. Sequence analysis also revealed the F gene was relatively conserved whereas the G gene was more variable between the A and B lineages. This study demonstrates that hMPV is an important contributor to acute respiratory infection in children in India, resulting in both outpatient visits and hospitalizations.

Keywords: Human metapneumovirus, acute respiratory infections, pneumonia, fusion protein gene, glycoprotein gene

INTRODUCTION

Human metapneumovirus virus (hMPV) causes 1.5%–12% of acute respiratory tract infections and has been detected in developed and developing countries [Banerjee et al., 2007; Boivin et al., 2002; Esper et al., 2003; Freymouth et al., 2003; Heininger et al., 2009; IJpma et al., 2004; Jartti et al., 2002; Mao et al., 2008; Nissen et al., 2002; Noyola et al., 2005; Peiris et al., 2003; Thanasugarn et al., 2003]. Children less than 5 years of age, elderly adults and immunocompromised patients are at increased risk of severe hMPV infection [Boivin et al., 2002; Pelletier et al., 2002; Peret et al., 2002]. Two main lineages or genotypes of hMPV (genotype A and genotype B) and two sub-lineages in each lineage, namely A1, A2, B1 and B2 have been described, [Biacchesi et al., 2003; Boivin et al., 2004; Huck et al., 2006; Peret et al., 2002; Skiadopoulos et al., 2004; van den Hoogen et al., 2004]. Both genotypes may circulate in one season although the predominating circulating genotype may vary in successive seasons [Agapov et al., 2006; Gerna et al., 2005; Ludewick et al., 2005; Mackay et al., 2006]. The present study spans two years and includes a larger number of samples than two earlier studies from India [Banerjee et al., 2007; Rao et al., 2004]. In the current study reverse transcription- polymerase chain reaction (RT-PCR) was used to detect hMPV from clinical samples, and sequence analysis of F, N and G genes was performed to study genetic variation of hMPV.

MATERIALS AND METHODS

Study Group

Enrollment criteria included ward patients and outpatients < 6 years of age who presented with acute respiratory infection to the pediatric department of All India Institute of Medical Sciences, New Delhi between April 2005 to March 2007. A convenience sampling approach was taken and 662 symptomatic children were enrolled. A subset of these samples was tested previously for other respiratory viruses [Bharaj et al., 2009]. Age and sex matched children from well child clinics were enrolled at a ratio 1:5 to the patient group to serve as asymptomatic controls. One hundred and twenty controls were enrolled during the winter-spring season (2005 October–2006 March and 2006 October–2007 March) as this is the period of maximal respiratory virus detection [Broor et al., 2007]. Nasopharyngeal aspirates were collected from symptomatic children and nasopharyngeal swabs from asymptomatic children as described previously [Banerjee et al., 2007]. The diagnosis and classification of acute respiratory tract infection was made by the attending pediatrician based on World Health Organization Integrated Management of Childhood Illness criteria as have been reported previously [Bharaj et al., 2009; WHO, 2000], Clinical diagnoses were also recorded. Classifications for children with cough or difficulty breathing were as follows: severe pneumonia (severe acute lower respiratory infection) if any general danger signs, chest in-drawing, or stridor was present; pneumonia (acute lower respiratory infection) if fast breathing (2 months up to 12 months, 50 breaths per minute or more and 12 months up to 5 years, 40 breaths per minute or more); no pneumonia or upper respiratory infection if no signs were present of pneumonia or severe pneumonia. Informed consent was obtained from parents of the children. The human ethics committees of All India Institute of Medical Sciences and the institutional review board of the University of Alabama at Birmingham approved the study.

Reverse Transcription-PCR (RT-PCR) and Nucleotide Sequencing

A standard strain of hMPV group A (CAN97-83, kindly provided by Dr. Guy Boivin, Centre de Recherche en Infectologie, Quebec, Canada) was grown in LLCMK2 cells and used as a positive control for standardization of RT-PCR. RNA was extracted from 500μl of nasopharyngeal samples with the RNeasy mini Kit (Qiagen GmbH, Hilden, Germany) as per manufacturer’s instructions. RT-PCR for N and F gene was done as described previously [Banerjee et al., 2007]. Specimens were designated positive if both N and F gene RT-PCR were positive. All specimens were also tested for human β-actin mRNA, to control for RNA extraction and RT-PCR inhibition.

For amplification of the entire G gene a single sense primer and two antisense primers were designed. The forward primer from the beginning of the G gene [GF (nucleotides 6247–6267): ATGGAGGTGAAAGTGGAGAAC] was common to both the external and nested PCR. The two reverse primers GR (nucleotides 7148–7171) GAGATAGACATTAACAGTGGATTC and GNR (nucleotides 7122–7142) GAGGATCCATTGCTATTTGTC were designed from the conserved proximal polymerase (L) gene. The nucleotide position of GF primer is relative to genome of hMPV isolate NL-00-1, (AF371337) and that of GR and GNR primers are relative to genome of hMPV isolate CAN 97–83, (AY297749). The semi-nested G gene PCR amplified 930 base pair that includes the entire G gene, the intergenic region between G and L gene and 23 nucleotides of the L gene.

External PCR for the G gene was done in a one step RT-PCR (QIAGEN OneStep RT-PCR Kit, Qiagen GmbH, Hilden, Germany). Reactions were performed with the following conditions: reverse transcription 50°C 30 min; 95°C for 15 min, 35 cycles of 94°C 1 min, 52°C 1 min, 72°C 1 min; final extension 72°C 10 min. For G gene semi-nested PCR, 1U of Taq DNA polymerase (Larova GmbH, Teltow, Germany) and 1ul of diluted (1:5 to 1:20) external PCR product were used. The conditions for semi-nested G gene PCR were: denaturation at 94°C 5 min, 25 cycles of 94°C 1 min, 53°C 1 min, 72°C 1 min, and final extension 72°C 10 min. The external and semi-nested PCR yielded amplicons of 959 base pair and 930 base pair respectively as seen on 1% agarose gel stained with ethidium bromide.

The nucleotide primers used for detection of hMPV were also used for partial F and N gene sequencing. The primers used for G gene sequencing were GF and GNR. The 401bp amplicon of F gene PCR, 365 bp of N gene and semi-nested G Gene PCR products were purified with a QIAquick gel extraction kit (Qiagen GmbH, Hilden, Germany) and sequenced in forward and reverse directions using the Big Dye Terminator v3.1 Cycle Sequencing Kit and a Gene Amp PCR system 9700 thermal cycler (Applied Biosystems, Foster City, CA, USA).

Sequence Editing and Alignment

Sequence electropherograms were analyzed using BioEdit version 5.0.9 [Hall, 1999] to resolve nucleotide ambiguities. Sequences were handled, edited and formatted using Genedoc version 2.6.002 [Nicholas and Nicholas, 1997]. Alignment of sequences was done using the software CLUSTAL X version 1.83 [Thompson et al., 1997]. Sequence comparisons were made using the Basic Local Alignment Search Tool (BLAST) (http://www.ncbi.nlm.nih.gov/BLAST/).

Phylogenetic Analysis

Phylogenetic and molecular evolutionary analyses were conducted using MEGA version 4 [Tamura et al., 2007]. Statistical significance of tree topology was tested with bootstrapping (1000 replicas). All branches showing bootstrap values greater than 50% were termed statistically significant.

Synonymous and Non-synonymous Mutations

Synonymous and non-synonymous mutations were analyzed by Nei and Gojobori method [Nei and Gojobori, 1986]. The program SNAP (Synonymous/Non-synonymous Analysis Program) provided by the HIV database web site (http://www.hiv.lanl.gov/content/hiv-db/SNAP/WEBSNAP/SNAP.html) was used for analysis of synonymous versus non-synonymous mutations.

Prediction of Glycosylation Sites

NetOglyc (version 3.1) [Julenius et al., 2005] was used to predict the most potential O-glycosylated serine and threonine residues. Potential N-glycosylation acceptor sites (Asn-X-Thr/Ser) have been described for the hMPV F and G proteins [Peret et al., 2004; Schowalter et al., 2006].

Statistical Analysis

Continuous and categorical variables were analyzed using the t-test for independent sample and chi-square tests respectively. Fisher’s exact test was used for categorical observations when a cell had an expected value of less than five variables. For contingency table analyses of symptoms, signs and risk factors associated with hMPV infection, Chi-square or Fisher’s exact tests were used, as appropriate. A comparison of mean age between hMPV infected children with acute lower respiratory infection, seen in the outpatient department and those who were admitted to the ward was calculated using Mann-Whitney U Test. A P-value of <0.05 was considered statistically significant. Statistical analysis was done using SPSS for Windows (Version 15) at biostatistics department of All India Institute of Medical Sciences.

RESULTS

Study Group

The age range of 662 symptomatic children was 1–71 months with a median age of 16 months and a male:female ratio of 1.9:1 (435 males and 227 females). The age range of the 120 asymptomatic control children was 1–68 months with a median age of 13 months and a male:female ratio of 1.1:1 (64 males and 56 females). Of 662 children with acute respiratory infection, 520 children were seen in the outpatient department and 142 were admitted to pediatric ward. Of 520 children seen in outpatient department, 284 had upper respiratory infection, 206 had acute lower respiratory infection and 30 had severe acute lower respiratory infection. Of 142 inpatients, 35 had acute lower respiratory infection and the remaining 107 children had severe acute lower respiratory infection.

Detection of hMPV in Children with Acute Respiratory Infections

Human metapneumovirus was detected in 3% of children with acute respiratory infection, the prevalence was similar among children with upper respiratory infection (9/284) or acute lower respiratory infection (12/378) (Table I). A greater proportion of children with acute lower respiratory infection admitted to the ward had hMPV infection [7/142, (5%)], than those visiting the hospital outpatient department [5/236, (2%)]; however, this difference was not statistically significant [P= 0.13, Pearson χ2 test]. Human metapneumovirus was not detected in any of the 120 control children.

TABLE I.

Detection of hMPV in Clinical Samples from Children

Site of sample collection URI positives/Total URI tested (% positive) Total ALRI positives/Total ALRI tested (% positive) Total positives/Total samples tested (% positive)
Outpatient department 9/284 (3) 5/236 (2*) 14/520 (2.7)
Pediatric Ward - 7#/142 (5*) 7/142 (5)
Total positives/Total samples tested (% positive) 9/284 (3) 12/378 (3) 21/662 (3)
Open in a new tab

URI: Upper Respiratory Infection

ALRI: Acute Lower Respiratory Infection

*

P=0.13, (NS), Pearson χ2 test

#

5/7 had severe acute lower respiratory infection.

Clinical Features and Demographics of Children Infected with hMPV

Children infected with hMPV ranged from 1 month to 55 months of age (median 16 months). Children infected with hMPV who presented with upper respiratory infection were older than those with acute lower respiratory infection but the difference was not statistically significant (mean age 25.7±17.5 months vs 17.5±15.8 months, P=0.255, Mann-Whitney Test). The mean age of hMPV infected children with acute lower respiratory tract infection admitted to the hospital ward was significantly less (9.1 ± 7.1 months) than those seen as outpatients (29.2 ± 17.9 months) [P=0.034, Mann-Whitney Test]. The male female ratio of hMPV infected children was 1.3:1.

The clinical features of acute respiratory infection among children infected with hMPV were not distinctive from children who were not infected with hMPV. The occurrence of cough, runny nose and difficulty in breathing were similar among hMPV infected and non-infected children (data not shown). Fever was seen in 85.7% (18/21) of children with hMPV infection and in 64.6% (414/641) of children not infected with hMPV (P=0.077, Chi-Square Test with Continuity Correction). Given the limited number of hMPV infected children in the study, the statistical comparisons of clinical features associated with hMPV infection must be interpreted cautiously. Nevertheless, 9.5% (2/21) of children infected with hMPV were cyanotic as compared to 1.4% (9/641) of children not infected with hMPV [P=0.044,] and 19% (4/21) of hMPV infected children needed mechanical ventilator support as compared to 5% (34/641) of children not infected with hMPV [P=0.027, Pearson Chi-Square Test].

Seven of 12 hMPV infected children with acute lower respiratory infection were admitted to the hospital, of these 5 had the clinical diagnosis of pneumonia and two bronchiolitis. Chest radiographs of these 7 children showed interstitial infiltration in one, lobar consolidation in one, bronchopneumonia in two, bronchopneumonia and interstitial infiltration in two, and hyperinflation and interstitial infiltration in one inpatient. Three of these 7 inpatients had associated co-morbidities that included congenital heart disease (Tetralogy of Fallot), pulmonary hypertension and congestive heart failure and required mechanical ventilator support due to respiratory distress. Three (42.9%) of them were hospitalized for > 7 days, including one child with underlying co-morbid conditions. All 7 children were given antibiotics, 5 required oxygen supplementation and 4 required mechanical ventilator support. There was one intensive care unit admission and another child died, both had co-morbidities.

Phylogenetic Analysis of Partial F and N Gene Sequences

hMPV F gene sequences fall within two main lineages A and B, each having two sub-lineages A1, A2 and B1, B2 [Biacchesi et al., 2003; Boivin et al., 2004; Huck et al., 2006; Peret et al., 2002; Skiadopoulos et al., 2004; van den Hoogen et al., 2004]. The A2 sub-lineage is further bi-partitioned into two distinct clusters, A2a and A2b [Huck et al., 2006]. F gene sequences of 17 of the 19 Indian hMPV were distinct from comparison sequences (Figure 1). Sequences from two strains (IND/06-12/313OP and IND/06-10/W102) were found to be identical to hMPV F gene sequence from Japan (JPY88-12) [Ishiguro et al., 2005].

Figure 1.

Figure 1

Open in a new tab

Neighbor-joining phylogenetic tree using 359 bp (nt 607–965) of F gene sequences of Indian hMPV strains and reference sequences of lineage A and B. The prototype strains from the Netherlands and Canada of each of the sub-lineages are indicted by triangles. The Indian hMPV strains detected during 2005–2006 winter-spring season are indicated by circles and those detected during 2006–2007 winter-spring season are indicated by squares. Bootstrap values greater than 50% are shown at the branch nodes. Bootstrap values of 98% and 80% that supported the observed bi-partitioning of A2 sub-lineage are encircled. F gene sequences from GenBank of the following reference strains were used to construct the phylogenetic tree:

A1 sub-lineage: NL/00/1, CAN99-81, JPS03-180;

A2a sub-lineage:NL/17/00, CAN97-83;

A2b sub-lineage: JPS03-176, JPS03-178, JPS03-187, JPY88-12, BJ1887, O0601;

B1 sub-lineage:NL/1/99, CAN97-82, JPS02-76, JPS03-194;

B2 sub-lineage: NL/1/94, CAN98-75, BJ1816, CAN00-13, CS113.

Accession numbers of F gene sequences of 19 Indian strains: DQ861908 (IND/06-9/294OP), DQ861909 (IND/06-17/344OP), DQ861910 (IND/06-18/347OP), DQ861911(IND/06-19/351OP), DQ855629 (IND/06-12/313OP), DQ855630 (IND/06-11/311OP), DQ855631 (IND/06-8/268OP), DQ855632 (IND/06-21/365OP), DQ861912 (IND/06-16/W113), DQ855633 (IND/06-10/W102), DQ855634 (IND/06-13/W108), DQ855635 (IND/06-14/W110), DQ855636 (IND/06-15/W112), DQ855637 (IND/06-20/W119), EU259878 (IND/06-23/440OP), EU259879 (IND/06-24/452OP), EU259880 (IND/07-26/507OP), EU259882 (IND/07-27/514OP), EU259881 (IND/07-25/W140).

Neighbour joining phylogenetic analysis of the Indian F gene sequences showed that 9 strains grouped in the A and 10 in the B lineage (Figure 1). Among the A lineage viruses all 9 were in the A2 sub-lineage along with the Chinese and Japanese strains. There was 96.9% to 99.7% homology at the nucleotide level with the Japanese strains (JPS03-176, JPS03-178, JPS03-187, JPY88-12, O0601) and 98.1% to 99.4% nucleotide sequence homology with the Chinese strain (BJ1887). Two of the 9 Indian A2b strains were identical, and the remaining 7 showed 97.2% to 99.7% homology at the nucleotide level and 97.5% to 100% identity at the amino acid level among themselves. The 9 Indian A2b strains also showed 96.4%–98.1% nucleotide sequence homology with the A2 prototype strains of the A2a sub-lineage (NL/17/00 and CAN97-83).

Among the 10 Indian strains belonging to B lineage, 9 grouped in the B1 sub-lineage and 1 in the B2 sub-lineage. Eight of the 9 Indian B1 viruses had identical F gene sequences, 4 were identified in 2007 and 4 in 2006. Among B1 prototype strains (NL/1/99 and CAN97-82) and the Indian B1 strains homology at the nucleotide level was 98.3% to 98.9% and at the amino acid level was 100%. The Indian B1 viruses formed a separate cluster from the prototype strains and also grouped with Japanese strains JPS02-76 and JPS03-194, showing 98.6% to 99.4% nucleotide homology with these viruses.

Between B2 prototype strains (NL/1/94 and CAN98-75) and the Indian B2 strain homology at the nucleotide level was 97.5% to 97.8% and at the amino acid level was 100%. A Chinese strain CS113, showed 99.2% nucleotide homology with the Indian B2 strain and grouped with the Indian B2 strain in a separate cluster from the prototype strains.

Phylogenetic analysis using 340 base pair (nucleotides 69–408) of the N gene (Figure 2) showed the same tree topology as the F gene phylogenetic analysis. Bi-partitioning of A2 was supported by high bootstrap values (98% and 89%).

Figure 2.

Figure 2

Open in a new tab

Neighbor-joining phylogenetic tree using 340 bp (69–408 nucleotides) N gene sequences of Indian hMPV strains and reference sequences of lineage A and B. The prototype strains from the Netherlands and Canada of each of the sub-lineages are indicated by triangles. Twelve Indian hMPV strains detected during 2005–2006 winter-spring season are indicated by circles. Bootstrap values greater than 50% are shown at the branch nodes. Bootstrap values of 98% and 89% that supported the observed bi-partitioning of A2 sub-lineage are encircled. N gene sequences from GenBank of the following reference strains were used to construct the phylogenetic tree.

A1 sub-lineage: NL/00/1, CAN99-81, JPS03-180;

A2a sub-lineage:NL/17/00, CAN97-83;

A2b sub-lineage: JPS03-176, JPS03-178, JPS03-240, JPS03-187, BJ1887;

B1 sub-lineage:NL/1/99, CAN97-82, JPS02-76, JPS03-194;

B2 sub-lineage: NL/1/94, CAN98-75, BJ1816, CAN00-13, CS113.

Accession numbers of N gene sequences of 12 Indian strains: DQ908917(IND/06-9/294OP), DQ908914(IND/06-17/344OP), DQ908915(IND/06-18/347OP), DQ908916(IND 06-19/351OP), DQ908913(IND 06-12/313OP), DQ908907(IND 06-11/311OP), DQ908906(IND 06-8/268OP), DQ908908(IND 06-21/365OP), DQ908909(IND 06-10/W102), DQ908910(IND 06-13/W108), DQ908911(IND 06-14/W110), DQ908912(IND 06-15/W112)

Amino Acid Analysis of Partial F Protein

The predicted partial F protein amino acid sequences of the group A and B hMPV Indian strains were compared to prototype A and B strains respectively (Figure 3A, 3B and 3C). The partial F gene sequences were predicted to encode 119 amino acids (amino acids 202–321 in the full F protein) for both genotype A and B viruses. Seven of the 9 Indian A2b strains showed identical amino acid sequences, in the other two A2b strains amino acid substitutions were observed in each of the strains in different positions; in strain 268OP, K to R substitution was observed at amino acid position 94 and in strain W112, two amino acid substitutions were observed, one at position 102 (R to K) and the other at position 115 (T to F). All 9 Indian B1 strains had identical amino acid sequences.

Figure 3.

Figure 3

Open in a new tab

Alignment of the predicted amino acid sequences of partial F protein (202–321 aa) of Indian hMPV strains belonging to A2 sublineage (Figure 3A), B1 sub-lineage (Figure 3B) and B2 sub-lineage (Figure 3C) with the Canadian (CAN) and Dutch (NL) prototype strains. Only residues that differ from the consensus sequence are shown. Identical amino acids are represented by periods.

The prototype strains of A1 sub-lineage: CAN 99-81, NL/00/1, A2 sub-lineage: CAN 97-83, NL-17-00, B1 sub-lineage: CAN 97-82, NL/1/99, B2 sub-lineage: CAN 98-75, NL/1/94. Amino acid residues unique to sub-lineage A are boxed. Amino acid residues unique to lineage B are shaded in black, the amino acid residue unique to sub-lineage B1 is shaded in dark grey and the amino acid residue unique to sub-lineage B2 is shaded in light gray.

The A and B strains could be differentiated easily on the basis of unique changes. At amino acids 233, 286 and 312 of the F protein (i.e., at 31, 84 and 110 amino acid position of the partial F protein in the study) N, V and Q were present in all the Indian A2b strains whereas at the same positions Y, I and K were present in all the Indian B strains. At amino acid 296 position of F protein (i.e., at 94 amino acid position of the partial F protein in the study) K was present in all the Indian A2b strains (except for 268OP which had an R in place of K), N in all the Indian B1 strains and D in the Indian B2 strain.

The average ratio of synonymous to non-synonymous substitutions (dS/dN) ratio was 33.9 and ranged from 2.2 to >76.0. A ratio of dS/dN is > 1 indicates that evolutionary pressure on F protein is of purifying selection [Nei and Gojobori, 1986].

Seasonal Variability of hMPV Genotypes

From April 2005 through March 2006 there were 25 to 60 samples tested each month for hMPV. None of the samples screened for hMPV during April to November 2005 were positive. From December 2005 to March 2006 fourteen samples were positive for hMPV with a peak in March 2006 (8 samples positive). From April 2006 through March 2007 fewer samples were collected each month (0–10) and 7 were positive for hMPV. From April 2005 to March 2006, co-circulation of two genotypes A2b and B1 was found, with A2b predominating, whereas in the next 12 months both B1 and B2 strains were detected with B1 being predominant. In the entire study period, no hMPV sub-lineage A1 strains were detected.

Sequencing of G Gene of hMPV

G gene sequences of 19 Indian strains were unique as compared to previously reported sequences. Eighteen of the 19 samples clustered in the A2 and one in the B2 sub-lineage by phylogenetic analysis (Figure 4). Interestingly, 8 of the 18 samples clustered in the A2 sub-lineage by G gene analysis were placed in the B1 sub-lineage by F and N gene analysis. Among the 18 A2b strains identified by G gene analysis 13 grouped together in one cluster along with Chinese strain BJ1887 and had 90.4% – 91.2% nucleotide homology with it. Nine of those 13 strains were identical in G gene sequences. The remaining 5 of 18 A2b strains clustered with the Japanese strains JPS03-240 and O0601 and had 95.9% to 97.3% nucleotide homology with these viruses. The 18 Indian A2b strains showed 86.7% to 89.1% nucleotide homology with the A2 prototype strains (NL/17/00 and CAN97-83). The one Indian B2 strain showed 97.2%–99.1% nucleotide homology with the Chinese strains BJ5141, BJ5128, CS113 and CHN01-06 and grouped with them in a separate cluster from the prototype strain (NL/1/94 and CAN98-75).

Figure 4.

Figure 4

Open in a new tab

Neighbor-joining phylogenetic tree using G gene sequences of Indian hMPV strains and reference sequences of lineage A and B. The prototype strains from the Netherlands and Canada of each of the sub-lineages are indicted by triangles. The Indian hMPV strains detected during 2005–2006 winter-spring season are indicated by circles and those detected during 2006–2007 winter-spring season are indicated by squares. Bootstrap values greater than 50% are shown at the branch nodes. Bootstrap values of 96% and 74% that supported the observed bipartitioning of A2 sub-lineage are encircled. The 18 Indian A2b strains group in two separate clusters; one comprising 13 strains (in dotted box) and other comprising 5 strains (in dotted oval). Bootstrap values of 83% and 99% indicated by arrows further confirm the true clustering of 18 Indian A2b strains. Eight A2b Indian strains (*) are the possible recombinants that grouped in B1 lineage in F gene phylogenetic analysis. G gene sequences from GenBank of the following reference strains were used to construct the phylogenetic tree.

A1 sub-lineage: NL/00/1, CAN99-81, JPS03-180

A2a sub-lineage:NL/17/00, CAN97-83, CAN182-02, Arg/4/00

A2b sub-lineage: JPS03-240, BJ1887, CHN05-06, CAN197-02, O0601

B1 sub-lineage:NL/1/99, CAN97-82

B2 sub-lineage: NL/1/94, CAN98-75, UK/5/01, BJ5128, CS113, CHN01-06

Accession numbers of G gene sequences of 19 Indian strains: EU259863 (IND 06-9/294OP), EU259875 (IND 06-17/344OP), EU259871 (IND 06-18/347OP), EU259859 (IND 06-12/313OP), EU259874 (IND 06-11/311OP), EU259868 (IND 06-8/268OP), EU259860 (IND 06-21/365OP), EU259872 (IND 06-22/326OP), EU259869 (IND 06-16/W113), EU259870 (IND 06-10/W102), EU259865 (IND 06-13/W108), EU259867 (IND 06-14/W110), EU259861 (IND 06-15/W112), EU259862 (IND 06-20/W119), EU259876 (IND 06-23/440OP), EU259873 (IND 06-24/452OP), EU259866 (IND 07-25/W140), EU259864 (IND 07-26/507OP), EU259877 (IND 07-27/514OP).

Amino Acid Analysis of G Protein

The predicted amino acid sequences of the Indian A2 and B2 strains were compared to prototype strains of A2 and B2 lineage (Figure 5 and 6). Amino acid changes due to base substitutions were distributed along the entire protein but were more frequent in the extracellular domain of G protein [Bastien et al., 2004; Ishiguro et al., 2004]. The intracellular and transmembrane domains exhibited considerable amino acid homology both between the Indian A2b and B2 strains (64% to 68%) and within (96%) the Indian A2b strains whereas the ectodomains (starting from amino acid position 51) were quite variable (24%–25.3% aa homology) between A2b and B2 strains.

Figure 5.

Figure 5

Open in a new tab

Alignment of the predicted amino acid sequences of G protein of Indian A2b strains with the prototype strains of A2 sub-lineage of hMPV. Proposed intracellular, transmembrane and extracellular domains are indicated by the arrows above the alignment. Numbers indicate amino acid position. Conserved cysteine residue is marked with a dot. Potential N-glycosylation sites are in dotted boxes. The brackets, [ ], represent the potential O-glycosylation region.

Figure 6.

Figure 6

Open in a new tab

Alignment of the predicted amino acid sequences of G protein of Indian B2 strains with the prototype strains and a Chinese strain, CS113 of B2 sub-lineage of hMPV. Proposed intracellular, transmembrane and extracellular domains are indicated by the arrows above the alignment. Numbers indicate amino acid position. Conserved cysteine residue is marked with a dot. Potential N-glycosylation sites are in dotted boxes. The brackets, [ ], represent the potential O-glycosylation region.

The predicted lengths of the G protein of Indian A2b strains were 217, 219 and 228 amino acid residues corresponding to usage of termination codons located at nucleotide position 652 (UAA), 658 (UAG) and 685 (UAG) respectively. The predicted amino acid length of the G protein of Indian B2 strain was 236 residues, corresponding to the termination codon located at nt position 709 (UAA). Proline content ranged from 5.6% to 9.3% among the Indian hMPV G protein sequences. The cysteine residue at position 27, reported to be conserved among all hMPV lineages [Bastien et al., 2004; Ishiguro et al., 2004; Peret et al., 2004], was also present in the Indian hMPV strains. The B lineage G proteins are known to have an additional cysteine residue at amino acid position 65 in the extracellular domain of the G protein; this was also found in the Indian B2 virus [Ishiguro et al., 2004; Peret et al., 2004].

Glycosylation Sites in the G Gene

Sequence analysis revealed threonine and serine contents of 33% to 37% in the G protein of Indian strains making the G protein susceptible to extensive O-glycosylation (Figure 5 and 6). The program NetOglyc predicted 48–60 potential O-linked glycosylation sites (Best General Predictor Score i.e., G score ranging from 0.5 to 0.77), spanning from amino acid position 63 throughout the extracellular domain of the Indian A2b G proteins. In the Indian B2 strain G protein there were 66 (G score ranging from 0.5 to 0.72) potential sites for O-linked glycosylation. Potential N-linked glycosylation sites (Asn-X-Thr/Ser) varied from 2–6 in Indian A2b strains of hMPV (Figure 5) and 3–5 on the Indian B2 strain of hMPV (Figure 6) [Peret et al., 2004].

Analysis of Synonymous and Non-synonymous Mutations in the G Gene

The average ratio of synonymous to non-synonymous substitutions (dS/dN) in G protein of Indian hMPV strains was 1.8 and ranged from 0.33 – 8.25. These values suggest the presence of both positive and negative selective pressure, thereby suggesting neutral selection pressure on G protein of Indian strains.

DISCUSSION

The proportion of samples positive for hMPV in the present study (3%) was within the range described in other studies in children (1.5–12%). This includes reports with lower hMPV detection rates from Australia (1.5%), United Kingdom (2.3%) and Jordan (2.5%) [Hopkins et al., 2008; Kaplan et al., 2008; Nissen et al., 2002]. Rates of hMPV detection in the current report were similar to those in a hospital-based study in USA (3.9%), Spain (4%) and Thailand (4.2%) and a community based study in Nepal (4.2%) [Mathisen et al., 2009; Mullins et al., 2004; Thanasugarn et al., 2003; Vicente et al., 2006]. However, some studies have detected hMPV more commonly, such as in reports from Brazil (11.4%), United States (6.2% to 8.1%), Singapore (5%), Hongkong (5.5%), South Africa (5.8%), Switzerland (5%), and Finland (8%) [Esper et al., 2004; Heininger et al., 2009; IJpma et al., 2004; Jartti et al., 2002; Loo et al., 2007; McAdam et al., 2004; Oliveira et al., 2009; Peiris et al., 2003]. In these studies PCR was used for detection of hMPV, and they showed varied detections of hMPV, which may be due to differences in characteristics of the study populations (such as age) or sensitivity of different PCR assays. Testing for other respiratory viruses has been previously described for a subset of the children in this report [Bharaj et al., 2009]. Multiplex RT-PCR performed on 301 samples from children with acute lower respiratory infection collected from April 2005–March 2007 detected respiratory syncytial virus in 61 (20%), parainfluenza virus 3 in 22 (7%), parainfluenza virus 2 in 17 (6%), hMPV in 11 (3.7%), parainfluenza virus 1 in 10 (3.3%) and influenza A in 9 children (3%). Thus, among these children with acute lower respiratory infection, respiratory syncytial virus and parainfluenza viruses 2 and 3 were identified more commonly than hMPV.

Comparable to other reports [Esper et al., 2003; Freymouth et al., 2003; McAdam et al., 2004; Mullins et al., 2004; van den Hoogen et al., 2003; Williams et al., 2004], the present study showed 67% of children who were infected with hMPV were within 2–24 months of age. In addition, among children infected with hMPV and presented with acute lower respiratory infection, those hospitalized were younger (9.1 ± 7.1 months) than those evaluated in the outpatient setting (29.2 ± 17.9 months). The symptoms found among children infected with hMPV were similar to those described previously for hMPV and other respiratory viruses [Bharaj et al., 2009; Boivin et al., 2002; Esper et al., 2003; van den Hoogen et al., 2001; van den Hoogen et al., 2003]. The clinical diagnoses for hospitalized infants with hMPV infection were pneumonia and bronchiolitis, as reported previously [Boivin et al., 2002; Boivin et al., 2003; Peiris et al., 2003]. Consistent with the findings of the present study, other studies have shown that infection with hMPV may lead to severe respiratory distress requiring prolonged hospitalization, mechanical ventilation and admission to an intensive care unit [Estrada et al., 2007; Heininger et al., 2009; IJpma et al., 2004; Mullins et al., 2004; Vicente et al., 2006]. Thus hMPV infection is associated with a substantial clinical and likely economic impact. Similar to a previous report [van den Hoogen et al., 2001], hMPV was not detected in asymptomatic controls in the present study. However some studies have detected hMPV in asymptomatic individuals [Singleton et al., 2010; van den Hoogen et al., 2003]. One potential limitation of the current study is the possibility that the use of nasopharyngeal swabs from the asymptomatic children lead to reduced detection of hMPV as compared to testing of nasopharyngeal aspirates from ill children.

Previous studies have shown that hMPV infections occur more frequently from December to April in temperate climates [Boivin et al., 2002; Freymouth et al., 2003; Jartti et al., 2002; Williams et al., 2004]. In sub-tropical Delhi in northern India the present study detected hMPV from September through April, with a noticeable peak of detections in March 2006. Relatively fewer samples were tested the following year, precluding evaluation of seasonality in this period. An earlier report from tropical Pune in central India reported the presence of hMPV during July and August [Rao et al., 2004]. Thus, hMPV seasonality might vary in different parts of India.

Phylogenetic analysis of partial F gene sequences in the present study showed both the lineages (A and B) of hMPV circulate in India. In general group A hMPV are reported more commonly than group B [Boivin et al., 2004; Loo et al., 2007; Noyola et al., 2005]. In the present study in 2005–2006, genotype A2b and B1 viruses were detected, of which A2b were more common. In 2006–2007 no genotype A viruses were found, instead co-circulation of B1 and B2 strains was seen with B1 strains predominating.

A study from Germany reported a new sub-lineage A2b formed by partitioning of A2 into A2a and A2b [Huck et al., 2006]. Viruses in the A2b sub-lineage in the present study grouped with viruses reported from Japan and China [Ishiguro et al., 2004] (Figure 2). The A2b sequences from the study in Germany [Huck et al., 2006] were not included in the phylogenetic analysis in the present study as there was only partial overlap of the regions sequenced. Phylogenetic analysis of partial N gene sequences of hMPV strains supported the F gene results. Eight of the 9 strains that had grouped in the B1 sub-lineage by F and N gene phylogenetic analysis clustered in the A2b sublineage by G gene analysis. Dengue viruses that do not show phylogenetic correlation among the genes are assumed to be recombinants [Craig et al., 2003]. Although recombination has been suggested to occur in another paramyxovirus, respiratory syncytial virus, it is thought to be quite rare [Spann et al., 2003; Zheng et al., 1999]. Unfortunately, since the clinical samples had been exhausted and viruses could not be recovered in cell culture additional molecular characterizations could not be done. Thus, whether or not the phylogenetic classification discrepancies observed here were due to recombination or perhaps other mechanisms remains to be determined. G proteins of different amino acid lengths were observed in this study, as has been previously reported [Bastien et al., 2004; Peret et al., 2004]. Of note, this is the first report of N and G gene hMPV nucleotide sequences from India. This study demonstrates that hMPV contributes to acute respiratory infection in children in India, resulting in outpatient visits and hospitalizations. The circulation pattern of hMPV genotypes varies by seasons.

The study also documented the presence of the A2b sub-lineage of hMPV in India. Further studies are needed in developing countries such as India to better understand the clinical significance, seasonality, and molecular epidemiology of hMPV.

Acknowledgments

The project was supported by National Institute of Health (NIH; NIAID R21 AI59792). Financial assistance to Sagarika Banerjee was provided by Council for Scientific and Industrial Research (CSIR), India. The authors would like to thank Mr. Yashpal Yadav for technical assistance.

Footnotes

The work was performed in the Department of Microbiology, All India Institute of Medical Sciences, New Delhi, India.

References

  1. Agapov E, Sumino KC, Gaudreault-Keener M, Storch GA, Holtzman MJ. Genetic variability of human metapneumovirus infection: evidence of a shift in viral genotype without a change in illness. J Infect Dis. 2006;193:396–403. doi: 10.1086/499310. [DOI] [PubMed] [Google Scholar]
  2. Banerjee S, Bharaj P, Sullender W, Kabra SK, Broor S. Human metapneumovirus infections among children with acute respiratory infections seen in a large referral hospital in India. J Clin Virol. 2007;38:70–72. doi: 10.1016/j.jcv.2006.07.003. [DOI] [PubMed] [Google Scholar]
  3. Bastien N, Liu L, Ward D, Taylor T, Li Y. Genetic variability of the G glycoprotein gene of human metapneumovirus. J Clin Microbiol. 2004;42:3532–3537. doi: 10.1128/JCM.42.8.3532-3537.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bharaj P, Sullender WM, Kabra SK, Mani K, Cherian J, Tyagi V, Chahar HS, Kaushik S, Dar L, Broor S. Respiratory viral infections detected by multiplex PCR among pediatric patients with lower respiratory tract infections seen at an urban hospital in Delhi from 2005 to 2007. Virol J. 2009;6:89. doi: 10.1186/1743-422X-6-89. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Biacchesi S, Skiadopoulos MH, Boivin G, Hanson CT, Murphy BR, Collins PL, Buchholz UJ. Genetic diversity between human metapneumovirus subgroups. Virology. 2003;315:1–9. doi: 10.1016/s0042-6822(03)00528-2. [DOI] [PubMed] [Google Scholar]
  6. Boivin G, Abed Y, Pelletier G, Ruel L, Moisan D, Cote S, Peret TC, Erdman DD, Anderson LJ. Virological features and clinical manifestations associated with human metapneumovirus: a new paramyxovirus responsible for acute respiratory-tract infections in all age groups. J Infect Dis. 2002;186:1330–1334. doi: 10.1086/344319. [DOI] [PubMed] [Google Scholar]
  7. Boivin G, De Serres G, Cote S, Gilca R, Abed Y, Rochette L, Bergeron MG, Dery P. Human metapneumovirus infections in hospitalized children. Emerg Infect Dis. 2003;9:634–640. doi: 10.3201/eid0906.030017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Boivin G, Mackay I, Sloots TP, Madhi S, Freymuth F, Wolf D, Shemer-Avni Y, Ludewick H, Gray GC, LeBlanc E. Global genetic diversity of human metapneumovirus fusion gene. Emerg Infect Dis. 2004;10:1154–1157. doi: 10.3201/eid1006.031097. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Broor S, Parveen S, Bharaj P, Prasad VS, Srinivasulu KN, Sumanth KM, Kapoor SK, Fowler K, Sullender WM. A prospective three-year cohort study of the epidemiology and virology of acute respiratory infections of children in rural India. PLoS One. 2007;2:e491. doi: 10.1371/journal.pone.0000491. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Craig S, Thu HM, Lowry K, Wang XF, Holmes EC, Aaskov J. Diverse dengue type 2 virus populations contain recombinant and both parental viruses in a single mosquito host. J Virol. 2003;77:4463–4467. doi: 10.1128/JVI.77.7.4463-4467.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Esper F, Boucher D, Weibel C, Martinello RA, Kahn JS. Human metapneumovirus infection in the United States: clinical manifestations associated with a newly emerging respiratory infection in children. Pediatrics. 2003;111:1407–1410. doi: 10.1542/peds.111.6.1407. [DOI] [PubMed] [Google Scholar]
  12. Esper F, Martinello RA, Boucher D, Weibel C, Ferguson D, Landry ML, Kahn JS. A 1-year experience with human metapneumovirus in children aged <5 years. J Infect Dis. 2004;189:1388–1396. doi: 10.1086/382482. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Estrada B, Carter M, Barik S, Vidal R, Herbert D, Ramsey KM. Severe human metapneumovirus infection in hospitalized children. Clin Pediatr (Phila) 2007;46:258–262. doi: 10.1177/0009922806293896. [DOI] [PubMed] [Google Scholar]
  14. Freymouth F, Vabret A, Legrand L, Eterradossi N, Lafay-Delaire F, Brouard J, Guillois B. Presence of the new human metapneumovirus in French children with bronchiolitis. Pediatr Infect Dis J. 2003;22:92–94. doi: 10.1097/00006454-200301000-00024. [DOI] [PubMed] [Google Scholar]
  15. Gerna G, Campanini G, Rovida F, Sarasini A, Lilleri D, Paolucci S, Marchi A, Baldanti F, Revello MG. Changing circulation rate of human metapneumovirus strains and types among hospitalized pediatric patients during three consecutive winter-spring seasons. Brief report. Arch Virol. 2005;150:2365–2375. doi: 10.1007/s00705-005-0581-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Hall TA. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl Acids Symp Ser. 1999;41:95–98. [Google Scholar]
  17. Heininger U, Kruker AT, Bonhoeffer J, Schaad UB. Human metapneumovirus infections--biannual epidemics and clinical findings in children in the region of Basel, Switzerland. Eur J Pediatr. 2009;168:1455–1460. doi: 10.1007/s00431-009-0949-5. [DOI] [PubMed] [Google Scholar]
  18. Hopkins MJ, Redmond C, Shaw JM, Hart IJ, Hart CA, Smyth RL, Semple MG. Detection and characterisation of human metapneumovirus from children with acute respiratory symptoms in north-west England, UK. J Clin Virol. 2008;42:273–279. doi: 10.1016/j.jcv.2008.03.011. [DOI] [PubMed] [Google Scholar]
  19. Huck B, Scharf G, Neumann-Haefelin D, Puppe W, Weigl J, Falcone V. Novel human metapneumovirus sublineage. Emerg Infect Dis. 2006;12:147–150. doi: 10.3201/eid1201.050772. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. IJpma, Beekhuis D, Cotton MF, Pieper CH, Kimpen JL, van den Hoogen BG, van Doornum GJ, Osterhaus DM. Human metapneumovirus infection in hospital referred South African children. J Med Virol. 2004;73:486–493. doi: 10.1002/jmv.20116. [DOI] [PubMed] [Google Scholar]
  21. Ishiguro N, Ebihara T, Endo R, Ma X, Kikuta H, Ishiko H, Kobayashi K. High genetic diversity of the attachment (G) protein of human metapneumovirus. J Clin Microbiol. 2004;42:3406–3414. doi: 10.1128/JCM.42.8.3406-3414.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Ishiguro N, Ebihara T, Endo R, Ma X, Shirotsuki R, Ochiai S, Ishiko H, Kikuta H. Immunofluorescence assay for detection of human metapneumovirus-specific antibodies by use of baculovirus-expressed fusion protein. Clin Diagn Lab Immunol. 2005;12:202–205. doi: 10.1128/CDLI.12.1.202-205.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Jartti T, van den Hoogen B, Garofalo RP, Osterhaus AD, Ruuskanen O. Metapneumovirus and acute wheezing in children. Lancet. 2002;360:1393–1394. doi: 10.1016/S0140-6736(02)11391-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Julenius K, Molgaard A, Gupta R, Brunak S. Prediction, conservation analysis, and structural characterization of mammalian mucin-type O-glycosylation sites. Glycobiology. 2005;15:153–164. doi: 10.1093/glycob/cwh151. [DOI] [PubMed] [Google Scholar]
  25. Kaplan NM, Dove W, Abd-Eldayem SA, Abu-Zeid AF, Shamoon HE, Hart CA. Molecular epidemiology and disease severity of respiratory syncytial virus in relation to other potential pathogens in children hospitalized with acute respiratory infection in Jordan. J Med Virol. 2008;80:168–174. doi: 10.1002/jmv.21067. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Loo LH, Tan BH, Ng LM, Tee NW, Lin RT, Sugrue RJ. Human Metapneumovirus in Children, Singapore. Emerg Infect Dis. 2007;13:1396–1398. doi: 10.3201/eid1309.070220. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Ludewick HP, Abed Y, van Niekerk N, Boivin G, Klugman KP, Madhi SA. Human metapneumovirus genetic variability, South Africa. Emerg Infect Dis. 2005;11:1074–1078. doi: 10.3201/eid1107.050500. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Mackay IM, Bialasiewicz S, Jacob KC, McQueen E, Arden KE, Nissen MD, Sloots TP. Genetic diversity of human metapneumovirus over 4 consecutive years in Australia. J Infect Dis. 2006;193:1630–1633. doi: 10.1086/504260. [DOI] [PubMed] [Google Scholar]
  29. Mao HW, Yang XQ, Zhao XD. Characterization of human metapneumoviruses isolated in Chongqing, China. Chin Med J (Engl) 2008;121:2254–2257. [PubMed] [Google Scholar]
  30. Mathisen M, Strand TA, Sharma BN, Chandyo RK, Valentiner-Branth P, Basnet S, Adhikari RK, Hvidsten D, Shrestha PS, Sommerfelt H. RNA viruses in community-acquired childhood pneumonia in semi-urban Nepal; a cross-sectional study. BMC Med. 2009;7:35. doi: 10.1186/1741-7015-7-35. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. McAdam AJ, Hasenbein ME, Feldman HA, Cole SE, Offermann JT, Riley AM, Lieu TA. Human metapneumovirus in children tested at a tertiary-care hospital. J Infect Dis. 2004;190:20–26. doi: 10.1086/421120. [DOI] [PubMed] [Google Scholar]
  32. Mullins JA, Erdman DD, Weinberg GA, Edwards K, Hall CB, Walker FJ, Iwane M, Anderson LJ. Human metapneumovirus infection among children hospitalized with acute respiratory illness. Emerg Infect Dis. 2004;10:700–705. doi: 10.3201/eid1004.030555. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Nei M, Gojobori T. Simple methods for estimating the numbers of synonymous and nonsynonymous nucleotide substitutions. Mol Biol Evol. 1986;3:418–426. doi: 10.1093/oxfordjournals.molbev.a040410. [DOI] [PubMed] [Google Scholar]
  34. Nicholas KB, Nicholas HB., Jr GeneDoc version 2.6.002: a tool for editing and annotating multiple sequence alignments. 1997 Available: http://www.psc.edu/biomed/genedoc.
  35. Nissen MD, Siebert DJ, Mackay IM, Sloots TP, Withers SJ. Evidence of human metapneumovirus in Australian children. Med J Aust. 2002;176:188. doi: 10.5694/j.1326-5377.2002.tb04354.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Noyola DE, Alpuche-Solis AG, Herrera-Diaz A, Soria-Guerra RE, Sanchez-Alvarado J, Lopez-Revilla R. Human metapneumovirus infections in Mexico: epidemiological and clinical characteristics. J Med Microbiol. 2005;54:969–974. doi: 10.1099/jmm.0.46052-0. [DOI] [PubMed] [Google Scholar]
  37. Oliveira DB, Durigon EL, Carvalho AC, Leal AL, Souza TS, Thomazelli LM, Moraes CT, Vieira SE, Gilio AE, Stewien KE. Epidemiology and genetic variability of human metapneumovirus during a 4-year-long study in Southeastern Brazil. J Med Virol. 2009;81:915–921. doi: 10.1002/jmv.21436. [DOI] [PubMed] [Google Scholar]
  38. Peiris JS, Tang WH, Chan KH, Khong PL, Guan Y, Lau YL, Chiu SS. Children with respiratory disease associated with metapneumovirus in Hong Kong. Emerg Infect Dis. 2003;9:628–633. doi: 10.3201/eid0906.030009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Pelletier G, Dery P, Abed Y, Boivin G. Respiratory tract reinfections by the new human Metapneumovirus in an immunocompromised child. Emerg Infect Dis. 2002;8:976–978. doi: 10.3201/eid0809.020238. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Peret TC, Abed Y, Anderson LJ, Erdman DD, Boivin G. Sequence polymorphism of the predicted human metapneumovirus G glycoprotein. J Gen Virol. 2004;85:679–686. doi: 10.1099/vir.0.19504-0. [DOI] [PubMed] [Google Scholar]
  41. Peret TC, Boivin G, Li Y, Couillard M, Humphrey C, Osterhaus AD, Erdman DD, Anderson LJ. Characterization of human metapneumoviruses isolated from patients in North America. J Infect Dis. 2002;185:1660–1663. doi: 10.1086/340518. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Rao BL, Gandhe SS, Pawar SD, Arankalle VA, Shah SC, Kinikar AA. First detection of human metapneumovirus in children with acute respiratory infection in India: a preliminary report. J Clin Microbiol. 2004;42:5961–5962. doi: 10.1128/JCM.42.12.5961-5962.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Schowalter RM, Smith SE, Dutch RE. Characterization of human metapneumovirus F protein-promoted membrane fusion: critical roles for proteolytic processing and low pH. J Virol. 2006;80:10931–10941. doi: 10.1128/JVI.01287-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Singleton RJ, Bulkow LR, Miernyk K, DeByle C, Pruitt L, Hummel KB, Bruden D, Englund JA, Anderson LJ, Lucher L, Holman RC, Hennessy TW. Viral respiratory infections in hospitalized and community control children in Alaska. J Med Virol. 2010;82:1282–1290. doi: 10.1002/jmv.21790. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Skiadopoulos MH, Biacchesi S, Buchholz UJ, Riggs JM, Surman SR, Amaro-Carambot E, McAuliffe JM, Elkins WR, St Claire M, Collins PL, Murphy BR. The two major human metapneumovirus genetic lineages are highly related antigenic relatedness. J Virol. 2004;78:6927–6937. doi: 10.1128/JVI.78.13.6927-6937.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Spann KM, Collins PL, Teng MN. Genetic recombination during coinfection of two mutants of human respiratory syncytial virus. J Virol. 2003;77:11201–11211. doi: 10.1128/JVI.77.20.11201-11211.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Tamura K, Dudley J, Nei M, Kumar S. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol. 2007;24:1596–1599. doi: 10.1093/molbev/msm092. [DOI] [PubMed] [Google Scholar]
  48. Thanasugarn W, Samransamruajkit R, Vanapongtipagorn P, Prapphal N, Van den Hoogen B, Osterhaus AD, Poovorawan Y. Human metapneumovirus infection in Thai children. Scand J Infect Dis. 2003;35:754–756. doi: 10.1080/00365540310000094. [DOI] [PubMed] [Google Scholar]
  49. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 1997;25:4876–4882. doi: 10.1093/nar/25.24.4876. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. van den Hoogen BG, Bestebroer TM, Osterhaus AD, Fouchier RA. Analysis of the genomic sequence of a human metapneumovirus. Virology. 2002;295:119–132. doi: 10.1006/viro.2001.1355. [DOI] [PubMed] [Google Scholar]
  51. van den Hoogen BG, de Jong JC, Groen J, Kuiken T, de Groot R, Fouchier RA, Osterhaus AD. A newly discovered human pneumovirus isolated from young children with respiratory tract disease. Nat Med. 2001;7:719–724. doi: 10.1038/89098. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. van den Hoogen BG, Herfst S, Sprong L, Cane PA, Forleo-Neto E, de Swart RL, Osterhaus AD, Fouchier RA. Antigenic and genetic variability of human metapneumoviruses. Emerg Infect Dis. 2004;10:658–666. doi: 10.3201/eid1004.030393. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. van den Hoogen BG, van Doornum GJ, Fockens JC, Cornelissen JJ, Beyer WE, de Groot R, Osterhaus AD, Fouchier RA. Prevalence and clinical symptoms of human metapneumovirus infection in hospitalized patients. J Infect Dis. 2003;188:1571–1577. doi: 10.1086/379200. [DOI] [PubMed] [Google Scholar]
  54. Vicente D, Montes M, Cilla G, Perez-Yarza EG, Perez-Trallero E. Differences in clinical severity between genotype A and genotype B human metapneumovirus infection in children. Clin Infect Dis. 2006;42:e111–113. doi: 10.1086/504378. [DOI] [PubMed] [Google Scholar]
  55. WHO. Integrated management of childhood illness HANDBOOK. World Health Organization; 2000. WHO/FCH/CAH/00.12. [Google Scholar]
  56. Williams JV, Harris PA, Tollefson SJ, Halburnt-Rush LL, Pingsterhaus JM, Edwards KM, Wright PF, Crowe JE., Jr Human metapneumovirus and lower respiratory tract disease in otherwise healthy infants and children. N Engl J Med. 2004;350:443–450. doi: 10.1056/NEJMoa025472. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Zheng H, Storch GA, Zang C, Peret TC, Park CS, Anderson LJ. Genetic variability in envelope-associated protein genes of closely related group A strains of respiratory syncytial virus. Virus Res. 1999;59:89–99. doi: 10.1016/s0168-1702(98)00132-4. [DOI] [PubMed] [Google Scholar]

RESOURCES