Skip to main content
Proceedings of the National Academy of Sciences of the United States of America logoLink to Proceedings of the National Academy of Sciences of the United States of America
. 2015 Apr 6;112(16):E1984–E1993. doi: 10.1073/pnas.1418384112

Productive mRNA stem loop-mediated transcriptional slippage: Crucial features in common with intrinsic terminators

Christophe Penno a, Virag Sharma a, Arthur Coakley a, Mary O’Connell Motherway a, Douwe van Sinderen a, Lucyna Lubkowska b, Maria L Kireeva b, Mikhail Kashlev b, Pavel V Baranov a, John F Atkins a,c,1
PMCID: PMC4413344  PMID: 25848054

Significance

Perturbation of transcription register by RNA polymerase, transcription slippage, is used to yield additional protein products. Known functionally important cases involve a small number of short sequences without secondary structure. The discovery reported here of the dependence of a newly identified motif on nascent RNA forming a stem loop structure within the RNA exit channel of the polymerase greatly extends the potential for a broad variety of putative slippage sequences, especially as the phenomenon has been observed with both bacterial and eukaryotic RNA polymerases. Characterization of the mechanism involved shows similarities with, and differences from, intrinsic transcription termination, which also depends on formation of RNA stem loop structures. Our findings reveal novel insights to RNA polymerase versatility and functioning.

Keywords: transcriptional realignment, stem loop stimulator, heteropolymeric slippage-prone motifs, frameshifting

Abstract

Escherichia coli and yeast DNA-dependent RNA polymerases are shown to mediate efficient nascent transcript stem loop formation-dependent RNA-DNA hybrid realignment. The realignment was discovered on the heteropolymeric sequence T5C5 and yields transcripts lacking a C residue within a corresponding U5C4. The sequence studied is derived from a Roseiflexus insertion sequence (IS) element where the resulting transcriptional slippage is required for transposase synthesis. The stability of the RNA structure, the proximity of the stem loop to the slippage site, the length and composition of the slippage site motif, and the identity of its 3′ adjacent nucleotides (nt) are crucial for transcripts lacking a single C. In many respects, the RNA structure requirements for this slippage resemble those for hairpin-dependent transcription termination. In a purified in vitro system, the slippage efficiency ranges from 5% to 75% depending on the concentration ratios of the nucleotides specified by the slippage sequence and the 3′ nt context. The only previous proposal of stem loop mediated slippage, which was in Ebola virus expression, was based on incorrect data interpretation. We propose a mechanical slippage model involving the RNAP translocation state as the main motor in slippage directionality and efficiency. It is distinct from previously described models, including the one proposed for paramyxovirus, where following random movement efficiency is mainly dependent on the stability of the new realigned hybrid. In broadening the scope for utilization of transcription slippage for gene expression, the stimulatory structure provides parallels with programmed ribosomal frameshifting at the translation level.


A relatively neglected aspect of gene expression is functionally important RNA-DNA hybrid realignment within the RNA polymerase (RNAP) transcribing coding sequence. Such realigned polymerases yield transcripts lacking, or containing, one or more additional base(s) corresponding to the slippage-prone sequence. The fraction of the mRNA population containing deletions or insertions with respect to the template that are not of 3 nucleotides (nt) or multiples thereof, yields proteins that are either truncated, have C-terminal regions not encoded by the zero frame of the template DNA, or both. Despite the limited investigations, several diverse functional slippage-derived products have already been characterized.

Bacterial multisubunit DNA-dependent RNAPs undergo slippage on homopolymeric runs of As or Ts. Transcriptional slippage on a run of nine As in the Thermus thermophilus dnaX gene results in heterogeneous transcripts that lead to 50% of the ribosomes quickly terminating. This termination yields a DNA polymerase subunit that lacks C-terminal domains and is synthesized in a 1:1 ratio with the full-length product (1). In other bacteria, counterpart slippage is required for synthesis of the full-length rather than the truncated product (2). Disease significant homopolymeric transcriptional slippage occurs in expression of the secretion system of Shigella flexneri (3, 4), Citrobacter, and Yersinia (5). Mechanistically similar slippage is involved in several bacterial IS element transposases (6) and probably in Staphyloccocus aureus mapW (7). Striking instances of transcriptional realignment occur in gene expression of endosymbiotic bacteria of insects that have undergone rapid evolution resulting in high AT content and exceptional genome reduction (8, 9).

The length of the hybrid between nascent RNA and its template within a transcribing RNAP is highly relevant to slippage motif length. The length of the nascent RNA template hybrid oscillates by one base during nt cycling in the process of base addition. There is a longer hybrid when the RNAP is in the pretranslocated state with the catalytic site located at the RNA 3′ end (termed position i in its DNA template). The shorter hybrid is when the RNAP is in the posttranslocated state with the catalytic site vacated from the 3′ RNA end and ready for binding of the next cognate nucleoside triphosphate (NTP) (specified by DNA template position i + 1) (10). For Thermus thermophilus in which dnaX slippage was discovered, crystallographic structures have revealed that the respective lengths are 9 and 10 bp (11). Correspondingly, slippage occurs efficiently (can be ∼50% depending on the organism and 5′ nt context) with 9 As or Ts but is greatly reduced with shorter runs (12–14).

Functionally important slippage of viral-encoded RNA-dependent RNA polymerases has been studied in the expression of the Filovirus, Ebola, where slippage occurs on a run of 7As, and in the expression of Paramyxoviruses, especially Sendai virus (15–17). Note that in negative strand virus research, synonyms for transcription slippage, such as transcriptional stuttering, cotranscriptional editing, pseudotemplated transcription, or reiterative transcription, are frequently used (18). Unlike bacterial RNAPs in the examples described above, some viral RNAPs studied slip on the heteropolymeric sequence AmGn (where m and n are integers). On this motif the polymerase from several Paramyxoviruses add a nontemplated G nucleotide(s). The efficiency of G addition is 31% for Sendai and 82% for Nipah (19). The number of G insertions differs in different Paramyxovirus subfamilies (one in respiratory/morbilli and two in the rubula subfamily) and is dependent on the sequence upstream of the slippage site (20). The number of added Gs is correlated to the organization of the P gene in which it occurs in the different viruses (see ref. 21 for a discussion of the linkages of viral features).

As the propensity for slippage is strongly influenced by the stabilities of the initial and newly realigned nascent RNA-template hybrid (22, 23), slippage on heteropolymeric sequences is especially sensitive to realigned base pairing strength. Use of the AmGn motif involves formation of nondestabilizing rG:rU base pairs, but not rA:rC, and thus confers realignment directionality. With a motif containing shorter G tracts, it is only G addition(s) that occur and its efficiency is inversely proportional to the stability of the newly realigned RNA-RNA hybrid. In addition, increasing the length of the A tract of the motif leads to A addition (24). In contrast, with a motif containing a longer G tract, G deletion(s), but not addition, occurs (25).

A previous bioinformatic analysis of disrupted bacterial ORFs revealed that bacterial RNAPs might also slip on heteropolymeric motifs. Conserved XmYn motifs were identified as candidates for productive transcriptional realignment required for synthesis of a product encoded by two partially overlapping ORFs (26). One potential slippage site is in the 80 nt overlap region of the first (272 nt) and second (966 nt) ORFs of the IS630 family insertion sequence in Roseiflexus sp, RS-1 (Fig. 1). The second ORF is in the +1 translational reading frame with respect to the frame in which translation initiates. The trans-frame encoded protein is the functional transposase. Prior analysis of counterpart instances of where synthesis of a trans-frame encoded transposase requires a ribosomal frameshifting event has shown that the frameshifting is necessary for transposition (27, 28). Here we investigate whether the product encoded trans-frame with respect to the DNA sequence derives from transcriptional slippage or ribosomal frameshifting on the heteropolymeric T5C5 motif and the characteristics of the mechanism involved.

Fig. 1.

Fig. 1.

Roseiflexus IS630 insertion sequence. (A) Diagram of the IS630 family insertion sequence transposase gene that contains two ORFs. The 3′ end of orf1 overlaps the 5′ end of orf2 which is in the +1 frame with respect to it. The nucleotide sequence displayed is of the overlapping region of the two orfs (coordinates 561509–561588 in RefSeq entry NC_009523.1). The inverted sequence 5′ of the underlined T5C5 motif is indicated by arrows. (B) orf configuration in transcripts generated without or with slippage. (C) Products from standard translation of these transcripts.

Results

An Inverted Sequence Is Required for Transcriptional Slippage on a T5C5 Motif.

To investigate whether Escherichia coli RNAP undergoes slippage within the T5C5 motif in the Roseiflexus IS630 ORF1 ORF2 overlapping region (Fig. 1), we used the gst-mbp expression plasmid system pJ307 (Fig. 2 A–C). A 41 nt cassette from the overlap region that contains 30 nt 5′ of the T5C5 motif and its 3′ flanking nt, was fused between the reporter encoding sequences gst (in-frame) and mbp (−1 frame). In the nontemplate strand of IS630, the T5C5 motif is 5′ adjacent to the ORF1 stop codon (Fig. 2D, insert 1). Analysis of proteins expressed in E. coli shows 20% efficient ORF switching (Fig. 2E, insert 1) from the 0 [encoding the standard glutathione S-transferase (GST) product] to the +1 reading frame [yielding the trans-frame GST-maltose binding protein (MBP) product]. To determine if transcription slippage event(s) are occurring, the corresponding transcription products were analyzed by limited primer extension (LPE). This technique involved annealing labeled primer to sequence 3′ adjacent to the slippage motif, extending the primer using a set of three dNTPs with the fourth and missing one replaced by its corresponding chain terminator dNTP derivative. Only one primer extended product is expected to be delimited 5′ by the 5′ end of the primer and 3′ by the first template location specifying incorporation of the chain terminator (Fig. 2F; L acyA and L acyC show two independent reactions using acyclonucleotide acyA or acyC as the chain terminator). Specific addition, or lack of nt(s) corresponding to a template nt, before incorporation of the chain terminator nt, results in a longer or shorter LPE product(s). In this study, transcriptional slippage analysis involved comparison of the LPE products generated from the RT-PCR template from the mRNA population, designated T (Test) and generated from PCR template DNA, designated L (Ladder), to reveal any DNA polymerase slippage during PCR that could mislead interpretation of the results (Fig. 2, in green). LPE on the RT-PCR product derived from cells expressing a reporter carrying the original insert (Fig. 2F, insert 1 T) results in two products, the longer of which corresponds to the RT-PCR carrying T5C5 (as specified by the template) and the shorter one corresponds to the RT-PCR carrying T5C4. The corresponding control (Fig. 2F, insert 1 L) showed only one product, which is the same size as the longer one present in T, i.e., indicating homogeneity T5C5 in the PCR product. Therefore, LPE analysis established that 30% of the RT-PCR product derived from the WT IS630 41nt cassette lacked one cytosine in the C5 tract (Fig. 2F, insert 1).

Fig. 2.

Fig. 2.

Stimulatory effect of Roseiflexus stem loop on T5C5 motif slippage. (A) pJ307 vector with fused gst mpb reporter genes separated by the test insert whose propensity for mediating reading frame changes is monitored for standard (U5C5) transcription or that involving a realignment event (U5C4) (B), leading to the synthesis of GST or transframe encoded GST-MBP products (C). Right pointing arrows from A and B show the steps used to generate the limited primer extension products, L, ladder, to monitor potential replication slippage; T, Test, to monitor transcriptional slippage; and S, synthetic, as control for reverse transcriptase slippage. (D) (Upper) Sequence of insert 1 and its derivative inserts 2–4. (Lower) Predicted RNA stem loop structure of the shorter WT sequence in insert 2 and its variants 5–7. (E) Pulse chase analysis of proteins decoded from pJ307 (A) with test cassettes. GST reports zero frame translation and, with test sequences, GST-MBP reports products that are transframe encoded with respect to the DNA sequence; 16 and 15 represent in-frame and out-of-frame controls, respectively. SEM error for frameshifting efficiency was <25% for three independent experiments. (F, Upper) Expected LPE products. The primer is indicated by a green arrow. As illustrated by the length of the different reaction products terminated for the Ladder “L” after the C5 tract (acyA terminator) or T5C5 motif (acyC terminator), changes at any nt position before the termination site can be identified. (Lower) DNA sequencing gel analysis of LPE reaction products. L (Ladder) and T (Test) signify limited primer extension based on template sequence using PCR or RT-PCR, respectively. S (Synthetic) is as T but using chemically synthetized RNA. Acyclonucleotides, acyA and acyC, that cause termination, are indicated on the left; they reveal base insertion or base absence for the sequence containing the 3′ part of motif (5′-C5-3′) and the whole motif (5′-T5C5-3′). The termination sites of the primer extension, corresponding to the cDNA template base of the acyclonucleotide, are shown for inserts 1–7 that are diagrammed in Fig. 3. In the PCR-derived ladder (L), only one product indicates absence of slippage at any level.

Next, we analyzed if the sequence upstream of the T5C5 motif is required for robust transcription slippage, leading to the C deletion. In WT mRNA (insert 1), there is a 6 nt inverted repeat sequence with potential to form a stem loop structure containing a GCAA loop 5′ adjacent to the U5C5/U5C4 motif (Figs. 1 and 2D, insert 1). Deletion of the 12 nt 5′ of the inverted repeat sequence caused only a marginal reduction in slippage efficiency (Fig. 2 D and F, insert 2), but deletion of 20 nt that included the 6 nt in the 5′ side of the stem abolished slippage (Fig. 2 D and F, insert 3). In addition, substituting the sequence in the 5′ side of the stem with its complement, gcgggc to cgcccg, removed base pairing potential and also abolished slippage (Fig. 2 D and F, insert 4).

To test the possibility of reverse transcriptase slippage that would generate heterogeneity in the RT-PCR product, LPE reactions were also performed on chemically synthesized RNA, designated S (Synthetic; Fig. 2, in green). For that, we used the minimal sequence of the Roseiflexus slippage-prone cassette that exhibits strong slippage as detected by LPE analysis (Fig. 2D, insert 2 template specifies the inverted sequence and the U5C5 motif region). We conclude that reverse transcriptase slippage does not slip on the U5C5 motif and LPE faithfully detects the lack of one C in the mRNA compared with its template (Fig. 2F, Lower).

Transcription slippage resulting in the lack of one C in the transcript is expected to yield a full-length GST-MBP fusion protein (Fig. 2C). The GST-MBP protein expression was correlated with the ability of nascent RNA to potentially form a stem loop structure. The GST-MBP fusion product comprised 20% and 15% of the total reporter protein (GST and GST-MBP) expressed from the constructs containing inserts 1 and 2, respectively (Fig. 2 D and E); the fusion product was not detected for inserts 3 and 4 (Fig. 2 D and E). A similar result was also obtained in vivo with the gst lacZ encoded reporters for inserts containing the WT (inserts 1 and 2) or mutant (inserts 3 and 4) sequence (SI Results and Fig. S1). Taken together, the analyses of protein product(s) and transcripts synthesized in vivo show that trans-frame encoded protein synthesis is at least mainly driven by transcription slippage, which led to the programmed absence of one C in the mRNA. In conclusion, the minimal T5C5 slippage-prone sequence is delimited 5′ by the inverted repeat sequence and 3′ by the stop codon (insert 2). The sequence of insert 2 was used as the WT slippage-inducing cassette in the following experiments.

Features of the Stem.

The strength of base pairing potential specified by the inverted repeat sequence (gcgggcGCAAgcccgc, with sequence of the stem indicated in lowercase) was investigated with constructs derived from insert #2 (Fig. 2D). First, a base pairing variant indicated that slippage occurs when GC-rich base pairing is maintained (insert 5, cgcccgGCAAcgggcg, switching the 5′ and 3′ sides of the stem) but does not occur with G:U (insert 6, guggguGCAAguuugu, C replaced by U) or A:U alternatives (insert 7, auaaauGCAAauuuau, C to U and G to A; Fig. 2 D and F, inserts 5–7), supporting the idea that the original inverted repeat sequence forms a stem loop structure.

Next, a G-to-A substitution at the first position of the 3′ side of the stem that disrupts potential base pairing gave 25% slippage (Fig. 3, insert 45). Changing both the first and second base on the 3′ side of the stem to A further disrupts potential pairing to give the same 8 base loop as in insert 41 in the loop analysis below. It resulted in just 5% slippage (insert 46). Changing the 5′ base G on the 5′ side of the stem to C gave 10% slippage (insert 47). Replacing both the 5′ G and C at the base of the 5′ stem also resulted in 10% slippage (insert 48). Substituting the C 5′ adjacent to the stem with A creates the potential for a 1-bp stem bottom extension by pairing with the first U of the slippery motif. This construct (insert 52) has the same slippage efficiency as WT. Creating the potential for an extra CG base pair at the top of the stem led to slippage being reduced from 30% to 25% (insert 53). A combination of these last two changes creating the potential for two extra base pairs did not change the efficiency from WT (insert 54). Creating the potential for a second extra base pair at the top of the stem did not change the efficiency (insert 55). Adding to this the potential extra base pair at the bottom (as in insert 52) gave 27% slippage, similar to WT (insert 56).

Fig. 3.

Fig. 3.

Constructs, slippage analysis, and RNA stem loop-related structures. (A) Diagram of important features for TmCn derived Roseiflexus slippage-prone cassettes, displayed above the mutant classes with their insert numbers. (B) Insert sequences. The reading frame of the 5′ reporter gene, gst, is indicated at the left with the underlined TCG, which is part of the restriction site used for cloning. The in-frame stop codon, TAG, which is part of the 3′ restriction cloning site, is in bold. It overlaps with the underlined AGA that indicates the frame of the second reporter. Sequences potentially able to form a stem are in green with their loop sequence in italics. The Ts of TmCn potential slippery motifs are in blue and the Cs in red. Substitution mutant sequence(s) are in lowercase and bold; addition(s) are in purple; hyphens (-) indicate nt absence. The purple arrow at the bottom of the stop codon containing sequence column indicates the 3′ annealing site for limited primer extensions, with a specific dNTP replaced by the corresponding terminator acyNTP. This reveals the termination site nts which are shown boxed. Red box, position 1, shows the termination site used to identify transcripts whose sequence for the second half of the TmCn motif, i.e., Cn, has 1 base more or less than in the template. Blue box, position 2, shows the counterpart termination site for the whole motif. Absence of a box means the LPE analysis was not determined. (C) Relative yield of products with more or less nucleotide(s) than the template. Each length unit, as indicated by small vertical bars, corresponds to 5% slippage efficiency. When slippage was involved, the RT-PCR products were analyzed on at least on three independent samples of in vivo RNA (and on two when it was not). Error bars: SEM. (D–G) alternative RNA stem loop(s), inserts 49 and 61–62. (H) Known histidine pause attenuator 5′ of the RNA 3′end pause site. (I) T3 intrinsic terminator of the metY-nusA-infB operon (49).

Substituting the first 3 nt on the 5′ side to the stem to their complementary sequence CGC caused 15% slippage, perhaps due in part to alternative pairing (insert 49; Fig. 3D). Disruption of the 3 bp at the base of the stem by mutations at the 3′ side of the stem abolished slippage (insert 50). Interestingly, combining replacements from insert 49 and insert 50, to restore base pairing without affecting G/C content of the stem (5′CGC/5′GCG), gives 10% slippage (insert 51), which is three times less than the WT (5′GCG/5′CGC) 30% level. This result indicates that, in addition to the base pairing in the stem, the 3′ CGC sequence in RNA or DNA has a separate contribution to slippage (Discussion). Accordingly, swapping the left and right arms of the stem (insert 5), without changing the loop, decreased slippage from 30% to 20% (compare inserts 2 and 5).

Features of the Loop.

The loop, 5′-GCAA-3′, is a GNRA-type tetraloop (with the nature of the four bases being: G, guanine; N, any; R, purine; A, adenine) (29), provoking an analysis of the potential importance of the nature of the loop. Substituting these bases by their complimentary bases (5′-CGTT-3′) decreased slippage slightly to 25% (Fig. 3, insert 39). Changing the 3′ base to C also led to a similarly moderate decrease (insert 40). A 4-bp insert to create 5′-GCGCAAAA-3′ also led to 25% slippage (insert 41). Changing to the different GNRA sequence, 5′-GAAA-3′, yielded a modest increase to 35% (insert 42). Substitution with the most common tetraloop, the sequence in Rho-independent stem loop transcription terminators, 5′-TTCG-3′, also led to a modest increase to 35% (insert 43). Replacement with the loop of the histidine operon attenuator, pause stem loop, 5′-CTAAGTCTT-3′, led to a slight decrease to 25% (insert 44).

The corresponding LPE gel analysis is shown in Fig. S2 A (stem mutants) and B (loop mutants). In summary, stability of the stem is important, although it can have latitude in its length, and more stabilizing loops had a modestly enhancing effect on slippage compared with the other loop sequences tested.

All 10 nts in the T5C5 Motif Are Required for Slippage.

Structural studies of Thermus thermophilus RNAP provide strong evidence for the length of the RNA-DNA hybrid during elongation oscillating between 9 and 10 nt during forward and backward translocation of the enzyme on DNA (11). One hypothesis to explain the absence of 1 cytosine (5′-U5C4-3′) in a sizeable fraction of the mRNA (5′-U5C5-3′) transcripts is that a realignment of the nascent 3′ RNA end from its template DNA hybrid occurs by a 1 nt forward shift.

To ascertain the relative importance of the different motif positions, T1T2T3T4T5C1C2C3C4C5, substitutions were made that, where possible, did not change the identity of the encoded amino acids (Fig. 3, inserts 8–20). T1 was changed to A, C, or G, with resulting reduction to no more than 8% slippage (inserts 8–10). No slippage was detected with T4 changed to C (insert 11), T5 and C1, were together changed to A and G (insert 17), C2 was changed to A, G, or T (inserts 12–14), and C5 was changed to A, G, or T (inserts 18–20; Fig. S2C, Left). The proteins synthesized from these constructs were analyzed by a pulse chase experiment that indicated no significant synthesis of a trans-frame slippage product except when the mutated motif contains at least three Cs 5′ adjacent to the stop codon. The latter creates a “shifty stop” (30) for +1 ribosomal frameshifting (Fig. S2D).

Successive deletion of the 5′Ts (inserts 21–23) and successive deletion of the 3′Cs (inserts 24–26) abolished slippage (Fig. 3 and Fig. S2C, Right). In summary, the slippage-prone sequence involves all 10 nt of the motif and all motif mutations competent for slippage strictly yielded transcripts with only a single C deletion and no insertions or multiple deletions.

Slippage on T5C5-Derivative Motifs.

The lack of one C in the slippage product derives from forward realignment of the RNA transcript with respect to the DNA template resulting in an rU:dG mismatch within the RNA-DNA hybrid. The potential influence of the position of the rU:dG mismatch within TmCn motifs was analyzed by successive replacements of T by C and of C by T at the junctions in TmCn-containing constructs where m + n was maintained at 10. From T1C9 to T7C3, the WT slippage efficiency was maintained (Figs. 3 and 4A, inserts 27, 28, and 31–34). From T8C2 to T9C1, the number of cytosines was the same as in the template DNA (inserts 35 and 38). Five percent of the transcripts from T9C1 contained an additional uridine. This addition indicates a switch of the TmCn slippage to a different mechanism unrelated to programmed single C deletion with respect to the template sequence. Pulse chase analyses of protein products showed a corresponding +1 trans-frame–encoded protein whose relative abundance correlated with the proportion of transcripts lacking one C (U5C4; Fig. 4B, inserts 27, 28, 31–35, and 38). For T2C8 and T8C2, protein markers were provided by in-frame (inserts 30 and 37) and out-of-frame controls (inserts 29 and 36; see insert sequences in Fig. 3). In conclusion, rU:dG mismatches located at positions from −3 to −9 in the new RNA-DNA hybrid do not prevent slippage (Fig. 4A, cartoon on bottom).

Fig. 4.

Fig. 4.

Stimulatory effect of Roseiflexus stem loop on TmCn motif slippage. (A) LPE analysis with similar designations to Fig. 2F. L (Ladder) and T (Test) refer to LPE analysis on PCR or RT-PCR template, respectively. The cartoon at the bottom for the 9nt RNA-DNA hybrid shows the T/C junctions corresponding to each TmCn motif on the top of the gel. (B) Protein pulse chase characterization. The four lanes, inserts 29–30 and 36–37, represent out-of-frame and in-frame controls, for inserts 28 (T2C8 motif) and 35 (T8C2 motif) respectively. The insert sequences and corresponding slippage efficiencies are in Fig. 3. SEM error for frameshifting efficiency was <25% for three independent experiments.

The effect of increasing the number of Ts or Cs in the T5C5 motif was also analyzed (Fig. 3 and Fig. S2E, inserts 63–68). At T5C6 and T5C7 sequences, slippage is at the WT level of ∼30% (inserts 66 and 67). A control for T5C7 with precluded stem formation gave 15% slippage (insert 68), showing that this motif on its own was now slippery. However, with T5C7 (insert 68), we could not completely exclude the possibility of an alternative secondary structure in the RNA that replaced the original stem loop. T6C5 and T7C5 also yielded WT slippage levels (inserts 63 and 64). The control for T7C5 resulted in 15% slippage (insert 65), which is the same as the T5C7 control (insert 68). In conclusion, increasing the length of the TmCn slippery sequence (with m + n > 10) leads to slippage yielding a single C deletion whose efficiency is dependent on the upstream RNA stem loop.

The Identity of the Base 3′ Adjacent to the T5C5 Motif Is Essential for Slippage.

The nature of the first template base immediately downstream from the RNA-DNA hybrid affects RNAP pausing, forward translocation, and fidelity (31, 32). Its possible significance in the slippage-mediated origin of transcripts lacking a single C was investigated using four constructs. These constructs were derived from the reference WT construct (insert 2) in which the T5C5 motif is 5′ to the T residue as part of a TAG stop codon. An additional base, N, was inserted between the T5C5 and the TAG (Fig. 3, inserts 66 and 69–71). Construct T5C6 (insert 66) had N as C and, as mentioned above, had the same slippage efficiency as T5C5. With N instead being A, G, or T (inserts 69–71), LPE analysis showed that slippage was reduced from 30% with C to 3%, 2%, and 10%, respectively (Fig. 3 and Fig. S3). Compared with the original T5C5 construct with a T 3′ adjacent to the motif (30% slippage), the above constructs contain a one base insert (N) 3′ of the T5C5 motif with TAGATCC becoming NTAGATC. Therefore, an influence of the second 3′ (underlined) and perhaps the following base(s) on slippage is not precluded (SI Discussion). In conclusion, the identity of the base 3′ adjacent to the T5C5 motif influences slippage, with a purine having the strongest inhibitory effect.

Positioning of the Stem Loop Relative to the T5C5 Slippery Site.

For RNA structure-mediated effects on transcription termination and on pausing, the positioning of the structure strongly influences its effectiveness (33, 34). To assess for possible similar spacing influences for the Roseiflexus stem loop effect on slippage, the distance between the stem loop and the slippage site was increased (Fig. 3, inserts 57–62). Adding one (insert 57), three, or four As eliminated slippage (inserts 59–60), although two As gave 2–3% slippage (insert 58). With the addition of only GCCCGC, the same sequence as the 3′ side of the stem, slippage was 22% (insert 61), which was moderately reduced from WT (30%); in this case, an alternative stem loop with two extra base pairs (at its top) could form (Fig. 3E). With an additional repeat of this sequence, i.e., GCCCGCGCCCGC, the slippage level dropped to 2–3% (insert 62), which is the same as merely adding two As (insert 58). In this case, two alternative stem loops might form: one with three extra base pairs (two at its top and one at its bottom; Fig. 3F) and the other with two extra base pairs (at its top; Fig. 3G). The corresponding LPE gel analysis is shown in Fig. S2E. In conclusion, the distance between the RNA stem loop and the slippery motif is crucial for programmed slippage leading to one C deletion.

Mechanistic Analyses of Slippage on T5C5.

We used a minimal in vitro transcription system involving ternary elongation complexes (TECs) reconstituted from RNAP core enzyme and synthetic RNA/DNA oligonucleotides (35). This system was used to test whether slippage on the T5C5 motif depends only on the interaction of RNAP with the transcript and template in the 9- to 10-bp RNA-DNA hybrid as has been shown for slippage on homopolymeric tracts (22, 36). It was also used to confirm stimulation of slippage by the 5′ stem-loop structure. RNA polymerase was positioned upstream of the T5C5 slippery site with the 22 nt internally labeled nascent transcript with WT or a mutated 5′ sequence of the stem (mut). Transcription was resumed by addition of unlabeled UTP, CTP, and GTP for the T5C5tga construct or ATP, CTP, and UTP for the T5C5tag construct. Lack of ATP or GTP in the reactions induced RNAP stalling 2 bp downstream from the end of the slippery tract (the base highlighted in bold; Fig. 5A). The concentration of CTP was varied in the 5- to 500-µM range to investigate the effect on slippage of slow or fast transcription within the C5 part of the motif.

Fig. 5.

Fig. 5.

In vitro transcriptional slippage in a minimal purified system. (A) Example of in vitro slippage assay with the T5C5tga sequence. A TEC, containing RNAP, DNA (template and nontemplate strand), and nascent RNA, was generated at DNA template position 3′ adjacent to the 3′A5G5A5′ DNA template (Initial TEC). Then, transcription elongation progressed to the DNA template position 5′adjacent to template 3′A5G5A5′ sequence using a set of mixes of three NTPs including CTP at different concentration (Final TEC). (B) Slippage efficiency with RNAP purified from E. coli or RNAP II from S. cerevisiae. The DNA template used yields the WT or mutated (mut) Roseiflexus RNA structure. The T5C5 motif is 5′ adjacent to TAG or TGA. For E. coli polymerase, the effect of N protein from phage lambda added at the Initial TEC stage is indicated. SEM error bars are indicated for three independent experiments. (C) Representative sequencing gel of E. coli RNAP-derived transcripts from T5C5tga-containing templates. Part of the RNA sequence of standard (5′U5C53′) and slippage (5′U5C43′) products is shown on the Left.

Slippage on the T5C5 motif leading to lack of one C in the transcript occurred in vitro during transcription of a synthetic DNA template in the absence of any additional transcription factors. Changing the sequence 3′ to the slippery site, TAG, to TGA did not affect slippage (Fig. 5B), suggesting that G or A located 2 and 3 nt downstream from the T5C5 motif played no role in slippage. The efficiency of slippage on the template with the intact stem loop inversely correlates with the concentration of CTP in the reaction mix: lowering the CTP concentration led to a larger fraction of the transcript lacking one C (Fig. 5B, WT). Consistent with the in vivo findings, slippage on the template specifying RNA without the stem loop was observed at a very low level and only at the lowest CTP concentration tested (Fig. 5B, mut), confirming the strong stimulator role of the stem loop structure in slippage established in vivo.

Changing the UTP/CTP ratio showed a dramatic effect on slippage efficiency (Fig. S4 A and D). Although the UTP concentration also affects transcription of the T5 part of the T5C5 motif, it seems unlikely that this effect alters slippage in the C5 part of the motif. Such realignment must occur with the initial RNA 3′end having no more than four C residues, i.e., located 4 base pairs downstream from the T5 tract. Therefore, the UTP/CTP ratio effect indicates that a high rate of incorporation of UTP, the nucleotide specified immediately downstream of the motif, is crucial for the lack of one C by slippage. Thus, the dependence of slippage efficiency on transcription rate appears quite complex: slow transcription through the C5 part of the T5C5 motif promoted slippage, whereas slow addition of the NMP 3′ adjacent to the T5C5 motif inhibited slippage.

Transcription termination was observed at positions C2 and C3 (corresponding to the RNA 3′end sequence U5C2 and U5C3) with the test (WT) specifying the WT Roseiflexus structure, but not the control (mut), which specifies a mutated structure (Fig. S4 A and B). To test whether RNA stem loop formation has a similar effect on slippage as it does in transcription termination in destabilizing the closest part of the hybrid, phage lambda N protein, which stabilizes the upstream part of the hybrid (23, 37), was included in the assay.

The presence of N protein caused the efficiency of stem loop-dependent slippage on T5C5 to be reduced by ∼25–50% depending on CTP concentration (Fig. 5B). This reduction is consistent with the Roseiflexus stem loop directly mediating slippage via melting of the closest part of the RNA-DNA hybrid or with N protein inhibiting hybrid realignment involving “defect migration” (SI Discussion). A possible, perhaps additional, indirect effect via stem loop formation associated pausing stimulating slippage by enhancing the time window for hybrid realignment was explored. Pausing can be due to any of a number of reasons. In vitro experiments (above) showed the effect of substrate limitation. A further in vitro experiment used NusA transcription factor that stimulates RNAP pausing at the histidine biosynthetic attenuator (38). It increased RNAP pausing at position U 3′ adjacent to the motif but showed no effect on slippage (Fig. S4 A and C). These finding are in agreement with in vivo data (SI Results) using E. coli rho and rho nusA strains, the propensity of RNAP mutants, rpoB8 (slow elongation rate) and rpoB3595 (fast elongation rate), and the introduction of the “histidine pause” stem loop upstream of the T5C5 motif (Fig. 3H and inserts 72–73). Taken together, the in vitro and in vivo data do not reveal an indirect pausing-related mechanism of stem loop involvement in slippage stimulation.

Eukaryotic RNAP-Mediated Slippage.

Promoter-independent in vitro transcription permitted testing of whether eukaryotic RNA polymerase II (RNAP II) (35) also mediates stem loop-dependent slippage on T5C5. RNAP II from Saccharomyces cerevisiae also yielded transcripts lacking one C, although the proportion was slightly less than with E. coli RNAP under the same conditions (Fig. 5B, compare E. coli and yeast RNAPs for T5C5tga motif with WT RNA structure). Importantly, slippage efficiency of RNAP II was significantly stimulated by the RNA stem loop structure (Fig. 5B), and slippage was also sensitive to cytosine triphosphate (CTP) concentrations. To summarize, the T5C5 motif represents a universal slippery sequence for distantly related RNAPs, and both enzymes similarly use the stem-loop structure for slippage.

Discussion

This work shows that E. coli RNAP undergoes transcriptional slippage leading to lack of one cytosine in the RNA transcribed from a heteropolymeric T5C5 motif and certain derivatives. Slippage on heteropolymeric motifs during transcription elongation has been previously reported only for paramyxovirus RNA polymerases and involves AmGn motifs leading to additions of G (21). Formation of an RNA stem-loop structure strongly stimulates transcript realignment on a T5C5 motif. The only prior observation of transcriptional slippage stimulated by a stem loop structure was reported for Ebola virus RNA-dependent RNA polymerase (39). We assert that no credible evidence has been presented that it is a real precedent (SI Discussion). Importantly, the RNA structure-dependent transcript realignment on the T5C5 tract is not limited to bacterial transcription. Yeast RNAP II, whose protein contacts with the nascent RNA and the RNA-DNA hybrid are similar to, but not identical with, its bacterial counterpart, efficiently slips in vitro in a hairpin-dependent manner on the T5C5 motif. Potential relevance of polymerase structural differences to downstream DNA context on slippage efficiency merit future exploration. It could be significant because with E. coli RNAP slippage in vivo, the WT construct (insert 2) exhibited 30% slippage, whereas construct 71, which has the same 3′nt but contains an extra 3′ flanking T, showed 10% slippage (Fig. 3 and SI Discussion).

Several key features of the TmCn motif-containing cassette for E. coli mRNA transcripts lacking a single C are latitude of the TmCn motif involving 2 < m<7 and n > 2 with a minimal length of m + n = 10, involvement of a Tm/Cn (5′T/C3′) pyrimidine/pyrimidine junction within the motif, presence of a pyrimidine residue (Py, C, or T) 3′ adjacent to the TmCn motif, formation of a G/C-rich stem loop structure 5′ adjacent to the UmCn in the mRNA, and preference for the base 5′ adjacent to UmCn in the mRNA being a C (and so a G at the 5′ end of the stem; Fig. 3A, Upper, and Fig. S5). Our experimental observations, taken together with the previously identified structural and functional properties of ternary elongation complexes, suggest a mechanistic model of the programmed hairpin-dependent generation of mRNA lacking one C from TmCn heteropolymeric motifs.

The Site and Directionality of Transcript Realignment.

The components of the T5C5 motif are designated as follows: 5′-dT1T2T3T4T5C1C2C3C4C5-3′ in the DNA nontemplate strand or 3′-dA5G5-5′ 3′-dA1A2A3A4A5G1G2G3G4G5-5′ in the DNA template strand. Referring to the DNA template strand, realignment of the RNA-DNA hybrid leading to lack of a rC can occur at positions G1, G2, G3, or G4 with a corresponding RNA 3′ end having a C1, C2, C3, or C4 tract, respectively. Irrespective of location, the shift involves an rU5:dG1 mispair in the newly realigned RNA-DNA hybrid (the RNA bases specified by the motif have the same subscript number as in the template DNA motif sequence). The distance from the rU5:dG1 mismatch to the RNAP catalytic center can extend from 1 to 4 rC:dG bp, depending on the slippage site, so a shift at G4 would involve a significantly more stable hybrid in the RNAP catalytic center than a shift at G1 (Fig. 6, Upper Right).

Fig. 6.

Fig. 6.

Individual steps in programmed transcriptional realignment at T5C5 sequence. (Upper Right) Realignment site possibilities with nascent RNAs having C1, C2, C3, or C4 at their 3′ ends. The sole position of the rU5:dG1 mispair in the possible newly realigned hybrids is indicated by an open square. (Upper Left) the cartoon shows individual functional blocks of the T5C5 motif: the RNA stem loop-forming sequence (green), 5′GC3′ base pair (brown) in the hairpin stem immediately adjacent to the T5 tract (blue), the C5 tract (red), and pyrimidine residue (T or C) in the template DNA strand (black) at the 3′ of the C5 tract. The realignment occurs at the C4 site of the C5 tract and at a 9-nt distance from the rG:rC base pair at the base of the stem (shown by a double-headed arrow). Sequence elements on the top are necessary for realignment. (Lower) The putative structures and rearrangements of the RNA-DNA hybrid in RNAP paused at the C4 position of the T5C5 motif. The partitions of the RNAP active center, the RNA 3′ end-binding site (i) and the NTP binding site (i + 1) are shown in magenta. Arrows indicate matches, alternative base pairs, and mismatches in the RNA-DNA hybrid emerging at each step of the realignment. (Lower Right) Scheme depicts translocation states of RNAP in each slippage intermediate (post- or pretranslocated) where n, n + 1, and n + 2 correspond to RNAP with the 3′ RNA end base pairs with G4, G5, and 3′Pu (G/A) template DNA position, respectively. Double-headed arrows indicate two branching points in the realignment pathway, which are affected by CTP and UTP concentrations. High CTP/low UTP inhibits and high UTP/low CTP stimulates the realignment at C4 site. See Discussion for details.

Efficient generation of transcripts lacking one C from the TmCn motif (m + n = 10) variants with sequential combinations from T1C9, T2C8… to T7C3 is evidence that the presence of one rU:dG mismatch at any of the first eight hybrid RNA:DNA base pairing positions of the realigned hybrid are stabilized by structural features of the RNAP. However, realignment involving an rU:dG mismatch in the 9th or 10th hybrid positions does not yield transcripts lacking one C, permitting the deduction that these mismatch positions are not similarly stabilized [suggesting that relevant realignment occurs with T9C1 is the reality of realignment in at least the other direction (−1) where a mismatch is not involved at the same RNA base position, and transcripts are generated that contain an additional U (Fig. 4, insert 38; reaction acyC).

Mismatch stabilization at a subset of positions is supported by the increased slippage propensity exhibited by mutants in the fork loop domain of the β subunit, which interacts with the third and fourth RNA base from the RNA 3′ end (22) (SI Results and Fig. S2F). The suggested stability lock is consistent with X-ray and biochemical analysis of RNAP elongation complexes that show tight contacts of the enzyme with the RNA-DNA hybrid that are mostly limited to the first 2–3 3′-proximal bps of the hybrid (11, 40). Consequently, complete inhibition of slippage generating RNA lacking one C with T8C2 (5′-dT1T2T3T4T5T6T7T8C1C2-3′), but not with the T7C3 motif (5′-dT1T2T3T4T5T6T7C1C2C3-3′), indicates that RNAP loses its tolerance to rU:dG mispairing in the hybrid when located one rC:dG base pair from the RNA 3′ end. It further implies that realignment occurs at position C2 for T7C3, but not at its other possible shift site C1 (T8C2 has one possible shift site, C1). In addition, the T5 position of the T5C5 motif can also be excluded as a shift site because realignment of the 3′end of the RNA at this site generates rU5:dG1 in the active center of RNAP, which significantly slows down the next nucleoside monophosphate (NMP) incorporation (37, 41, 42). Earlier it was shown that the active center in RNAP has intrinsically low tolerance to even a minor anomaly in the RNA-DNA hybrid (40).

Altering the base at the C5 position in the T1T2T3T4T5C1C2C3C4C5T motif abolishes slippage, indicating that a C at this position is critical for realignment. Further, slippage efficiency is strongly dependent on UTP incorporation; U is specified 3′ adjacent to the C5 tract. These results for the T5C5T motif, taken together with those from the effect of positioning of the rU:dG mismatch in TmCn motifs in which m + n = 10, indicates that realignment must involve the two last (9th and 10th) motif positions. In summary, the TEC that appears to be the preferred candidate for realignment at the 3′-gA1AAAA5G1GGG4G5a-5′ template sequence has the 3′ end of the RNA, C4, base paired with underlined template G4; this is designated TECC4.

Posttranslocated TECC4 contains the 9-bp RNA-DNA hybrid (43) with its active site vacated from the RNA 3′ end and available for binding of the next cognate NTP (CTP) (Fig. 6, Left, TECC4). In the regular elongation pathway, this complex incorporates CMP to generate the pretranslocated TECC5 (Fig. 6, Right, Productive pathway TECC5), which continues transcription beyond the slippery motif to synthesize fully complementary mRNA (U5C5). We propose that the transcript realignment pathway competes with CMP incorporation in TECC4. Slippage moves the 3′ end of the transcript rU5C4 from position i (RNA 3′ end binding site) to position i + 1 (NTP binding site; Fig. 6, TECC4 and TECC5slip). Such a shift would convert the posttranslocated TECC4 to the pretranslocated TECC5slip (the italics and subscript indicate the nonstandard origin of the complex) without translocation of RNAP along the DNA or phosphodiester bond formation (consequent to substrate incorporation). In TECC5slip, the nascent transcript (5′-rU1U2U3U4U5C1C2C3C4-3′end) base pairs with 3′-dA1A2A3A4A5G1G2G3G4G5-5′ in the template, generating a relatively stable rU5:dG1 alternative base pair in the middle of the RNA-DNA hybrid. A shift of the transcript in the opposite direction (which would lead to a C insertion in the transcript) would generate an unstable rC1:dA5 mismatch. The better fit of rU5:dG1 compared with rC1.dA5 establishes slippage directionality (Fig. 6, TECC5slip dG1:rU5). Note that our experiments did not address the mechanistic details of the transcript realignment process. Some possibilities are in SI Discussion. These possibilities include transcript realignment by defect/bulge migration, i.e., consecutive dissociation and repairing of single base pairs within the initial RNA-DNA hybrid (44, 45), and the potential role in stem loop-dependent slippage of RNAP hyper-forward translocation (46), with consequent decreased hybrid length and therefore stability (Fig. S6, hyper-translocation model).

RNAP Translocation and Pausing in the Generation of RNA Lacking a Single C.

TECC5slip may re-enter the regular elongation pathway by undergoing forward translocation, incorporating the next cognate UMP, and generating mRNA lacking one C (Fig. 6, TEC escaped). Alternatively, TECC5slip can switch back to the regular TECC4 by reversal of the RNA shift (Fig. 6, Right, Realign reversal TECC4). Therefore, fast translocation of TECC5slip and fast incorporation of the next UMP would promote absence of one C (Fig. 6, TECC5slip and TEC escaped). The C5/T junction 3′ adjacent to the T5C5 motif likely promotes rapid escape of TECC5slip from the slippage site, because 3′ Py/Py junctions (referring to the nontemplate strand) strongly promote forward translocation of E. coli RNAP and yeast RNAPII, whereas Py/Pu junctions often induce transcription pausing at Py residues (37). Consistent with this notion, absence of a single C is inhibited when purine residues are specified 3′ adjacent to the TmCn motif. RNA:DNA mismatches at the −10 position of the RNA-DNA hybrid also promote RNAP translocation (37). Apparently, the distal G–proximal C (Fig. 3, inserts 2, 5, and 51) preference in the end of the hairpin stem suggests that the rC:dA mismatch is more efficient in promoting forward translocation of TECC5slip than the rG:dA mismatch.

A slow translocation and delayed incorporation of the next CMP by TECC4 are expected to favor the pathway leading to one C absence compared with the regular elongation pathway. Transient pausing at C4 could be supported by the highly biased purine/pyrimidine composition of its RNA-DNA hybrid. Pyrimidine-rich (U-rich) nascent RNA was shown to stimulate pausing of E. coli RNAP (40, 47). The RNA hairpin may additionally contribute to the pausing either by melting the RNA-DNA hybrid in TECC4, by interacting with the RNAP, or by inducing a hyper-translocation of RNAP as proposed previously (33, 46, 48) (SI Discussion and Fig. S6). Our model above and below explains how the prevalence of C absence depends on CTP and UTP concentrations in vitro. At low [CTP], RNAP dwells at the C4 position, providing additional time for the RNA shift (TECC4 → TECC5slip) to occur. Rapid incorporation of UMP by TECC5slip at high [UTP] competes with conversion of this complex back to TECC4. Thus, the single C absence is most prevalent in vitro at high [UTP] and low [CTP] (Fig. 6, Right).

The Stem-Loop Structure in Transcriptional Slippage: Parallels with Intrinsic Termination.

The realignment precursor TECC4 contains the RNA hairpin with a 6-bp stem 5′ adjacent to the 9-bp hybrid (rU5C4:dA5G4). The RNA hairpin promotes melting of the upstream part of the RNA-DNA hybrid during transcription termination (33, 37) [the Roseiflexus slippage stem loop is similar to the T3 intrinsic terminator of the metY-nusA-infB operon (49); Fig. 3I]. Interestingly, with phage T7 single-subunit RNAP, an RNA stem loop structure (TΦ) stimulates intrinsic termination on the upstream RNA-DNA hybrid containing poly(A) or polyU tracts. In the absence of a stem loop, T7 RNAP slips on the same motifs leading to nt addition(s), but this slippage is strongly inhibited by stem loop formation (50). In vitro, a small fraction of the TECC4 also terminates transcription. Similar to slippage yielding absence of a single C, termination at C4 occurs in a stem loop-dependent manner. Therefore, within this sequence context, the hairpin-mediated melting of the upstream part of the RNA-DNA hybrid may have two alternative outcomes: termination of the elongation complex or transcript realignment. The proposed similarity of these mechanisms is further supported by in vitro inhibition of slippage on TmCn by the antitermination protein N (Fig. 5). N is thought to stabilize the RNA-DNA hybrid in RNAP (23, 37). In summary, programmed transcript realignment and intrinsic transcription termination may be considered as two branches of the same pathway, both including destabilization of the RNA-DNA hybrid within RNAP. The relative efficiencies of these two processes should depend on the RNA-DNA hybrid stability in the TmCn motif.

Mechanistic Summary.

Slippage on the TmCn motif involves a programmed unidirectional shift of the RNA strand of the RNA-DNA hybrid in RNAP, which occurs uniquely at the C4 position of the T5C5 motif. The productive unidirectional forward 1-bp shift at the TmCn motifs is secured by the stability of the alternative new-realigned hybrid(s) occurring at different sites in the TmCn sequence. Inviability of more than one rU:dG and even one rC:dA mismatch prevents a two-base deletion and any insertions, respectively. Mismatches cause rapid reversal of the single nt backward shift. The C5T (Py/Py) antipausing junction sequence, as opposed to the pause-inducing Py/Pu sequence, at the downstream end of the T5C5 motif promotes rapid escape of the realigned complex to elongation before reversal of the slippage. This mechanism implies that transient transcription realignment occurs on a broad variety of heteropolymeric sequences. However, rapid reversal of the realignment prevents deletions and insertions in the mRNA unless additional sequence elements that inhibit the reversal are present.

Perspective.

The term programmed transcriptional realignment (PTR) for structure-mediated slippage seems merited. It evokes a parallel with programmed ribosomal frameshifting, especially with those cases where a recoding signal involves interaction of the nascent peptide within components of the peptide exit channel of the ribosome. A different type of parallel is where there is suggestive evidence for mRNA structure formation within a translating ribosome (51). The present work opens a new perspective for potential slippage-mediated regulation and protein diversity. Future challenges include testing initial bioinformatics-derived candidates and extending the searches to include eukaryotic organisms.

Materials and Methods

Bacteria Strains and Plasmids.

E. coli strains and plasmids and oligonucleotides (IDT DNA) are in Tables S1–S3. The sequence of the inserts is also indicated in Fig. 3.

RNA Purification, Reverse Transcription, and PCR Reactions.

Strains grown in Luria Bertani (LB) media to midlog phase were induced, when required, with 1 mM isopropyl-β-d-thiogalactopyranoside (IPTG) for 20 min. RNA were isolated using TRIzol (Invitrogen), treated with DNaseI turbo (Ambion), and purified with a base silica column (Anachem). Reverse transcription using 1 µg total RNA and SuperScriptIII reverse transcriptase (Invitrogen) was at 52 °C. The sequence of the R#669 primer used on vector pJ307 gst-mbp was GGTGACTTTAATTCCGGTATC (this anneals 102 nt downstream the BamHI 3′ cloning site) and of R#30 on vector pJ123 GST-lacZ, was ACGACGTTGTAAAACGACGG (anneals 22nt downstream the BglII 3′ cloning site). PCR reactions, 50 µL, with 2 µL reverse transcription reaction product or plasmid DNA, were performed with primers R#30 and F#450 (5′-CCCAATGTGCCTGGATGCG-3′) and with R#669 and F#668 (5′-TAAGTACTTGAAATCCAGCAAG-3′). PCR reactions contained Taq DNA polymerase 0.8 units (Biolabs), 1× thermo buffer (Biolabs), 200 µM each dNTP (Biolabs), 500 nM each primer, and 2 µL cDNA reaction or 0.1–0.5 ng plasmid. As a control for DNA contamination, reverse transcription reactions were performed without reverse transcriptase and used as template for PCR reactions. Reaction amplification involved 25 cycles, with 30-s denaturation at 94 °C, 30-s annealing at 52 °C, and 30-s elongation at 72 °C. See Fig. 2 for the strategy used for transcriptional slippage analysis.

LPE Reactions.

RT-PCR and PCR products were agarose gel purified with a PCR clean up kit (Anachem). Primers with IRD700 fluorescent labeling were IRD700-R#226 (pJ123) TAGGGCCCTTCGAAGATCTA and IRD700-R#821 (pJ307) CAGTTGGGAATTCTTGGATCTA. Reactions, 12.5 µL, contained 0.05 pmol DNA template, 0.15 pmol IRD700 labeled oligo, 1 µM final of three dNTP (Biolabs) with the missing one replaced by 50 µM of the corresponding acyNTP (Biolabs), and 0.05 U/µL of Vent exo− DNA polymerase (Biolabs). Reaction were linearly amplified for 60 cycles, with 30-s denaturation at 94 °C, 30-s annealing at 55 °C, and 30-s elongation at 72 °C. Products were analyzed on a 15% urea sequencing gel. Signal detections and image captures were performed by means of a Li-Cor sequencing instrument (Li-Cor Biosciences). Band signal intensity was quantified using ImageQuant. Fig. S7 depicts optimization of the LPE reactions conditions.

Protein Analysis.

Pulse chase experiments were performed as in ref. 52 in Mops (morpholinepropanesulfonic acid)-glucose containing 100 μg/mL ampicillin and all amino acids (150 μg/mL each) except methionine and tyrosine, pulsed with [35S]methionine for 2 min, and chased with unlabeled Met for 2 min; the exception, where indicated, is for induction with IPTG, where it was for 20 min. Proteins were separated on 10% SDS/PAGE. Dried gels were exposed to a Molecular Dynamics PhosphorImager screen, and band intensity was quantified by ImageQuant. The frameshifting efficiency was estimated as in ref. 53.

In Vitro Experiments.

RNA polymerase from E. coli and RNAP II from S. cerevisiae were purified as described previously (41, 54). NTPs were purified as described in ref. 41. Bacteriophage lambda N protein was purified as described in ref. 23. Details of transcription procedures are provided in SI Materials and Methods. Briefly, to prepare the initial TEC (Fig. 5A), the TEC was first assembled from synthetic RNA and DNA oligonucleotides (35) and then ligated to a DNA test insert. The TEC was walked by addition of NTP subsets to form a 63 nt transcript stalled 8 nt upstream of the slippery site (3′-A5G5-5′) on the DNA template. The 3′ CMP of nascent RNA in this TEC is hybridized to dG within the 3′-CGTT-5′ sequence, which specified the loop of the Roseiflexus RNA structure. The 63 nt nascent RNA was digested with RNase T1, producing a 14 nt nascent RNA (5′-ACGGACGCGGGCGC-3′). The RNA was labeled by incubation with α-[32P] ATP (3,000 mCi/mol), producing a 16 nt RNA. The initial TEC carrying 22 nt RNA was obtained after an additional walking step.

The initial TEC was incubated with 50 µM UTP and GTP and 5, 50, or 500 µM CTP for 4 min at ambient temperature. For the experiments with the T5C5tag template, GTP was substituted with ATP. When indicated, the initial TEC was preincubated with 100-fold molar excess of N protein for 10 min. Reactions were stopped by adding the denaturing gel loading buffer containing EDTA and urea, and the reactions products were separated in a 10% sequencing gel. Gels were exposed to a Molecular Dynamics PhosphorImager screen, and band intensity was quantified by ImageQuant. Slippage efficiency was estimated as the fraction of slippage product of the sum of the slippage and standard products.

Supplementary Material

Supplementary File
pnas.201418384SI.pdf (2.1MB, pdf)

Acknowledgments

We thank D. J. Jin, D. Friedman, and M. Cashel for bacterial strains; G. Loughran, L. Renault, and S. Rinke for support; H. Feldmann and M. Mehedi for sending the coding sequence information of Ebola virus cassettes used in their work; and O. Fayet for stimulating us to investigate IS elements and a rewarding collaboration. This work was supported by an Irish Research Council fellowship (to C.P.), Science Foundation Ireland Grants 13/IA/1853, 07/CE/B1365, and 12/RC/2273 (to J.F.A. and D.v.S.), Wellcome Trust Grant 094423 (to P.V.B.), an Irish Health Research Board postdoctoral fellowship Grant PDTM/2011/09 (to M.O.M.), a National Institutes of Health intramural award (to M.K.), and a University College Cork seed grant (to J.F.A.).

Footnotes

The authors declare no conflict of interest.

This article is a PNAS Direct Submission.

This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1418384112/-/DCSupplemental.

References

  • 1.Larsen B, Wills NM, Nelson C, Atkins JF, Gesteland RF. Nonlinearity in genetic decoding: Homologous DNA replicase genes use alternatives of transcriptional slippage or translational frameshifting. Proc Natl Acad Sci USA. 2000;97(4):1683–1688. doi: 10.1073/pnas.97.4.1683. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Antonov I, Coakley A, Atkins JF, Baranov PV, Borodovsky M. Identification of the nature of reading frame transitions observed in prokaryotic genomes. Nucleic Acids Res. 2013;41(13):6514–6530. doi: 10.1093/nar/gkt274. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Penno C, Sansonetti P, Parsot C. Frameshifting by transcriptional slippage is involved in production of MxiE, the transcription activator regulated by the activity of the type III secretion apparatus in Shigella flexneri. Mol Microbiol. 2005;56(1):204–214. doi: 10.1111/j.1365-2958.2004.04530.x. [DOI] [PubMed] [Google Scholar]
  • 4.Penno C, et al. Transcriptional slippage controls production of type III secretion apparatus components in Shigella flexneri. Mol Microbiol. 2006;62(5):1460–1468. doi: 10.1111/j.1365-2958.2006.05456.x. [DOI] [PubMed] [Google Scholar]
  • 5.Gueguen E, Wills NM, Atkins JF, Cascales E. Transcriptional frameshifting rescues Citrobacter rodentium type VI secretion by the production of two length variants from the prematurely interrupted tssM gene. PLoS Genet. 2014;10(12):e1004869. doi: 10.1371/journal.pgen.1004869. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Baranov PV, Fayet O, Hendrix RW, Atkins JF. Recoding in bacteriophages and bacterial IS elements. Trends Genet. 2006;22(3):174–181. doi: 10.1016/j.tig.2006.01.005. [DOI] [PubMed] [Google Scholar]
  • 7.Baranov PV, Hammer AW, Zhou J, Gesteland RF, Atkins JF. Transcriptional slippage in bacteria: Distribution in sequenced genomes and utilization in IS element gene expression. Genome Biol. 2005;6(3):R25. doi: 10.1186/gb-2005-6-3-r25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Tamas I, et al. Endosymbiont gene functions impaired and rescued by polymerase infidelity at poly(A) tracts. Proc Natl Acad Sci USA. 2008;105(39):14934–14939. doi: 10.1073/pnas.0806554105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Wernegreen JJ, Kauppinen SN, Degnan PH. Slip into something more functional: Selection maintains ancient frameshifts in homopolymeric sequences. Mol Biol Evol. 2010;27(4):833–839. doi: 10.1093/molbev/msp290. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Bar-Nahum G, et al. A ratchet mechanism of transcription elongation and its control. Cell. 2005;120(2):183–193. doi: 10.1016/j.cell.2004.11.045. [DOI] [PubMed] [Google Scholar]
  • 11.Vassylyev DG, Vassylyeva MN, Perederina A, Tahirov TH, Artsimovitch I. Structural basis for transcription elongation by bacterial RNA polymerase. Nature. 2007;448(7150):157–162. doi: 10.1038/nature05932. [DOI] [PubMed] [Google Scholar]
  • 12.Wagner LA, Weiss RB, Driscoll R, Dunn DS, Gesteland RF. Transcriptional slippage occurs during elongation at runs of adenine or thymine in Escherichia coli. Nucleic Acids Res. 1990;18(12):3529–3535. doi: 10.1093/nar/18.12.3529. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Uptain SM, Kane CM, Chamberlin MJ. Basic mechanisms of transcript elongation and its regulation. Annu Rev Biochem. 1997;66:117–172. doi: 10.1146/annurev.biochem.66.1.117. [DOI] [PubMed] [Google Scholar]
  • 14.Chamberlin M, Berg P. Deoxyribo ucleic acid-directed synthesis of ribonucleic acid by an enzyme from Escherichia coli. Proc Natl Acad Sci USA. 1962;48(1):81–94. doi: 10.1073/pnas.48.1.81. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Thomas SM, Lamb RA, Paterson RG. Two mRNAs that differ by two nontemplated nucleotides encode the amino coterminal proteins P and V of the paramyxovirus SV5. Cell. 1988;54(6):891–902. doi: 10.1016/S0092-8674(88)91285-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Jacques JP, Kolakofsky D. Pseudo-templated transcription in prokaryotic and eukaryotic organisms. Genes Dev. 1991;5(5):707–713. doi: 10.1101/gad.5.5.707. [DOI] [PubMed] [Google Scholar]
  • 17.Lamb RA, Parks GD. Paramyxoviridae: The viruses and their replication. In: Knipe DM, Howley PM, editors. Fields Virology. 5th Ed. Lippincott Williams & Wilkins; Philadelphia: 2007. pp. 1449–1496. [Google Scholar]
  • 18.Anikin M, Molodtsov V, Temiakov D, McAllister WT. In: Transcript Slippage and Recoding. Recoding: Expansion of Decoding Rules Enriches Gene Expression. Atkins JF, Gesteland RF, editors. Springer; New York: 2010. pp. 409–432. [Google Scholar]
  • 19.Kulkarni S, et al. Nipah virus edits its P gene at high frequency to express the V and W proteins. J Virol. 2009;83(8):3982–3987. doi: 10.1128/JVI.02599-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Iseni F, et al. Chemical modification of nucleotide bases and mRNA editing depend on hexamer or nucleoprotein phase in Sendai virus nucleocapsids. RNA. 2002;8(8):1056–1067. doi: 10.1017/s1355838202029977. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Kolakofsky D, Roux L, Garcin D, Ruigrok RWH. Paramyxovirus mRNA editing, the “rule of six” and error catastrophe: A hypothesis. J Gen Virol. 2005;86(Pt 7):1869–1877. doi: 10.1099/vir.0.80986-0. [DOI] [PubMed] [Google Scholar]
  • 22.Zhou YN, et al. Isolation and characterization of RNA polymerase rpoB mutations that alter transcription slippage during elongation in Escherichia coli. J Biol Chem. 2013;288(4):2700–2710. doi: 10.1074/jbc.M112.429464. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Parks AR, et al. Bacteriophage λ N protein inhibits transcription slippage by Escherichia coli RNA polymerase. Nucleic Acids Res. 2014;42(9):5823–5829. doi: 10.1093/nar/gku203. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Hausmann S, Garcin D, Delenda C, Kolakofsky D. The versatility of paramyxovirus RNA polymerase stuttering. J Virol. 1999;73(7):5568–5576. doi: 10.1128/jvi.73.7.5568-5576.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Jacques JP, Hausmann S, Kolakofsky D. Paramyxovirus mRNA editing leads to G deletions as well as insertions. EMBO J. 1994;13(22):5496–5503. doi: 10.1002/j.1460-2075.1994.tb06884.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Sharma V, et al. A pilot study of bacterial genes with disrupted ORFs reveals a surprising profusion of protein sequence recoding mediated by ribosomal frameshifting and transcriptional realignment. Mol Biol Evol. 2011;28(11):3195–3211. doi: 10.1093/molbev/msr155. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Mejlhede N, et al. -1 frameshifting at a CGA AAG hexanucleotide site is required for transposition of insertion sequence IS1222. J Bacteriol. 2004;186(10):3274–3277. doi: 10.1128/JB.186.10.3274-3277.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Rettberg CC, Prère MF, Gesteland RF, Atkins JF, Fayet O. A three-way junction and constituent stem-loops as the stimulator for programmed -1 frameshifting in bacterial insertion sequence IS911. J Mol Biol. 1999;286(5):1365–1378. doi: 10.1006/jmbi.1999.2546. [DOI] [PubMed] [Google Scholar]
  • 29.Zwieb C. Conformity of RNAs that interact with tetranucleotide loop binding proteins. Nucleic Acids Res. 1992;20(17):4397–4400. doi: 10.1093/nar/20.17.4397. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Weiss RB, Dunn DM, Atkins JF, Gesteland RF. Slippery runs, shifty stops, backward steps, and forward hops: -2, -1, +1, +2, +5, and +6 ribosomal frameshifting. Cold Spring Harb Symp Quant Biol. 1987;52:687–693. doi: 10.1101/sqb.1987.052.01.078. [DOI] [PubMed] [Google Scholar]
  • 31.Kashkina E, et al. Multisubunit RNA polymerases melt only a single DNA base pair downstream of the active site. J Biol Chem. 2007;282(30):21578–21582. doi: 10.1074/jbc.C700098200. [DOI] [PubMed] [Google Scholar]
  • 32.Kireeva ML, Domecq C, Coulombe B, Burton ZF, Kashlev M. Interaction of RNA polymerase II fork loop 2 with downstream non-template DNA regulates transcription elongation. J Biol Chem. 2011;286(35):30898–30910. doi: 10.1074/jbc.M111.260844. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Komissarova N, Becker J, Solter S, Kireeva M, Kashlev M. Shortening of RNA:DNA hybrid in the elongation complex of RNA polymerase is a prerequisite for transcription termination. Mol Cell. 2002;10(5):1151–1162. doi: 10.1016/s1097-2765(02)00738-4. [DOI] [PubMed] [Google Scholar]
  • 34.Toulokhonov I, Artsimovitch I, Landick R. Allosteric control of RNA polymerase by a site that contacts nascent RNA hairpins. Science. 2001;292(5517):730–733. doi: 10.1126/science.1057738. [DOI] [PubMed] [Google Scholar]
  • 35.Komissarova N, Kireeva ML, Becker J, Sidorenkov I, Kashlev M. Engineering of elongation complexes of bacterial and yeast RNA polymerases. Methods Enzymol. 2003;371:233–251. doi: 10.1016/S0076-6879(03)71017-9. [DOI] [PubMed] [Google Scholar]
  • 36.Strathern J, et al. The fidelity of transcription: RPB1 (RPO21) mutations that increase transcriptional slippage in S. cerevisiae. J Biol Chem. 2013;288(4):2689–2699. doi: 10.1074/jbc.M112.429506. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Imashimizu M, Shimamoto N, Oshima T, Kashlev M. Transcription elongation: Heterogeneous tracking of RNA polymerase and its biological implications. Transcription. 2014;5:5. doi: 10.4161/trns.28285. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Artsimovitch I, Landick R. Pausing by bacterial RNA polymerase is mediated by mechanistically distinct classes of signals. Proc Natl Acad Sci USA. 2000;97(13):7090–7095. doi: 10.1073/pnas.97.13.7090. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Mehedi M, et al. Ebola virus RNA editing depends on the primary editing site sequence and an upstream secondary structure. PLoS Pathog. 2013;9(10):e1003677. doi: 10.1371/journal.ppat.1003677. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Bochkareva A, Yuzenkova Y, Tadigotla VR, Zenkin N. Factor-independent transcription pausing caused by recognition of the RNA-DNA hybrid sequence. EMBO J. 2012;31(3):630–639. doi: 10.1038/emboj.2011.432. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Kireeva ML, et al. Transient reversal of RNA polymerase II active site closing controls fidelity of transcription elongation. Mol Cell. 2008;30(5):557–566. doi: 10.1016/j.molcel.2008.04.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Imashimizu M, Oshima T, Lubkowska L, Kashlev M. Direct assessment of transcription fidelity by high-resolution RNA sequencing. Nucleic Acids Res. 2013;41(19):9090–9104. doi: 10.1093/nar/gkt698. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Vassylyev DG, et al. Crystal structure of a bacterial RNA polymerase holoenzyme at 2.6 A resolution. Nature. 2002;417(6890):712–719. doi: 10.1038/nature752. [DOI] [PubMed] [Google Scholar]
  • 44.Banavali NK. Partial base flipping is sufficient for strand slippage near DNA duplex termini. J Am Chem Soc. 2013;135(22):8274–8282. doi: 10.1021/ja401573j. [DOI] [PubMed] [Google Scholar]
  • 45.Neher RA, Gerland U. Dynamics of force-induced DNA slippage. Phys Rev Lett. 2004;93(19):198102. doi: 10.1103/PhysRevLett.93.198102. [DOI] [PubMed] [Google Scholar]
  • 46.Nedialkov YA, Nudler E, Burton ZF. RNA polymerase stalls in a post-translocated register and can hyper-translocate. Transcription. 2012;3(5):260–269. doi: 10.4161/trns.22307. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Gusarov I, Nudler E. The mechanism of intrinsic transcription termination. Mol Cell. 1999;3(4):495–504. doi: 10.1016/s1097-2765(00)80477-3. [DOI] [PubMed] [Google Scholar]
  • 48.Hein PP, et al. RNA polymerase pausing and nascent-RNA structure formation are linked through clamp-domain movement. Nat Struct Mol Biol. 2014;21(9):794–802. doi: 10.1038/nsmb.2867. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Bylund GO, Nord S, Lövgren JM, Wikström PM. Alterations in the β flap and β’ dock domains of the RNA polymerase abolish NusA-mediated feedback regulation of the metY-nusA-infB operon. J Bacteriol. 2011;193(16):4113–4122. doi: 10.1128/JB.00196-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Molodtsov V, Anikin M, McAllister WT. The presence of an RNA:DNA hybrid that is prone to slippage promotes termination by T7 RNA polymerase. J Mol Biol. 2014;426(18):3095–3107. doi: 10.1016/j.jmb.2014.06.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Atkins JF, Gestland RF, editors. Recoding: Expansion of Decoding Rules Enriches Gene Expression. Springer; New York: 2010. pp. 1–466. [Google Scholar]
  • 52.Gurvich OL, et al. Sequences that direct significant levels of frameshifting are frequent in coding regions of Escherichia coli. EMBO J. 2003;22(21):5941–5950. doi: 10.1093/emboj/cdg561. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Grentzmann G, Ingram JA, Kelly PJ, Gesteland RF, Atkins JF. A dual-luciferase reporter system for studying recoding signals. RNA. 1998;4(4):479–486. [PMC free article] [PubMed] [Google Scholar]
  • 54.Kireeva ML, Kashlev M. Mechanism of sequence-specific pausing of bacterial RNA polymerase. Proc Natl Acad Sci USA. 2009;106(22):8900–8905. doi: 10.1073/pnas.0900407106. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary File
pnas.201418384SI.pdf (2.1MB, pdf)

Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences

RESOURCES