Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2015 Apr 29.
Published in final edited form as: Toxicol Appl Pharmacol. 2009 Aug 12;241(1):90–100. doi: 10.1016/j.taap.2009.08.004

Arsenic exacerbates atherosclerotic lesion formation and inflammation in ApoE−/− mice

Sanjay Srivastava a,d,*, Elena N Vladykovskaya a, Petra Haberzettl a, Srinivas D Sithu b, Stanley E D'Souza b, J Christopher States c,d
PMCID: PMC4414341  NIHMSID: NIHMS682546  PMID: 19682479

Abstract

Exposure to arsenic-contaminated water has been shown to be associated with cardiovascular disease, especially atherosclerosis. We examined the effect of arsenic exposure on atherosclerotic lesion formation, lesion composition and nature in ApoE−/− mice. Early post-natal exposure (3-week-old mice exposed to 49 ppm arsenic as NaAsO2 in drinking water for 7 weeks) increased the atherosclerotic lesion formation by 3- to 5-fold in the aortic valve and the aortic arch, without affecting plasma cholesterol. Exposure to arsenic for 13 weeks (3-week-old mice exposed to 1, 4.9 and 49 ppm arsenic as NaAsO2 in drinking water) increased the lesion formation and macrophage accumulation in a dose-dependent manner. Temporal studies showed that continuous arsenic exposure significantly exacerbated the lesion formation throughout the aortic tree at 16 and 36 weeks of age. Withdrawal of arsenic for 12 weeks after an initial exposure for 21 weeks (to 3-week-old mice) significantly decreased lesion formation as compared with mice continuously exposed to arsenic. Similarly, adult exposure to 49 ppm arsenic for 24 weeks, starting at 12 weeks of age increased lesion formation by 2- to 3.6-fold in the aortic valve, the aortic arch and the abdominal aorta. Lesions of arsenic-exposed mice displayed a 1.8-fold increase in macrophage accumulation whereas smooth muscle cell and T-lymphocyte contents were not changed. Expression of pro-inflammatory chemokine MCP-1 and cytokine IL-6 and markers of oxidative stress, protein-HNE and protein-MDA adducts were markedly increased in lesions of arsenic-exposed mice. Plasma concentrations of MCP-1, IL-6 and MDA were also significantly elevated in arsenic-exposed mice. These data suggest that arsenic exposure increases oxidative stress, inflammation and atherosclerotic lesion formation.

Keywords: Arsenic, Atherosclerosis, Inflammation, MCP-1, IL-6 and oxidative stress

Introduction

Inorganic arsenic is a worldwide natural drinking water contaminant (Nordstrom, 2002; Smith et al., 2002; Ahmed et al., 2006). In the United States, the Agency for Toxic Substances and Disease Registry (ATSDR) has ranked arsenic as the number one hazardous chemical for more than 10 years (2007). Elevated arsenic levels are present in the ground water in several parts of the United States and some of the public water systems in western states have arsenic levels >9-fold higher than World Health Organization (WHO) or US Environmental Protection Agency (USEPA) recommended maximum levels (Engel et al., 1994; Frost et al., 2003). Exceptionally high levels of arsenic in drinking water are found in Bangladesh, Taiwan, India, Chile and Argentina (Nordstrom, 2002; Ahmed et al., 2006).

Accumulating evidence suggests that arsenic exposure induces cardiovascular disease (CVD) (Engel et al., 1994; Wang et al., 2007; Tseng, 2008; States et al., 2009). Epidemiological studies in Taiwan suggest that the incidence of CVD shows dose–response in people exposed to relatively high levels of arsenic (Chen et al., 1996; Wang et al., 2007; Tseng, 2008). Epidemiologic studies in regions of high arsenic in groundwater show a marked increase in CVD including carotid atherosclerosis (Wang et al., 2002), hypertension (Chen et al., 1995) and ischemic heart disease (Hsueh et al., 1998). Consumption of arsenic-contaminated drinking water is associated with mortality from arterial disease in the United States where much lower arsenic levels prevail (Engel et al., 1994).

Atherosclerosis underlies most CVD and accounts for more than half of all the deaths in the developed world. Epidemiological studies in adults (Wang et al., 2007; Tseng, 2008) as well as experimental studies in adult mice (Simeonova et al., 2003; Bunderson et al., 2004) show strong correlation between arsenic exposure and atherosclerosis. However, little is known about the biochemical mechanisms by which arsenic exacerbates atherosclerosis. Atherosclerosis is a multi-factorial and complex disease. Upon endothelial activation, mononuclear cells such as monocytes and T-lymphocytes attach to the endothelium and then transmigrate into sub-endothelial space. Transmigrated monocytes transform into macrophages which, after taking up the oxidized lipids, transform into foam cells. These cholesterol-rich macrophages secrete pro-inflammatory cytokines and enhance lesion inflammation and atherogenesis. At the latter stages of atherogenesis, oxidized lipids stimulate the migration of medial smooth muscle cells into the intima. The intimal smooth muscle cells proliferate and engulf the oxidized lipids (also forming foam cells), synthesize extracellular matrix proteins and form fibrous cap. Therefore, lesion size, composition and nature are all important parameters for the comprehensive understanding of the processes of atherogenesis. Moreover, since atherosclerosis is a heterogeneous process, the extent and nature of the lesions could vary at different locations and different stages of the disease. In the present study, we have systematically and comprehensively examined the effect of early post-natal life and adult exposure to arsenic on extent, composition and nature of atherosclerotic lesion formation in ApoE−/− mice.

Methods

Foam cell formation

Arsenic-induced foam cell formation in vitro was examined in bone marrow derived macrophages isolated from C57/BL6 mice (Reynolds et al., 2007). Cells were seeded in 6-well dish (1×106 cells/well) in RPMI media supplemented with 1% Penicillin/ Streptomycin and 0.1% fetal bovine serum. After 24 h, fresh media containing copper oxidized LDL (oxLDL, 10 µg/mL) and 0 or 5 µM NaAsO2 was added and cells were incubated for 24 h. Cells then were incubated with Nile Red (100 ng/mL; Invitrogen, Carlsbad, CA) for 15 min at 4 °C. Lipid uptake was quantified by measuring Nile Red florescence (10,000 cells) by flow cytometry (Greenspan et al., 1985).

Animal housing and treatment protocols

One hundred and fourteen, male ApoE−/− mice (B6.129P2-ApoEtm1Unc/J, Jax Labs, Bar Harbor, ME) were used for the study. The mice were housed and bred under pathogen-free conditions in the University of Louisville vivarium under controlled temperature and 12 h light/12 h dark cycle. Prior to treatments, all mice were maintained on a normal chow diet and tap water as described previously (Srivastava et al., 2007a). According to Louisville Water Company, concentration of arsenic in the tap water was below the detection limit of 2 ppb. Although arsenic concentration was not measured in normal chow in the present study, arsenic concentration of up to 390 ppb has been reported in nonpurified diet (Kozul et al., 2008). Studies were performed under protocols approved by the University of Louisville Animal Care and Use Committee.

Mice were subjected to the following treatment protocols (Scheme 1): Three-week-old mice were maintained on tap water (Control; n=12; Protocol A) or tap water supplemented with NaAsO2 (85 mg/L; 49 ppm As; n=9; Protocol B) for 7 weeks. In Protocols C–F, 3-week-old mice were maintained on tap water (Control; n=15; Protocol C) or tap water supplemented with NaAsO2 (1 ppm As; n=10; Protocol D), (4.9 ppm As; n=10; Protocol E) and (49 ppm As; n=14; Protocol F) for 13 weeks. In Protocols G–H, 3-week-old mice were maintained on tap water (Control; n=10; Protocol G) or tap water supplemented with NaAsO2 (49 ppm As; n=7; Protocol H) for 33 weeks. In Protocol I, 3-week-old mice were provided water with NaAsO2 (n=8) for 21 weeks and then maintained on tap water for an additional 12 weeks. In Protocol J, 12-week-old mice were maintained on tap water supplemented with NaAsO2 (n=15) for 24 weeks. Throughout the course of the study all mice were maintained on normal chow.

Scheme 1.

Scheme 1

Exposure protocols.

Two mice, one each in Protocols H and I died and were excluded from the study. All the other mice completed the experimental protocols successfully. At the end of the treatment protocols, mice were anesthetized with pentobarbital and blood and tissues were removed for use as described below.

Atherosclerotic lesion analyses

For the morphometric analysis, entire aorta from the heart, extending to the iliac arteries and including the subclavian right and left common carotid arteries, was removed and rinsed with phosphate buffered saline (PBS). Periadventitial tissue was removed under the dissecting microscope and, wherever indicated, aortic arch and distal aorta were cut longitudinally to expose the intimal surface. The tissue was pinned en face on wax and lipids were stained with Sudan IV, wherever indicated. The aortic arch was defined as the region from ascending arch to 3 mm distal to subclavial artery (Srivastava et al., 2007a). Percent lesion area was calculated using Metamorph 4.5 software.

For the analysis of lesion formation in the aortic valve, the tissue was frozen in OCT reagent and serial cryosections of 8 µm-thickness were taken from the origin of the aortic valve leaflets, throughout the aortic sinus as described previously (Srivastava et al., 2007a). Mean lesion area was calculated from the analysis of digital images obtained from 9 to 12 serial sections from each aortic sinus sample, using Metamorph 4.5 software. Oil Red O staining was used to detect lipid deposition in these sections. Sirius Red staining was used to visualize collagen.

Plasma lipoprotein analyses

Plasma cholesterol and triglyceride levels were measured enzymatically and lipoprotein subclass profiles were determined by nuclear magnetic resonance spectroscopy as described (Srivastava et al., 2007a).

Immunohistochemical analyses

Immunohistochemical staining with protein-HNE and protein-MDA antibody was performed as described (Srivastava et al., 2006, 2007b). Immunostainining for MCP-1 and IL-6 was performed using a goat polyclonal anti-MCP-1 (Santa Cruz Biotechnology, Santa Cruz, CA) and rat monoclonal antimouse IL-6 (Biolegends, San Diego, CA), respectively. Macrophages were detected with a rat monoclonal antibody against mouse macrophages, clone MOMA-2 (Serotec, Raleigh, NC). Smooth muscle cells were identified with a monoclonal anti-α-smooth muscle cell actin, clone A4 (Sigma Chemicals, St. Louis, MO) and T-lymphocytes were stained with a rabbit polyclonal anti-CD3 antibody (Santa Cruz). Briefly, the air-dried cryostat sections were fixed in cold acetone and endogenous peroxidase activity was quenched with hydrogen peroxide. Sections were incubated with primary antibody for appropriate amount of time, rinsed and after incubation with appropriate secondary antibodies, the immunostains were visualized with diaminobenzidine or Nova Red (Vector Laboratories, Burlingame, CA). The sections were then counterstained with Mayer’s hematoxylin. At least three sections per animal were analyzed for each staining. Appropriate non-immune serum was used as negative control. Digital images were acquired using Spot advanced camera and analyzed by Metamorph 4.5 software as described (Srivastava et al., 2006). For each stain, the threshold was predetermined, and held constant for all sections analyzed from each protocol. Samples were analyzed by one blinded observer.

Measurements of lipid peroxidation-derived aldehydes by gas chromatography-mass spectrometry

Concentration of malonaldialdehyde, the most abundant lipid peroxidation-derived aldehyde was measured in the plasma as described (Srivastava et al., 2002). Benzaldehyde ring D5 was used as internal standard.

Measurements of cytokines

Expression of pro-inflammatory cytokines was measured in the arsenic-treated bone marrow derived macrophages in vitro. Cells were incubated with 0, 5 and 20 µM NaAsO2 in RPMI media containing 0.1 % FBS for 6 h and expression of cytokines was measured by quantitative PCR. RNA was isolated using Trizol reagent and 2.0 µg RNA was reverse transcribed with AMV reverse transcriptase (Promega Corporation, Madison, WI) at 42 °C for 60 min, followed by PCR amplification. Quantitative RT-PCR was carried out in a BioRad Real-Time PCR thermocycler using iQTM SYBR green supermix (Biorad Laboratories, Hercules, CA). The following sets of primers were used: TNF-α, GCATGATCCGCGACGTGGAA, AGATCCATGCCGTTGGCCAG; IL-1β, CTCCATGAGCTTTGTACAAGG, TGCTGATGTACCAGTTGGGG; GAPDH, AGGTCATCCCAGAGCTGAACG, GGAGTTGCTGTTGAAGTCGCA. Primers for IL-6 were obtained from SABiosciences (Frederick, MD). The primers were validated to yield single specific band with a conventional RT-PCR. Readings were normalized by GAPDH to calculate ΔCt-values. Concentrations of MCP-1 and IL-6 in the plasma were determined by ELISA, using commercial kits as per manufacturer’s instructions.

Statistical analyses

All results are presented as mean±standard error of mean (SEM). Statistical significance between two groups was established by Student’s t-test. For multiple group analysis, one-way ANOVA with Holm-Sidak post-hoc analysis was used. A value of P<0.05 was considered significant.

Results

Foam cell formation is an early event in atherogenesis. In the subendothelial space macrophages take up cholesterol and transform into foam cells. We examined the effect of arsenic exposure on foam cell formation in vitro and in lesions of mice exposed to arsenic. FACS analysis of macrophages incubated with oxidized LDL and 5 µM NaAsO2 for 18 h showed that lipid uptake was increased by 2-fold as compared to cells incubated with oxidized LDL without arsenic (Fig. 1A). To examine the foam cell formation in vivo, 3-week-old mice were exposed to arsenic for 7 weeks and lesion formation was examined throughout the aortic tree. Arsenic-exposure did not affect body weight, heart weight or general health of the mice (data not shown). Morphometric analysis of aortic valves showed that exposure to arsenic led to a 3.6-fold increase in lesion formation as compared with tap water-fed controls (P<0.01; Fig. 1B). Staining of the aortic sinus with Oil Red O showed a small number of lipid-laden foam cells in aortic valve cusps in vehicle-fed controls. Accumulation of cholesterol-rich foam cells was significantly increased in aortic roots of arsenic-exposed mice. Similar to the aortic valves, in 10-week-old control mice, Sudan IV staining showed very few sparse lesions in the aortic arch. However, corresponding arsenic-exposed mice showed appreciable lesion formation in the aortic arch. The lesions were primarily localized in the area of low shear stress. Quantitation of the lesion area showed that lesion formation in the aortic arch of arsenic-exposed mice was >5-fold larger than in control mice (P<0.01; Fig. 1B). None of the 10-week-old arsenic-exposed or control mice displayed any lesions in the abdominal aorta (data not shown).

Fig. 1.

Fig. 1

Arsenic increases foam cell formation in vitro and early life exposure to arsenic exacerbates all stages of atherosclerotic lesion formation. Panel A shows the foam cell formation in vitro in murine bone marrow derived macrophages incubated with oxidized LDL (10 µg/mL) and 0 or 5 µM NaAsO2. Quantification of the lipid uptake was done by flow cytometry. Panel B shows early lesion formation in ApoE−/− mice. Three-week-old ApoE−/− mice were either maintained on tap water (Control; Protocol A) or tap water supplemented with 85 mg/L NaAsO2 (49 ppm As; Protocol B) for 7 weeks. Lesion formation was examined in the aortic valve (i) and the aortic arch (ii). Lipids were stained with Oil Red O in the aortic valve and Sudan IV in the aortic arch. Panel C shows the temporal effect of arsenic exposure on atherosclerotic lesion formation. Starting at 3 weeks of age, mice were maintained on tap water supplemented with NaAsO2 (49 ppm As) and lesion formation was examined at 10 (Protocol B), 16 (Protocol F) and 36 (Protocol H) weeks of age in the aortic valve (i), the aortic arch (ii) and the abdominal aorta (iii). Mice maintained on tap water (Protocols A, C and G) served as controls. Values are expressed as mean±SEM. *P<0.01 versus Control.

Early life exposure to arsenic did not affect plasma cholesterol concentration (Table 1). However, early life exposure to arsenic caused a significant decrease (P<0.01) in the plasma triglyceride levels (Table 1). NMR analysis of the subclasses of lipoproteins showed that the mean particle size of VLDL and HDL particles of arsenic-exposed and control mice were similar. However, plasma VLDL concentration in arsenic-exposed mice was decreased by 20% (Table 1). Sub-classification of the VLDL particle showed a significant decrease in the abundance of large VLDL particles (>60 nm diameter) in arsenic-exposed mice, whereas small (27–35 nm) and medium (35–60 nm) VLDL concentrations were not changed significantly. Together, these data suggest that despite a significant decrease in plasma triglycerides and large VLDL particles, short-term early life exposure to arsenic increases fatty streak formation.

Table 1.

Plasma lipids and lipoprotein analyses of arsenic-exposed mice.

Treatment Plasma cholesterol
(mg/dL)
Plasma triglycerides
(mg/dL)
Particle size (nm)
Particle concentration (nmol/L)
VLDL Abundance (nmol/L)
VLDL HDL VLDL HDL Small Medium Large
Control (10 weeks) 377 ±26 105 ±10 73 ±3 8 ±0.1 274 ±25 5000 ±1000 166 ±30 100 ±8 18.6±1
As 49 ppm (3–10 weeks) 371 ±24 78 ± 12* 66 ±2 7.7 ±0.1 220 ±27* 4910 ±500 121 ±20 88 ±8 10.9 ±1*
Control (16 weeks) 383 ± 26 97 ±6 ND ND ND ND ND ND ND
As 1 ppm (3–16 weeks) 422 ± 14 79 ±6† ND ND ND ND ND ND ND
As 1 ppm (3–16 weeks) 403 ±12 81 ±5† ND ND ND ND ND ND ND
As 49 ppm (3–16 weeks) 411 ±16 74 ±8† ND ND ND ND ND ND ND
Control (36 weeks) 499 ± 39 125 ±15 75 ±2 8±1 265 ±8 6005 ±1090 158 ±10 94 ±3 16.6±1
As (3–36 weeks) 463 ± 54 90±4§ ND ND ND ND ND ND ND
As (3–24 weeks) + water (24–36 weeks) 460 ± 43 89±8§ ND ND ND ND ND ND ND
As (12–36 weeks) 433± 26 95±8§ 63±2 8±0.1 264±27 9010±3023 144±22 107±8 16.9±1

ApoE−/− mice were either maintained on tap water (control) or exposed to drinking water supplemented with sodium arsenite (49 ppm) for indicated period on time. ND—not determined. Values are expressed as mean ± SEM.

*

P<0.05 versus control (10 weeks);

†

P<0.05 versus control (16 weeks) and

§

P<0.05 versus control (36 weeks).

To examine the long-term atherogenic effect of arsenic exposure on different stages of lesion formation, we performed temporal studies. Beginning at 3 weeks of age, mice were provided arsenic-supplemented water and atherosclerotic lesion formation was examined at 16 (Protocol F) and 36 weeks (Protocol H) of age. Mice maintained on tap water served as controls (Protocols C and G). As shown in Table 1, arsenic-exposed mice showed a significant decrease in the plasma triglyceride concentration with no change in plasma cholesterol, both at 16 and 36 weeks of age (Table 1). Again, despite the decrease in plasma triglycerides, the lesion area in arsenic-exposed mice was significantly increased (Fig. 1C). Sixteen-week-old arsenic-exposed mice showed 2–4-fold increase in lesion area in the aortic valve, aortic arch and abdominal aorta. At 36 weeks of age both the control and arsenic-exposed mice showed appreciable lesions throughout the aortic tree. However, lesion formation was significantly increased in arsenic-exposed mice (2-fold in the aortic valve, 3.6-fold in aortic arch and 2.4-fold in abdominal aorta).

Next, we examined the dose–response of arsenic-induced exacerabation of lesion formation. Three-week-old mice were provided water supplemented with sodium arsenite (1 ppm; Protocol D and 4.9 ppm; Protocol E) for 13 weeks and lesion formation was compared with 16-week-old mice maintained on tap water (Control; Protocol C). Exposure to arsenic increased the plaque formation both in the aortic valve (Fig. 2A) and the aortic arch (Fig. 2B) in a dose-dependent manner. Staining of the sections of the aortic sinus of anti MOMA-2 antibodies showed a dose-dependent increase in the accumulation of macrophages in arsenic-exposed mice (Fig. 2C). Staining for smooth muscle cells and CD3+ T-cells was minimal in both control and arsenic exposed mice (data not shown).

Fig. 2.

Fig. 2

Fig. 2

Arsenic enhances atherosclerotic lesion formation and macrophage accumulation in lesions in a dose-dependent manner. Three-week-old ApoE−/− mice were either maintained on tap water (Control; Protocol C) or tap water supplemented with 1 (Protocol D), 4.9 (Protocol E) or 49 ppm NaAsO2 (Protocol F) for 13 weeks. Lesion formation was examined in the aortic valve (A) and the aortic arch (B). Lipids were stained with Oil Red O in the aortic valve and Sudan IV in the aortic arch. Accumulation of macrophages is the aortic valve was examined by staining the sections with anti-MOMA-2 antibody (C). Values are expressed as mean±SEM. #P<0.05 and *P<0.01 versus Control.

Next, we examined whether continuous arsenic exposure is essential for the increase in lesion formation. For these experiments, 3-week-old mice were maintained on arsenic supplemented tap water for 21 weeks and then switched to tap water with no arsenic for an additional 12 weeks (Protocol I). Lesion areas in these mice were compared with mice maintained on tap water for 36 weeks (Protoco G) or mice continuously maintained on arsenic supplemented water for 33 weeks (Protocol H). As shown in Fig. 3, withdrawal of arsenic in mice under Protocol I significantly decreased the plaque area throughout the aortic tree as compared with mice continuously maintained on arsenic supplemented water (Protocol H). However, surface lesion area in the arsenic-exposed mice under Protocol I was still significantly larger as compared with mice maintained on tap water (Protocol G). Together these data suggest that withdrawal of arsenic decreases lesion progression in ApoE−/− mice, but does not attenuate the initial atherogenic affects.

Fig. 3.

Fig. 3

Withdrawal of arsenic diminishes atherosclerotic lesion formation. Starting at age 3 weeks, ApoE−/− mice were maintained on tap water supplemented with NaAsO2 (49 ppm As) for 21 weeks and then the mice were maintained on tap water for an additional 12 weeks (Protocol I). Lesion formation in the aortic valve (A), the aortic arch (B) and the abdominal aorta (C) was compared with mice continuously maintained on tap water (Control; Protocol G) or NaAsO2 (49 ppm As; Protocol H). Values are expressed as mean±SEM. *P<0.01 versus Control (tap water) and #P<0.01 versus mice continuously maintained on water supplemented with arsenic.

In the next series of experiments, we examined how adult exposure to arsenic affects atherogenesis. For these experiments, starting at 12 week of age, mice were maintained on arsenic supplemented water for 24 weeks (Protocol J). Mice maintained on tap water (Protocol G) served as controls. Similar to early life and early life plus adult exposure, adult-only arsenic exposure did not affect plasma cholesterol but significantly decreased plasma triglycerides (Table 1). However, unlike the early life exposure, the abundance of total VLDL particle and large VLDL particle in adult-only exposure group was comparable to controls (Table 1). Atherosclerotic lesion area in the adult-only arsenic exposed mice was significantly increased throughout the aortic tree (Fig. 4A). Quantification of lesion area showed that arsenic exposure increases lesion formation by 2.1fold in the aortic valves (P<0.01), 3.6-fold in the aortic arch (P<0.01) and 2.4-fold in the abdominal aorta (P<0.01).

Fig. 4.

Fig. 4

Exposure to arsenic in adult mice exacerbates atherogenesis and affects lesion cellularity. Starting at 12 weeks of age ApoE−/− mice were maintained on tap water supplemented with NaAsO2 (49 ppm As; Protocol J) for 24 weeks. Lesion formation and composition in these mice were compared with 36-week-old mice maintained on tap water (Control; Protocol G). Panel A shows the effect of arsenic exposure on lesion formation in the aortic valve (i), the aortic arch (ii) and the abdominal aorta (iii). Panel B shows the effect of arsenic exposure on lesion composition in the aortic valve. Macrophage accumulation was examined following staining with anti-MOMA-2 (i), smooth muscle cell abundance was stained with anti-α-smooth muscle cell actin (ii), and T-lymphocytes were stained with anti-CD3 (iii) antibodies. Interstitial collagen was stained with Sirius Red (iv). Values are expressed as mean±SEM. #P<0.05 and *P<0.01 versus Control.

To examine the effect of arsenic exposure on the composition of the atherosclerotic lesions, we quantified the abundance of macrophages, T-lymphocytes, smooth muscle cells and collagen in the aortic valves of these mice. For these experiments, sections of aortic valves of control and arsenic-exposed mice (adult exposure; Protocols G and J) were used. As shown in Fig. 4B, the macrophage content, was 1.8-fold greater in arsenic-exposed mice than in controls (P<0.01). Staining for the smooth muscle cells with antismooth muscle cell α-actin showed that most of the cells were in the intimal area closest to the lumen. When quantified, the staining in arsenic-exposed mice was comparable to the controls. Only few cells (<2%) showed positive staining for T-lymphocytes (CD3 positive cells). The extent of staining was similar in arsenic-exposed and control mice. Staining with Sirius Red showed that the interstitial collagen content of lesions in arsenic-exposed mice was 1.3-fold higher. Similar to adult exposure, early life arsenic exposure (3–16 weeks of age, Protocols D–F) also increased the accumulation of macrophages in the aortic valves of 16-week-old mice in dosedependent manner (Fig. 2C). However, no smooth muscle cells or T-lymphocytes were detected in the lesions of 16-week-old arsenic exposed mice (data not shown).

Macrophages secrete pro-inflammatory cytokines, which can increase vascular inflammation. Therefore, we examined the effect of arsenic exposure on the generation of pro-inflammatory cytokines in bone marrow derived murine macrophages in vitro. Cells were incubated with 0, 5 and 20 µM NaAsO2 in RPMI for 6 h and cytokine mRNA production was measured by quantitative PCR. As shown in Fig. 5A, NaAsO2 (5 µM) increased the expression of IL-6 by 7-fold but did not increase the expression of TNFα and IL-1β. In macrophages exposed to 20 µM NaAsO2, IL-6 expression increased by 60-fold but TNFα and IL-1β expression increased only modestly. To examine the effect of arsenic exposure on inflammation in atherosclerotic lesions, we examined the expression of chemokine MCP-1 and pro-inflammatory cytokine IL-6 in aortic valves of control and arsenic-exposed mice (adult exposure; Protocols G and J). As shown in Fig. 5B, atherosclerotic lesions of control mice displayed marked immunopositive reactivity with MCP-1 antibodies. MCP-1 expression was markedly increased in the lesions of arsenic-exposed mice. Similarly, exposure to arsenic also increased IL-6 expression in atherosclerotic lesions (Fig. 5C). Moreover, we also observed a significant increase in the plasma concentrations of MCP-1 (Fig. 5D) and IL-6 (Fig. 5E) in arsenic-exposed mice.

Fig. 5.

Fig. 5

Arsenic enhances vascular inflammation. For in vitro assays, bone marrow derived macrophages were incubated with 0, 5 and 20 µM NaAsO2 for 6 hand expression of cytokine mRNAs was examined by quantitative PCR (A). To examine arsenic-induced inflammation in vivo, ApoE−/− mice were either maintained on tap water (Control; Protocol G) or tap water supplemented with NaAsO2 for 24 weeks starting at age 12 weeks (49 ppm As; Protocol J). Sections of the aortic valve were stained with anti-MCP-1 (B) and anti-IL-6 (C) antibodies. Plasma levels of MCP-1 (D) and IL-6 (E) were measured by ELISA as described under Methods. Values are expressed as mean±SEM. *P<0.01 versus Control.

One possible mechanism by which lesion inflammation is enhanced is oxidative stress. Oxidized lipoproteins in atherosclerotic lesions can cause endothelial activation, foam cell formation and cytokine production. To examine whether arsenic increases oxidative stress in lesions of arsenic-exposed mice, we examined accumulation of lipid peroxidation derived aldehydes (HNE and MDA) in aortic valves of control and arsenic-exposed mice (adult exposure; Protocols G and J). As shown in Fig. 6, atherosclerotic lesions of control mice showed appreciable expression of protein-HNE and protein-MDA adducts. The accumulation of protein-HNE (Fig. 6A) and protein-MDA (Fig. 6B) adducts was markedly increased in the lesions of arsenic-exposed mice. Similar to the atherosclerotic lesions, concentration of MDA in the plasma was increased by 2.5-fold in arsenic-exposed mice (Fig. 6C).

Fig. 6.

Fig. 6

Arsenic increases oxidative stress in the lesions. ApoE−/− mice were either maintained on tap water (Control; Protocol G) or tap water supplemented with sodium arsenite for 24 weeks starting at age 12 weeks (49 ppm As; Protocol J). Oxidative stress in the lesions was examined by staining the sections with the antibodies raised against the protein adducts of lipid peroxidation derived aldehydes, HNE (Protein-HNE; A) and MDA (Protein-MDA; B). Panel C shows the plasma levels of MDA, measured by GC-MS as described under Methods. Values are expressed as mean±SEM. *P<0.01 versus Control.

Discussion

Our study for the first time shows that early post natal exposure to arsenic for only 7 weeks markedly increased lesion area in aortic valves and aortic arch. However, exposure to arsenic did not affect plasma cholesterol concentrations. The only effect of arsenic exposure on plasma lipids was a significant decrease in plasma triglycerides and large VLDL particles. Since increased concentrations of plasma triglycerides and VLDL correlate with the increased risk of cardiovascular disease in humans (Hodis et al., 1994; Carmena et al., 2004), our data showing that exposure to arsenic increases plaque formation and lesion inflammation, despite a significant decrease in plasma triglycerides and large VLDL is quite remarkable. Interestingly, in humans, arsenic-related ischemic heart disease was reported to be independent of changes in the serum lipids (Hsueh et al., 1998). Early life exposure to arsenic-contaminated water in humans is associated with arteriosclerosis and myocardial infarction in infants (Rosenberg, 1973, 1974) and increased mortality from lung cancer and bronchiectasis (Smith et al., 2006). Moreover, recently, we showed that exposure of pregnant dams to arsenic exacerbates atherosclerotic lesion formation in the offspring in ApoE−/− mice again in spite of a decrease in plasma triglycerides (Srivastava et al., 2007a). Together, these observations suggest that infants might be particularly susceptible to the atherogenic affects of arsenic.

Our temporal studies showed that prolonged exposure to arsenic increased the lesion formation throughout the aortic tree. Moreover, removal of arsenic after initial treatment for 21 weeks slowed down the lesion progression. However, the lesions in these mice did not regress after 12 weeks of withdrawal and were significantly higher than the controls. Nonetheless, lesion areas in these mice were significantly smaller than mice continuously maintained on arsenic supplemented water. These observations complement a population based study showing that arsenic exposure cessation could reverse peripheral vascular disease (Pi et al., 2005).

Similar to early life exposure, we observed significant increase in lesion formation in the aortic valves, aortic arch and abdominal aorta in adult mice exposed to arsenic for 24 weeks. Arsenic feeding did not affect plasma cholesterol concentrations, but decreased the plasma triglycerides. The observed increase in lesion size following adultexposure to arsenic in this study is in agreement with a previous report showing that long-term arsenic exposure (20 or 100 mg/L NaAsO2 for 24 weeks) to adult ApoE−/− mice increases atherosclerotic lesion formation in the aorta by 1.6–2.3 fold and accumulation of arsenic in the lesions by 5–10 fold (Simeonova et al., 2003). Similarly adult exposure to arsenic has been shown to increase the lesion size in the innominate arteries of ApoE−/−/LDLR−/− mice (Bunderson et al., 2004).

We further probed the effect of arsenic exposure on composition and nature of the lesions. Exposure to arsenic increased the accumulation of macrophages in aortic valves, but did not affect smooth muscle cell and T-lymphocyte concentrations in the lesions. Macrophages are key cellular elements in atherosclerotic plaque pathogenesis and are vital determinants of plaque stability and rupture (Li and Glass, 2002). The importance of macrophages in atherogenesis is underscored by the observation that macrophage-deficient mice are resistant to atherosclerotic lesion formation (Smith et al., 1995).

MCP-1 plays a pivotal role in the trafficking of macrophages and genetic deletion of MCP-1 or its receptor CCR2 in atherogenic mice decreases lesion size and macrophage accumulation (Gu et al., 1998; Dawson et al., 1999). Bone marrow transplant from mice overexpressing MCP-1 accelerates atherosclerosis (Aiello et al., 1999). Our data show that arsenic exposure (Protocol H) increases MCP-1 expression in vascular lesions and MCP-1 concentration in the plasma. Moreover, we also observed increased expression of proinflammatory cytokine IL-6 in the proliferative regions of lesions and in the plasma of arsenic-exposed mice. IL-6 is recognized as a local as well as peripheral marker for vascular inflammation, and is an independent risk factor for coronary artery disease and increased IL-6 expression in plaques strongly correlates with plaque instability and rupture (Biasucci et al., 1996; Luc et al., 2003; Kleemann et al., 2008). IL-6 can also induce MCP-1 expression (Rott et al., 2003) and enhance lesion inflammation. Our studies showing exposure to arsenic enhances both vascular inflammation and circulating concentrations of plasma MCP-1 and IL-6 are consistent with the studies of Wu et al. (2003) showing exposure to arsenic increases IL-6 concentration in the plasma. Moreover, recent studies suggest that humans carrying two risk genotypes of ApoE and MCP-1 and exposed to arsenic-contaminated drinking water have >10-fold greater risk of carotid atherosclerosis than unexposed populations (Hsieh et al., 2008). Collectively, our experimental data along with the human data suggest arsenic exposure induced inflammation plays a key role in the exacerbation of atherogenic responses.

One potential mechanism by which arsenic could enhance vascular inflammation is oxidative stress. Cytokines, such as IL-6 increase the formation of reactive oxygen species (ROS). Arsenic has been shown to increase the generation of ROS in vascular cells in vitro (Chen et al., 1998; Barchowsky et al., 1999), which can affect gene expression and inflammatory responses (Willerson and Ridker, 2004). ROS have a very short half life and direct effects are restricted to the site of their generation. Many of the atherogenic properties of ROS have been attributed to aldehydes generated from lipid oxidation. Oxidized lipid derived aldehydes cause monocyte adhesion, foam cell formation and vascular inflammation (Berliner and Gharavi, 2008; Uchida, 2008). Proteins cross-linked with lipid derived aldehydes are present in atheromas (Berliner and Gharavi, 2008; Uchida, 2008) and immunization of experimental animals with aldehyde proteinadducts diminishes atherosclerotic lesion formation (George et al., 1998) suggesting these aldehydes could be causally involved in atherogenesis. Our data show that arsenic augments the accumulation of protein-adducts of lipid peroxidation-derived aldehydes MDA and HNE in the atherosclerotic lesions and concentration of MDA in the plasma. These observations complement the population based study showing increased blood arsenic level correlates with increased ROS production, compromised oxidative defense capacity and generation of IL-1β, IL-6 and MCP-1 (Wu et al., 2001).

In summary, our data show that even a short-term early life exposure to arsenic increases lesion formation without increasing plasma cholesterol. Prolonged exposure to arsenic results in a dose-dependent increase in lesion formation throughout the aortic tree and withdrawal of arsenic diminishes the exacerbation of lesion formation. Lesions in arsenic-exposed mice display enhanced interstitial fibrosis, increased macrophage accumulation, lesion inflammation and accumulation of products of lipids oxidation which can further exacerbate lesion inflammation and atherogenesis. Significantly, many of our findings complement the observed atherogenic affects of arsenic in humans exposed to arsenic-contaminated water. Further studies are required to examine the effect of anti-inflammatory and antioxidant therapy in diminishing the atherogenic affects of arsenic.

Acknowledgments

This work was supported in part by National Institutes of Health grants, R01ES017260, R01 HL65618, R01ES011314, R21ES015812, P01ES011860, P20RR24489, P30ES014443, and a pilot grant from the University of Louisville Center for Genetics and Molecular Medicine. Technical assistance of Barbara Bishop, David Young, Erica Werkman, Denny Clark, Ntube O. Ngalame and Heather L. Miller is gratefully acknowledged.

Abbreviations

ApoE

Apolipoprotein E

MCP-1

Monocyte chemotactic protein-1

IL-6

Interleukin-6

HNE

4, hydroxynonenal

MDA

malonaldialdehyde

Footnotes

Conflict of interest statement

The authors declare that there are no conflicts of interest.

References

  1. Agency for Toxic Substances and Disease Registry. CERCLA Priority List of Hazardous Substances. www.atsdr.cdc.gov/cercla/07list.html.
  2. Ahmed MF, Ahuja S, Alauddin M, Hug SJ, Lloyd JR, Pfaff A, Pichler T, Saltikov C, Stute M, van GA. Epidemiology. Ensuring safe drinking water in Bangladesh. Science. 2006;314:1687–1688. doi: 10.1126/science.1133146. [DOI] [PubMed] [Google Scholar]
  3. Aiello RJ, Bourassa PA, Lindsey S, Weng W, Natoli E, Rollins BJ, Milos PM. Monocyte chemoattractant protein-1 accelerates atherosclerosis in apolipoprotein E-deficient mice. Arterioscler. Thromb. Vasc. Biol. 1999;19:1518–1525. doi: 10.1161/01.atv.19.6.1518. [DOI] [PubMed] [Google Scholar]
  4. Barchowsky A, Klei LR, Dudek EJ, Swartz HM, James PE. Stimulation of reactive oxygen, but not reactive nitrogen species, in vascular endothelial cells exposed to low levels of arsenite. Free Radic. Biol. Med. 1999;27:1405–1412. doi: 10.1016/s0891-5849(99)00186-0. [DOI] [PubMed] [Google Scholar]
  5. Berliner JA, Gharavi NM. Endothelial cell regulation by phospholipid oxidation products. Free Radic. Biol. Med. 2008;45:119–123. doi: 10.1016/j.freeradbiomed.2008.04.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Biasucci LM, Vitelli A, Liuzzo G, Altamura S, Caligiuri G, Monaco C, Rebuzzi AG, Ciliberto G, Maseri A. Elevated levels of interleukin-6 in unstable angina. Circulation. 1996;94:874–877. doi: 10.1161/01.cir.94.5.874. [DOI] [PubMed] [Google Scholar]
  7. Bunderson M, Brooks DM, Walker DL, Rosenfeld ME, Coffin JD, Beall HD. Arsenic exposure exacerbates atherosclerotic plaque formation and increases nitrotyrosine and leukotriene biosynthesis. Toxicol. Appl. Pharmacol. 2004;201:32–39. doi: 10.1016/j.taap.2004.04.008. [DOI] [PubMed] [Google Scholar]
  8. Carmena R, Duriez P, Fruchart JC. Atherogenic lipoprotein particles in atherosclerosis. Circulation. 2004;109:III2–III7. doi: 10.1161/01.CIR.0000131511.50734.44. [DOI] [PubMed] [Google Scholar]
  9. Chen CJ, Hsueh YM, Lai MS, Shyu MP, Chen SY, Wu MM, Kuo TL, Tai TY. Increased prevalence of hypertension and long-term arsenic exposure. Hypertension. 1995;25:53–60. [PubMed] [Google Scholar]
  10. Chen CJ, Chiou HY, Chiang MH, Lin LJ, Tai TY. Dose-response relationship between ischemic heart disease mortality and long-term arsenic exposure. Arterioscler. Thromb. Vasc. Biol. 1996;16:504–510. doi: 10.1161/01.atv.16.4.504. [DOI] [PubMed] [Google Scholar]
  11. Chen YC, Lin-Shiau SY, Lin JK. Involvement of reactive oxygen species and caspase 3 activation in arsenite-induced apoptosis. J. Cell Physiol. 1998;177:324–333. doi: 10.1002/(SICI)1097-4652(199811)177:2<324::AID-JCP14>3.0.CO;2-9. [DOI] [PubMed] [Google Scholar]
  12. Dawson TC, Kuziel WA, Osahar TA, Maeda N. Absence of CC chemokine receptor-2 reduces atherosclerosis in apolipoprotein E-deficient mice. Atherosclerosis. 1999;143:205–211. doi: 10.1016/s0021-9150(98)00318-9. [DOI] [PubMed] [Google Scholar]
  13. Engel RR, Hopenhayn-Rich C, Receveur O, Smith AH. Vascular effects of chronic arsenic exposure: a review. Epidemiol. Rev. 1994;16:184–209. doi: 10.1093/oxfordjournals.epirev.a036150. [DOI] [PubMed] [Google Scholar]
  14. Frost FJ, Muller T, Petersen HV, Thomson B, Tollestrup K. Identifying US populations for the study of health effects related to drinking water arsenic. J. Expo. Anal. Environ. Epidemiol. 2003;13:231–239. doi: 10.1038/sj.jea.7500275. [DOI] [PubMed] [Google Scholar]
  15. George J, Afek A, Gilburd B, Levkovitz H, Shaish A, Goldberg I, Kopolovic Y, Wick G, Shoenfeld Y, Harats D. Hyperimmunization of apo-E-deficient mice with homologous malondialdehyde low-density lipoprotein suppresses early atherogenesis. Atherosclerosis. 1998;138:147–152. doi: 10.1016/s0021-9150(98)00015-x. [DOI] [PubMed] [Google Scholar]
  16. Greenspan P, Mayer EP, Fowler SD. Nile red: a selective fluorescent stain for intracellular lipid droplets. J. Cell Biol. 1985;100:965–973. doi: 10.1083/jcb.100.3.965. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Gu L, Okada Y, Clinton SK, Gerard C, Sukhova GK, Libby P, Rollins BJ. Absence of monocyte chemoattractant protein-1 reduces atherosclerosis in low density lipoprotein receptor-deficient mice. Mol. Cell. 1998;2:275–281. doi: 10.1016/s1097-2765(00)80139-2. [DOI] [PubMed] [Google Scholar]
  18. Hodis HN, Mack WJ, Azen SP, Alaupovic P, Pogoda JM, LaBree L, Hemphill LC, Kramsch DM, Blankenhorn DH. Triglyceride- and cholesterol-rich lipoproteins have a differential effect on mild/moderate and severe lesion progression as assessed by quantitative coronary angiography in a controlled trial of lovastatin. Circulation. 1994;90:42–49. doi: 10.1161/01.cir.90.1.42. [DOI] [PubMed] [Google Scholar]
  19. Hsieh YC, Hsieh FI, Lien LM, Chou YL, Chiou HY, Chen CJ. Risk of carotid atherosclerosis associated with genetic polymorphisms of apolipoprotein E and inflammatory genes among arsenic exposed residents in Taiwan. Toxicol. Appl. Pharmacol. 2008;227:1–7. doi: 10.1016/j.taap.2007.10.013. [DOI] [PubMed] [Google Scholar]
  20. Hsueh YM, Wu WL, Huang YL, Chiou HY, Tseng CH, Chen CJ. Low serum carotene level and increased risk of ischemic heart disease related to long-term arsenic exposure. Atherosclerosis. 1998;141:249–257. doi: 10.1016/s0021-9150(98)00178-6. [DOI] [PubMed] [Google Scholar]
  21. Kleemann R, Zadelaar S, Kooistra T. Cytokines and atherosclerosis: a comprehensive review of studies in mice. Cardiovasc. Res. 2008;79:360–376. doi: 10.1093/cvr/cvn120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Kozul CD, Nomikos AP, Hampton TH, Warnke LA, Gosse JA, Davey JC, Thorpe JE, Jackson BP, Ihnat MA, Hamilton JW. Laboratory diet profoundly alters gene expression and confounds genomic analysis in mouse liver and lung 1. Chem. Biol. Interact. 2008;173:129–140. doi: 10.1016/j.cbi.2008.02.008. [DOI] [PubMed] [Google Scholar]
  23. Li AC, Glass CK. The macrophage foam cell as a target for therapeutic intervention. Nat. Med. 2002;8:1234–1242. doi: 10.1038/nm1102-1235. [DOI] [PubMed] [Google Scholar]
  24. Luc G, Bard JM, Juhan-Vague I, Ferrieres J, Evans A, Amouyel P, Arveiler D, Fruchart JC, Ducimetiere P. C-reactive protein, interleukin-6, and fibrinogen as predictors of coronary heart disease: the PRIME Study. Arterioscler. Thromb. Vasc. Biol. 2003;23:1255–1261. doi: 10.1161/01.ATV.0000079512.66448.1D. [DOI] [PubMed] [Google Scholar]
  25. Nordstrom DK. Public health. Worldwide occurrences of arsenic in ground water. Science. 2002;296:2143–2145. doi: 10.1126/science.1072375. [DOI] [PubMed] [Google Scholar]
  26. Pi J, Yamauchi H, Sun G, Yoshida T, Aikawa H, Fujimoto W, Iso H, Cui R, Waalkes MP, Kumagai Y. Vascular dysfunction in patients with chronic arsenosis can be reversed by reduction of arsenic exposure. Environ. Health Perspect. 2005;113:339–341. doi: 10.1289/ehp.7471. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Reynolds JM, Liu Q, Brittingham KC, Liu Y, Gruenthal M, Gorgun CZ, Hotamisligil GS, Stout RD, Suttles J. Deficiency of fatty acid-binding proteins in mice confers protection from development of experimental autoimmune encephalomyelitis. J. Immunol. 2007;179:313–321. doi: 10.4049/jimmunol.179.1.313. [DOI] [PubMed] [Google Scholar]
  28. Rosenberg HG. Systemic arterial disease with myocardial infarction. Report on two infants. Circulation. 1973;47:270–275. doi: 10.1161/01.cir.47.2.270. [DOI] [PubMed] [Google Scholar]
  29. Rosenberg HG. Systemic arterial disease and chronic arsenicism in infants. Arch. Pathol. 1974;97:360–365. [PubMed] [Google Scholar]
  30. Rott D, Zhu J, Zhou YF, Burnett MS, Zalles-Ganley A, Epstein SE. IL-6 is produced by splenocytes derived from CMV-infected mice in response to CMV antigens, and induces MCP-1 production by endothelial cells: a new mechanistic paradigm for infection-induced atherogenesis. Atherosclerosis. 2003;170:223–228. doi: 10.1016/s0021-9150(03)00295-8. [DOI] [PubMed] [Google Scholar]
  31. Simeonova PP, Hulderman T, Harki D, Luster MI. Arsenic exposure accelerates atherogenesis in apolipoprotein E- mice. Environ. Health Perspect. 2003;111:1744–1748. doi: 10.1289/ehp.6332. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Smith JD, Trogan E, Ginsberg M, Grigaux C, Tian J, Miyata M. Decreased atherosclerosis in mice deficient in both macrophage colony-stimulating factor op and apolipoprotein E. Proc. Natl. Acad. Sci. U. S. A. 1995;92:8264–8268. doi: 10.1073/pnas.92.18.8264. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Smith AH, Lopipero PA, Bates MN, Steinmaus CM. Public health. Arsenic epidemiology and drinking water standards. Science. 2002;296:2145–2146. doi: 10.1126/science.1072896. [DOI] [PubMed] [Google Scholar]
  34. Smith AH, Marshall G, Yuan Y, Ferreccio C, Liaw J, von Ehrenstein O, Steinmaus C, Bates MN, Selvin S. Increased mortality from lung cancer and bronchiectasis in young adults after exposure to arsenic in utero and in early childhood. Environ. Health Perspect. 2006;114:1293–1296. doi: 10.1289/ehp.8832. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Srivastava S, Chandrasekar B, Bhatnagar A, Prabhu SD. Lipid peroxidation-derived aldehydes and oxidative stress in the failing heart: role of aldose reductase. Am. J. Physiol. Heart Circ. Physiol. 2002;283:H2612–H2619. doi: 10.1152/ajpheart.00592.2002. [DOI] [PubMed] [Google Scholar]
  36. Srivastava S, Ramana KV, Tammali R, Srivastava SK, Bhatnagar A. Contribution of aldose reductase to diabetic hyperproliferation of vascular smooth muscle cells. Diabetes. 2006;55:901–910. doi: 10.2337/diabetes.55.04.06.db05-0932. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Srivastava S, D’Souza SE, Sen U, States JC. In utero arsenic exposure induces early onset of atherosclerosis in ApoE−/− mice. Reprod. Toxicol. 2007a;23:449–456. doi: 10.1016/j.reprotox.2007.01.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Srivastava S, Chandrasekar B, Gu Y, Luo J, Hamid T, Hill BG, Prabhu SD. Downregulation of CuZn-superoxide dismutase contributes to beta-adrenergic receptor-mediated oxidative stress in the heart. Cardiovasc. Res. 2007b;74:445–455. doi: 10.1016/j.cardiores.2007.02.016. [DOI] [PubMed] [Google Scholar]
  39. States JC, Srivastava S, Chen Y, Barchowsky A. Arsenic and cardiovascular disease. Toxicol. Sci. 2009;107:312–323. doi: 10.1093/toxsci/kfn236. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Tseng CH. Cardiovascular disease in arsenic-exposed subjects living in the arseniasis-hyperendemic areas in Taiwan. Atherosclerosis. 2008;199:12–18. doi: 10.1016/j.atherosclerosis.2008.02.013. [DOI] [PubMed] [Google Scholar]
  41. Uchida K. A lipid-derived endogenous inducer of COX-2: a bridge between inflammation and oxidative stress. Mol. Cells. 2008;25:347–351. [PubMed] [Google Scholar]
  42. Wang CH, Jeng JS, Yip PK, Chen CL, Hsu LI, Hsueh YM, Chiou HY, Wu MM, Chen CJ. Biological gradient between long-term arsenic exposure and carotid atherosclerosis. Circulation. 2002;105:1804–1809. doi: 10.1161/01.cir.0000015862.64816.b2. [DOI] [PubMed] [Google Scholar]
  43. Wang CH, Hsiao CK, Chen CL, Hsu LI, Chiou HY, Chen SY, Hsueh YM, Wu MM, Chen CJ. A review of the epidemiologic literature on the role of environmental arsenic exposure and cardiovascular diseases. Toxicol. Appl. Pharmacol. 2007;222:315–326. doi: 10.1016/j.taap.2006.12.022. [DOI] [PubMed] [Google Scholar]
  44. Willerson JT, Ridker PM. Inflammation as a cardiovascular risk factor. Circulation. 2004;109:II2–II10. doi: 10.1161/01.CIR.0000129535.04194.38. [DOI] [PubMed] [Google Scholar]
  45. Wu MM, Chiou HY, Wang TW, Hsueh YM, Wang IH, Chen CJ, Lee TC. Association of blood arsenic levels with increased reactive oxidants and decreased antioxidant capacity in a human population of northeastern Taiwan. Environ. Health Perspect. 2001;109:1011–1017. doi: 10.1289/ehp.011091011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Wu MM, Chiou HY, Ho IC, Chen CJ, Lee TC. Gene expression of inflammatory molecules in circulating lymphocytes from arsenic-exposed human subjects. Environ. Health Perspect. 2003;111:1429–1438. doi: 10.1289/ehp.6396. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES