Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2016 May 1.
Published in final edited form as: Am J Obstet Gynecol. 2015 Jan 13;212(5):650.e1–650.e11. doi: 10.1016/j.ajog.2015.01.014

Oxidative stress is responsible for maternal diabetes-impaired transforming growth factor beta signaling in the developing mouse heart

Fang Wang 1, E Albert Reece 1,2, Peixin Yang 1,2
PMCID: PMC4417061  NIHMSID: NIHMS655494  PMID: 25595579

Abstract

Objectives

Oxidative stress plays a causal role in diabetic embryopathy. Maternal diabetes induces heart defects and impaired transforming growth factor beta (TGFβ) signaling, which is essential for cardiogenesis. We hypothesize that mitigating oxidative stress through superoxide dismutase 1 (SOD1) overexpression in transgenic (Tg) mice reverses maternal hyperglycemia-impaired TGFβ signaling and its downstream effectors.

Study Design

Day 12.5 embryonic hearts from wild-type (WT) and SOD1 overexpressing embryos of nondiabetic (ND) and diabetic mellitus (DM) dams were used for detection of oxidative stress markers: 4-hydroxynonenal (4-HNE) and malondlaldehyde (MDA), and TGFβ1, 2, 3, phosphor (p)-TGFβ receptor II (TβRII), p-Smad2 and p-Smad3. The expression of three TGFβ responsive genes was also assessed. Day 11.5 embryonic hearts were explanted and cultured ex vivo, with or without treatments of a SOD1 mimetic (tempol) or a TGFβ recombinant protein for detection of TGFβ signaling intermediates.

Results

Levels of 4-HNE and MDA were significantly increased by maternal diabetes, and SOD1 overexpression blocked the increase of these two oxidative stress markers. Maternal diabetes suppresses the TGFβ signaling pathway by down-regulating TGFβ1 and TGFβ3 expression. Consequently, phosphorylation of TβRII, Smad2 and Smad3, downstream effectors of TGFβ, and expression of three TGFβ responsive genes were reduced by maternal diabetes, and these reductions were prevented by SOD1 overexpression. Treatment with tempol or TGFβ recombinant protein restored high glucose-suppressed TGFβ signaling intermediates and responsive gene expression.

Conclusions

Oxidative stress mediates the inhibitory effect of hyperglycemia in the developing heart. Antioxidants, TGFβ recombinant proteins or TGFβ agonists may have potential therapeutic values in the prevention of heart defects in diabetic pregnancies.

Keywords: SOD1 transgenic mice, oxidative stress, TGFβ signaling, embryonic heart

INTRODUCTION

Preexisting maternal diabetes increases the risk of congenital heart defects in the offspring. Major cardiac defects including persistent truncus arteriosus and ventricular septal defects (VSDs) are often seen in offspring of diabetic women1, 2. Because the number of women of reproductive age (18-44 years old) with diabetes is increasing3, diabetes-induced heart defects have become an urgent health problem4.

The critical exposure period for diabetes-induced birth defects is during organogenesis, which occurs during gestational stage 2 to 8 weeks in humans5 and corresponds approximately to E8.5 to 12.5 in the mouse2, 6. Investigations using rodent models of diabetic embryopathy have revealed many important insights into the signal transduction factors that may cause diabetic embryopathy, particularly those involved in diabetes-induced neural tube defects (NTDs)5, 7-15. However, information regarding diabetes-induced alterations in cardiac development signal transduction is limited.

Transforming growth factor β (TGFβ) signaling plays an important role in early embryonic cardiac development, especially in the formation of the cardiac cushions between E8.5 and E12.5 in the mouse16. TGFβ ligands (TGFβ1, 2, 3) bind to the TGFβ type II receptor (TβRII) at the cell surface, causing it to be activated by phosphorylation, and then, in turn, to recruit and phosphorylate TGFβ type I receptor (TβRI). TβRI phosphorylation causes phosphorylation of Smad2 and Smad3 proteins, enabling their migration to the nucleus (in association with Smad4) to regulate transcription of TGFβ target genes.

Maternal diabetes suppresses TGFβ signaling17, which prevents this cascade from occurring, and may contribute to hyperglycemia-induced heart malformations. The mechanism linking impaired TGFβ signaling to heart defects in offspring of diabetic mothers has not been explored. However, previous work suggests a strong correlation between TGFβ signaling and cardiac development. For example, TGFβ1 is responsible for smooth muscle development in the cardiac outflow tract18. In addition, eliminating TGFβ2 via knockout leads to cardiac outflow septum defects in mice19, and deleting TβRII in mice causes cardiac cushion fusion defects and VSD formation 19, 20.

In the developing embryo, maternal diabetes induces mitochondrial dysfunction, enhances cellular ROS production and impairs cellular antioxidant defense capabilities leading to oxidative stress21. Several studies in animal models have shown effectiveness of using antioxidant supplementations to prevent diabetes-induced neural tube defects (NTDs) and heart defects13, 22-25. SOD1 is an endogenous antioxidant enzyme that detoxifies superoxide. Our previous studies7, 26, 27 have demonstrated that mitigating oxidative stress through SOD1 overexpression in mouse embryos ameliorates maternal diabetes-induced NTD formation.

It has been reported that oxidative stress can either inhibit or enhance TGFβ signaling pathway in different model systems17, 28-30. The relationship between oxidative stress and TGFβ signaling in the developing heart under diabetic conditions is unknown. In the present study, we examined the effect of maternal diabetes in vivo and high glucose ex vivo on the TGFβ signaling, and employed the SOD1-Tg mice and a SOD1 mimetic to assess the role of oxidative stress in mediating the inhibitory effect of hyperglycemia on TGFβ signaling.

Material and methods

Animals and Reagents

C57BL/6J mice (average body weight 22 g) were purchased from Jackson Laboratory (Bar Harbor, Maine). SOD1-Tg mice in a C57BL/6J background were revived from frozen embryos by the Jackson Laboratory (stock no. 00298). Streptozotocin (STZ) from Sigma (St. Louis, MO) was dissolved in sterile 0.1M citrate buffer (PH 4.5). Sustained-release insulin pellets were purchased from Linplant (Linshin, Canada).

Mouse models of diabetic embryopathy

All procedures for animal use were approved by the Institutional Animal Care and Use Committee of University of Maryland School of Medicine. Eight-week old wild-type (WT) female mice were intravenously injected daily with 75 mg/kg STZ over two days to induce diabetes. Blood glucose levels were monitored daily by tail vein puncture and using FreeStyle Blood Glucose Monitoring System (TheraSense, Abbot, Alameda, CA). Mice were considered as having diabetes when their blood glucose levels were greater than or equal to 14 mM. Insulin pellets were then subcutaneously implanted in diabetic mice to restore euglycemia prior to mating to protect early embryonic formation and implantation. Mice were then mated with SOD1-Tg male mice at 3:00 PM to generate WT and SOD1-overexpressing embryos.

Embryonic day 0.5 (E0.5) was designated once the vaginal plug was present on the next morning. On E5.5, insulin pellets were removed to permit frank hyperglycemia (>14mM glucose levels), and exposure of the developing embryos to a hyperglycemic conditions from E7 to E12, which is critical period for early heart development. WT, non-diabetic female mice injected with vehicle and sham operated on for insulin pellet implantation served as non-diabetic controls. On E12.5, mice were euthanized, and embryonic hearts were dissected out of the embryos for analysis.

Ex vivo embryonic heart culture

Ex vivo embryonic heart culture was performed and modified according to Dr. Hisayuki Hashimoto's recent publication31. Briefly, E11.5 hearts from nondiabetic WT (ND-WT) dams were quickly explanted, and placed in a 24-well plate coated with collagen gel (A10483-01, BD Gibco). The collagen gel was prepared in 5 mM (low glucose, LG) or 25 mM (high glucose, HG) D-glucose in M199 culture media (M4530, Sigma) and hydrated by warmed Opti-MEM media, plus 1% fetal bovine serum (FBS, 16140071, Gibco) and insulin-transferrin-selenium (ITS, 25-800-CR, Corning). After incubation overnight at 37°C in a humidified atmosphere of 5% CO2, M199 medium with 5 mM (LG) or 25 mM (HG) D-glucose plus 10% FBS, was added to the hearts and culture for 24 hours. Then hearts were treated with 5 mM Tempol (ALX-430-081-M250, Enzo Life Science) for 24 hours to suppress oxidative stress, or 50 ng/ml TGFβ1 recombinant protein (TP300973, Origene) for 48 hours to rescue TGFβ signaling.

Western Blotting

Western blotting was performed as previously described32. Briefly, E12.5 hearts from different experimental groups were sonicated in 35 μl ice-cold lysis buffer [20 Mm Tis-HCl (pH7.5), 150 mM NaCl, 1 mM EDTA, 10 mM NaF, 2 mM Na-orthovanadate, 1mM pheylmethylsulfonyl fluoride and 1% Triton-X-100] containing protease inhibitor cocktail (Sigma, St. Louis, MO). Equal amounts of protein were resolved by SDS-PAGE and transferred onto Immobilon-P membranes (Millipore). Membranes were incubated for 12 hour at 4 °C with the following primary antibodies at 1:1000 to 1:2000 dilutions in 5% nonfat milk: anti-TGFβ; anti-TβRII with/without phosphorylation; anti-Smad2 with/without phosphorylation; anti-Smad3 with/without phosphorylation; anti-SOD1 (Cell Signaling, Beverly, MA); and anti-β-actin (Abcam, Cambridge, MA). Signals were detected using SuperSignal West Femto Maximum Sensitivity Substrate kit (Thermo Scientific). Chemiluminescence emitted from the bands was directly captured using a UVP Bioimage EC3 system (UVP, Upland, CA). Densitometric analysis of chemiluminescence signals was performed by VisionWorks LS software (UVP, Upland, CA).

Real-time PCR

Total RNA was isolated from E12.5 embryonic hearts using an RNeasy Mini Kit (Qiagen, Valencia, CA). Real-time PCR for TGFβ1, β2, β3, Snai2 (snail homolog 2), CTGF (connective tissue growth factor), GDF1 (growth differentiation factor 1) and β-actin were performed using Maxima SYBR Green/ROX qPCR Master Mix assay (Thermo Scientific, Rockford, US). RT-PCR and subsequent calculations were performed by a 7700 ABI PRISM sequence detector system (Applied Biosystem). Primer sequences for RT-PCR are listed in Table 1.

Table 1.

Primer sequences used in RT-PCR

Primer name Primer Source Primer Sequence
TGFβ1F Primerbank ID: 6755775a1 CTCCCGTGGCTTCTAGTGC
TGFβ1R GCCTTAGTTTGGACAGGATCTG
TGFβ2F Primerbank ID: 6678317a1 TCGACATGGATCAGTTTATGCG
TGFβ2R CCCTGGTACTGTTGTAGATGGA
TGFβ3F Primerbank ID: 6678319a1 CCTGGCCCTGCTGAACTTG
TGFβ3R TTGATGTGGCCGAAGTCCAAC
Snai2F Primerbank ID: 6755576a1 TGGTCAAGAAACATTTCAACGCC
Snai2R GGTGAGGATCTCTGGTTTTGGTA
CTGFF Primerbank ID: 6753878a1 GGGCCTCTTCTGCGATTTC
CTGFR ATCCAGGCAAGTGCATTGGTA
GDF1F Primerbank ID: 6679977a1 AACTAGGGGTCGCCGGAAA
GDF1R TCAAAGACGACTGTCCACTCG
Open in a new tab

F: Forward; R: Reverse

Immunostaining

Embryonic hearts were fixed in 4% paraformaldehyde overnight followed by embedding in OCT compound (Sakura finetek, Torrance, CA). 10- m heart cryosections were antigen-unmasked using citrate buffer and blocked in 5% bovine serum albumin in PBS-T (0.1% Triton X-100 in PBS) for 1 hour. The following antibodies were used as primary antibodies: p-Smad2 (1:200) (Cell Signaling Technology), p-Smad3 (1:200) (Cell Signaling Technology), p-Histone H3 (1:100) (Millipore, Bedford, MA). Normal rabbit or mouse IgG at the same dilutions as those for antibodies were used as controls. Sections were counterstained with DAPI and mounted with aqueous mounting medium (Sigma, St Louis, MO). Images were captured using an inverted microscope (Nikon Eclipse E1000M). For the evaluation of cell proliferation, p-Histone H3 positive cells were counted on three heart sections per group.

Statistics

Data were presented as means ± SE. Analysis of variance (ANOVA) with Tukey-test was used to identify significant differences when appropriate. A difference of P<0.05 was considered to be statistically significant.

Results

SOD1 overexpression blocks maternal diabetes-induced oxidative stress in the developing heart

Maternal diabetes produces ROS, results in oxidative stress, and induces lipid peroxidation and protein oxidization. In order to examine whether SOD1 overexpression could ameliorate maternal diabetes-induced oxidative stress in the embryonic heart, we tested the levels of two major lipid peroxidation markers, 4-hydroxynonenal (4-HNE) and malondialdehyde (MDA). We found that levels of these two markers were significantly higher in the embryonic heart from the diabetes mellitus wild-type (DM-WT) group when compared with other two groups (Fig. 1A, B). SOD1 overexpressing embryonic heart exposed to diabetes showed comparable levels of these two markers with WT embryonic hearts under nondiabetic condition (Fig. 1A, B). These results suggested that SOD1 overexpression significantly blocks maternal diabetes-induced oxidative stress in the developing heart.

Figure 1. SOD1 overexpression abolishes maternal diabetes-induced oxidative stress in the developing heart.

Figure 1

Open in a new tab

A, The western blotting image of 4-HNE in E12.5 embryonic hearts from ND-WT, DM-WT and DM-SOD1 groups. B, The western blotting image of MDA in E12.5 embryonic hearts from ND-WT, DM-WT and DM-SOD1 groups. Three hearts from embryos of three dams (n=3) per group were analyzed. * indicates significant difference compared to other groups. ND: nondiabetic; DM: diabetic mellitus; WT: wild-type; SOD1: SOD1 overexpressing.

SOD1 overexpression restores maternal diabetes-impaired TGFβ expression in the developing heart

To determine whether maternal diabetes affects the expression of TGFβs and whether oxidative stress participates in this process, levels of three TGFβ ligands (TGFβ1, β2, β3) were analyzed in E12.5 embryonic hearts from the ND-WT, DM-WT and DM-SOD1 groups. Both mRNA and protein analyses showed that TGFβ1 and TGFβ3 were significantly decreased in embryonic hearts from the DM-WT group, compared with those from the ND-WT group, while TGFβ2 showed no significant change among these two groups (Fig. 2A, B). We further found that blocking oxidative stress by SOD1 overexpression could restore the expression levels of TGFβ1 and TGFβ3 suppressed by maternal diabetes (Fig. 2A, B), indicating that the downregulation of TGFβs can be reversed by SOD1 overexpression.

Figure 2. SOD1 overexpression restores maternal diabetes-suppressed TGFβs expression.

Figure 2

Open in a new tab

A, mRNA levels of TGFβ1, β2 and β3 in WT and SOD1 overexpressing heart from ND and DM dams. B, protein level of TGFβ in E12.5 embryonic hearts from ND-WT, DM-WT and DM-SOD1 groups. Three hearts from embryos of three dams (n=3) per group were analyzed. * indicates significant difference compared to other groups. ND: nondiabetic; DM: diabetic mellitus; WT: wild-type; SOD1: SOD1 overexpressing.

SOD1 overexpression ameliorates maternal diabetes-impaired downstream TGFβ signaling intermediates in the developing heart

We next investigated whether maternal diabetes and oxidative stress could also affect the levels of TGFβ signaling cascades in the embryonic heart. We tested the protein levels of TβRII, Smad2 and Smad3 phosphorylation in the E12.5 embryonic hearts. The levels of p-TβRII, p-Smad2 and p-Smad3 were all significantly decreased in the DM-WT group and restored in the DM-SOD1 group (Fig. 3A, B, C). The immunostaining signals of p-Smad2 and p-Smad3 in the E12.5 embryonic hearts from the DM-WT group were lower than those from the ND-WT and DM-SOD1 groups (Fig. 3D).

Figure 3. SOD1 overexpression rescues TGFβ signaling downstream effectors suppressed by maternal diabetes.

Figure 3

Open in a new tab

A, protein level of p-TβRII, B, protein level of p-Smad2, C, protein level of p-Smad3 in E12.5 embryonic hearts from ND-WT, DM-WT and DM-SOD1 groups. D, image of p-Smad2 and p-Smad3 immunostaining. Rabbit normal IgG served as controls. Red signals were p-Smad2 and p-Smad3 and cell nuclei were stined by DAPI (Blue). Three E12.5 hearts from embryos of three dams (n=3) per group, and three serial sections per heart were analyzed. Bars =150 μm. * indicates significant difference compared to other groups. ND: nondiabetic; DM: diabetic mellitus; WT: wild-type; SOD1: SOD1 overexpressing.

SOD1 overexpression reverses maternal diabetes-decreased TGFβ signaling responsive gene expression

We detected the expression level of three TGFβ responsive genes, snail homolog 2 (Snai2), connective tissue growth factor (CTGF) and growth differentiation factor 1 (GDF1). Maternal diabetes significantly decreased the expression of these three TGFβ responsive genes in the developing heart, and SOD1 overexpression restored their expression levels suppressed by maternal diabetes (Fig. 4).

Figure 4. SOD1 overexpression rescues maternal diabetes-reduced TGFβ target gene expression.

Figure 4

Open in a new tab

mRNA levels of TGFβ target genes Snai2, CTGF and GDF1. Three hearts from embryos of three dams (n=3) were analyzed. * indicates significant difference compared to other groups. ND: nondiabetic; DM: diabetic mellitus; WT: wild-type; SOD1: SOD1 overexpressing.

Tempol abolishes high glucose-impaired TGFβ signaling in ex vivo cultured embryonic hearts

Our results indicated that oxidative stress plays a key role in maternal diabetes-impaired TGFβ signaling in the developing heart. To further confirm this, we explanted E11.5 embryonic hearts and cultured them ex vivo in high glucose and tempol (superoxide dismutase mimetic) conditions to check the effect of tempol on high glucose-suppressed TGFβ signaling. p-Histone H3 staining showed similar cell proliferation levels between the low glucose cultured hearts (cultured for 3 days) and E12.5 WT embryonic hearts from ND dams, suggesting that culture medium can maintain explanted hearts very well for at least 3 days (Fig.5A). Similar to our in vivo observations that overexpressing SOD1 rescued TGFβ signaling, tempol treatment restored TGFβ, p-TβRII, p-Smad2, p-Smad3 (Fig. 5B) and three TGFβ responsive genes (Fig. 5C) that were decreased by high glucose, suggesting that high glucose-induced oxidative stress suppresses TGFβ signaling pathway.

Figure 5. Tempol treatment restores high glucose-suppressed TGFβ signaling in ex vivo cultured hearts.

Figure 5

Open in a new tab

A, immunostaing image of p-Histone H3 in ND-WT and LG-WT (WT hearts cultured in low glucose condition for 3 days). Red dots were p-Histone H3 positive cells, nuclei were stained with DAPI (Blue). Three serial sections per heart were analyzed. B, protein levels of TGFβ, p-TβRII, p-Smad2, p-Smad3 in ex vivo cultured hearts from 5 mM glucose, 25 mM glucose, 25 mM glucose plus tempol groups. C, mRNA levels of Snai2, CTGF and GDF1 in 5 mM glucose, 25 mM glucose, 25 mM glucose plus tempol groups. Three hearts per group (n=3) were analyzed. * indicates significant difference compared to other groups.

TGFβ recombinant protein restores high glucose-suppressed TGFβ signaling

The TGFβ signaling pathway is involved in a wide range of cellular process including cell growth, cell differentiation and apoptosis, and uses a variety of regulatory mechanisms. In order to determine whether maternal diabetes impaired TGFβ signaling due to TGFβ down-regulation, we used a TGFβ recombinant protein to treat ex vivo cultured hearts. TGFβ recombinant protein treatment successfully restored TGFβ, p-TβRII, p-Smad2, p-Smad3 and expression of the three TGFβ responsive genes which were suppressed by high glucose (Fig. 6A, B). These results further support our hypothesis that oxidative stress suppresses TGFβ signaling mainly through down-regulation of TGFβ expression.

Figure 6. TGFβ recombinant protein treatment rescues TGFβ signaling suppressed by high glucose ex vivo.

Figure 6

Open in a new tab

A, protein levels of TGFβ, p-TβRII, p-Smad2 and p-Smad3 in ex vivo cultured hearts from 5 mM glucose, 25 mM glucose, 25 mM glucose plus TGFβ recombinant protein groups. B, mRNA levels of Snai2, CTGF and GDF1 in 5 mM glucose, 25 mM glucose, 25 mM glucose plus TGFβ recombinant protein groups. Three hearts per group (n=3) were analyzed. * indicates significant difference compared to other groups.

Comment

Much experimental evidence supports the hypothesis that oxidative stress is involved in the etiology of several diabetic complications including diabetic embryopathy7-12, 14, 15, 33-36. Maternal diabetes causes oxidative stress in the developing embryos by, not only increasing ROS production, but also suppressing endogenous antioxidant activity7, 13, 37, 38. Diabetes-induced oxidative stress alters the expression of genes that are critical for embryonic neurogenesis and cardiogenesis, leading to NTDs and heart defects39.

Studies have demonstrated that dietary antioxidant supplements to the mother or antioxidant treatment to cultured embryos significantly reduce maternal diabetes- or high glucose in vitro-induced NTD formation13, 40-42. Our previous studies have demonstrated that SOD1 overexpression in SOD1-Tg mice drastically suppresses embryonic NTD formation in diabetic pregnancies7, 10. Here, we aim to determine whether SOD1 overexpressing by using SOD1-Tg mice could ameliorate maternal diabetes-induced heart defects.

Membrane lipids are one of the primary targets of ROS. 4-HNE and MDA are two major membrane lipid peroxidation products. We have previously demonstrated that SOD1 overexpression inhibits diabetes-increased 4-HNE and MDA expression in neurulation-stage embryos7. Consistently, we found that maternal diabetes-increased 4-HNE and MDA expression in the developing heart was abolished by SOD1 overexpression, indicating that SOD1 overexpression could relieve maternal diabetes-induced oxidative stress in the developing heart.

TGFβ signaling plays a key role in embryonic cardiogenesis43. TGFβ ligands (TGFβ1, 2 and 3) and the main TGFβ receptor proteins (TβRI and TβRII) are widely expressed in different compartments of the developing heart44. TGFβ1 is expressed in the endocardium from E845, whereas TGFβ2 ligand is expressed in the myocardium of the atrioventricular (AV) canal at E1046, 47. TGFβ3 is not expressed in the developing heart until E11, and is limited to epicardium and the mesenchymal cells in the cardiac cushions46, 47.

In this study, we used E12.5 embryonic hearts to examine and changes in expression of all three TGFβ ligands under hyperglycemic conditions. We found that the total level of TGFβ ligands, especially TGFβ1 and TGFβ3, were reduced by maternal diabetes. This finding is consistent with what described by Zhao et al in E10.5 hearts17, but contradicts a previous in vitro study, which described a slight decrease in TGFβ1 expression in the mouse (E9.5) embryonic heart when exposed to high glucose for 24 hours2. This discrepancy may be explained by the different stages of hearts that were examined in the two studies.

Consistent with the down-regulation of TGFβ1 and TGFβ3, downstream effectors of the TGFβ signaling, p-TβRII, p-Smad2 and p-Smad3, were decreased in embryonic hearts under diabetic conditions. Our ex vivo experiments using TGFβ recombinant protein in cultured hearts provided direct evidence that decreased TGFβ is responsible for high glucose-induced p-TβRII, p-Smad2 and p-Smad3 downregulation.

ROS react with nitric oxide (NO) to produce reactive nitrogen species (RNS)48. Marta et al observed that RNS reduced the amount of phosphorylated Smad2/3 and their nuclear translocation, and inhibited the transcriptional activities of the TGFβ/Smad signaling49. Hyperglycemia induces diabetic embryopathy by enhancing the production of ROS and the generation of RNS50.

In the present study, we observed that maternal diabetes-impaired TGFβ signaling was restored in SOD1-overexpressing embryonic hearts. The contribution of RNS to maternal diabetes-impaired TGFβ signaling was not assessed. Further studies using knockout mice of iNos, which enhances NO production and the consequent formation of RNS in diabetic embryopathy, may determine the contribution of RNS to TGFβ signaling impairment.

Our ex vivo experiment treating with tempol on cultured hearts further demonstrated that oxidative stress is fully responsible for decreased TGFβ signaling by high glucose. SOD1 overexpression or tempol treatment restored the expression of three TGFβ target genes, Snai2, CTGF and GDF1. Snai2 is critical for endothelial-to-mesenchymal transition (EMT) in cardiac cushion morphogenesis51. CTGF (connective tissue growth factor), a member of CCN family of extracellular matrix-associated heparin-binding proteins, has an essential role in cell adhesion, migration, proliferation and angiogenesis52, 53. Aberrant CTGF expression is associated with diabetic nephropathy54, retinopathy55 and cardiovascular diseases56. GDF1 is a key regulator in the establishment and maintenance of Left-Right (L-R) signals governing asymmetric organogenesis, including the heart and the great vessels57. The absence of GDF1 in the mouse is associated with disturbances in L-R patterning57. Thus, alterations of these three TGFβ responsive genes may be mechanistically important for diabetes-induced embryonic heart defects.

In summary, our study demonstrated that hyperglycemia suppresses the TGFβ signaling pathway in the embryonic heart by inhibiting TGFβ ligand expression (Fig. 7). We also showed that oxidative stress is responsible for impairment of the TGFβ signaling pathway (Fig. 7). TGFβ signaling impairment is directly linked to the down-regulation of Snai2, CTGF and GDF1 expression, which may mediate the teratogenicity of maternal diabetes in the developing heart (Fig. 7). SOD1 overexpression in vivo or treatment with the SOD1 mimetic tempol ex vivo rescued TGFβ signaling and its responsive genes expression. Our findings provide a mechanistic basis for the development of antioxidant and TGFβ signaling agonists against maternal diabetes-induced embryonic heart defects.

Figure 7. Schematic of maternal diabetes-induced oxidative stress impaires TGFβ signaling in the developing heart leading to heart malformations.

Figure 7

Open in a new tab

Oxidative stress induced by maternal diabetes suppresses TGFβ1 and β3 expression, which further inhibits the phosphorylation level of p-TβRII, p-Smad2 and p-Smad3. Phosphorylated-Smad2/3 will be translocated into the nucleus as transcription factor with the help of Smad4. Downregulation of p-Smad2 and p-Smad3 by oxidative stress suppresses their function as transcription factors, which results in reduced expression of TGFβ target genes, such as Snai2, CTGF and GDF1, and probably malformed heart development. +p: phosphorylation; ⇓: downregulation; dash arrow line: possible mechanism.

Pregestational diabetes mellitus is a significant risk factor for heart defects through modified maternal metabolism4, 58. In human studies, congenital heart defects occur in 5% of diabetic pregnancies58. Increasing maternal body mass index and obesity also are associated with an increasing risk of CHDs, and severe obesity is an even greater risk factor for the development of CHDs59, 60. There is increased mortality and morbidity in babies born with one or multiple heart defects, and these babies need urgent surgical care and life-long health support. The best way to cure cardiac issues in later life is to prevent heart defect formation in embryonic life.

Excessive oxidative stress is a key mechanism underlying the formation of structural birth defects such as neural tube defects (NTDs) and heart defects60. Studies have shown that mutations in SOD1 and SOD2, that potentially affect the expression of these two antioxidant enzymes, are observed in patients with myelomeningocele, a type of NTDs61. Oxidative stress markers in maternal circulation may be utilized for early diagnosis of fetal adverse outcomes62-64. Examining oxidative stress markers such as 8- hydroxydeoxyguanosine and 8-isoprostane in maternal urine samples has also been used for early detection of adverse pregnancy outcomes65. Because oxidative stress impacts an array of signaling pathways including the TGFβ signaling pathway in the present study, other metabolites in the maternal circulation could be valuable indicators of defective fetuses. Currently available interventions to prevent birth defects are limited. Folic acid intake attenuates maternal diabetes- or obesity-induced NTD formation66. In contrast, another study demonstrated that the periconceptional use of vitamins or supplements that contain folic acid failed to prevent congenital heart defects caused by preexisting maternal diabetes mellitus67, 68. Mechanistic studies including our current study provide important insights into developing new interventions against diabetes-, obesity- or other stress conditions-induced birth defects.

Animal studies have demonstrated that dietary supplements that contain folic acid, vitamin E or polyunsaturated fatty acids ameliorate the incidence of birth defects in diabetic pregnancies40, 41, 67. However, even with folic acid supplements, women with pre-existing diabetes still produce a higher incidence of offspring with CHDs68. Developing safe and effective therapeutic interventions to prevent maternal diabetes-induced CHDs is an urgent need. However, more work needs to be conducted in animal studies before we can begin clinical trials of prospect therapeutic candidates.

Condensation.

Maternal diabetes-induced oxidative stress mediates the inhibitory effect of hyperglycemia on TGFβ signaling in the developing heart.

Acknowledgments

This study is supported by NIH R01DK083243, R01DK101972 (P. Y) and R01DK103024 (to P. Y and E. A. R), and an American Diabetes Association Basic Science Award (1-13-BS-220). The authors are grateful to Dr. Julie Wu at the University of Maryland School of Medicine Offices of the Dean and Public Affairs, for critical reading and editing.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Disclosure: None of the authors have a conflict of interest.

REFERENCES

  • 1.Aberg A, Westbom L, Kallen B. Congenital malformations among infants whose mothers had gestational diabetes or preexisting diabetes. Early human development. 2001;61:85–95. doi: 10.1016/s0378-3782(00)00125-0. [DOI] [PubMed] [Google Scholar]
  • 2.Smoak IW. Hyperglycemia-induced TGFbeta and fibronectin expression in embryonic mouse heart. Developmental dynamics : an official publication of the American Association of Anatomists. 2004;231:179–89. doi: 10.1002/dvdy.20123. [DOI] [PubMed] [Google Scholar]
  • 3.Lawrence JM, Contreras R, Chen W, Sacks DA. Trends in the prevalence of preexisting diabetes and gestational diabetes mellitus among a racially/ethnically diverse population of pregnant women, 1999-2005. Diabetes care. 2008;31:899–904. doi: 10.2337/dc07-2345. [DOI] [PubMed] [Google Scholar]
  • 4.Correa A, Gilboa SM, Besser LM, et al. Diabetes mellitus and birth defects. American journal of obstetrics and gynecology. 2008;199:237, e1–9. doi: 10.1016/j.ajog.2008.06.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Xue L, Yi H, Huang Z, Shi YB, Li WX. Global gene expression during the human organogenesis: from transcription profiles to function predictions. International journal of biological sciences. 2011;7:1068–76. doi: 10.7150/ijbs.7.1068. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Savolainen SM, Foley JF, Elmore SA. Histology atlas of the developing mouse heart with emphasis on E11.5 to E18.5. Toxicologic pathology. 2009;37:395–414. doi: 10.1177/0192623309335060. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Li X, Weng H, Reece EA, Yang P. SODI overexpression in vivo blocks hyperglycemia-induced specific PKC isoforms: substrate activation and consequent lipid peroxidation in diabetic embryopathy. American journal of obstetrics and gynecology. 2011;205:84, e1–6. doi: 10.1016/j.ajog.2011.02.071. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Li X, Weng H, Xu C, Reece EA, Yang P. Oxidative stress-induced JNK1/2 activation triggers proapoptotic signaling and apoptosis that leads to diabetic embryopathy. Diabetes. 2012;61:2084–92. doi: 10.2337/db11-1624. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Li X, Xu C, Yang P. c-Jun NH2-terminal kinase 1/2 and endoplasmic reticulum stress as interdependent and reciprocal causation in diabetic embryopathy. Diabetes. 2013;62:599–608. doi: 10.2337/db12-0026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Wang F, Reece EA, Yang P. Superoxide dismutase 1 overexpression in mice abolishes maternal diabetes-induced endoplasmic reticulum stress in diabetic embryopathy. American journal of obstetrics and gynecology. 2013;209:345, e1–7. doi: 10.1016/j.ajog.2013.06.037. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Wang F, Wu Y, Gu H, et al. Ask1 gene deletion blocks maternal diabetes- induced endoplasmic reticulum stress in the developing embryo by disrupting the unfolded protein response signalosome. Diabetes. 2014 doi: 10.2337/db14-0409. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Xu C, Li X, Wang F, Weng H, Yang P. Trehalose prevents neural tube defects by correcting maternal diabetes-suppressed autophagy and neurogenesis. American journal of physiology Endocrinology and metabolism. 2013;305:E667–78. doi: 10.1152/ajpendo.00185.2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Yang P, Li H. Epigallocatechin-3-gallate ameliorates hyperglycemia-induced embryonic vasculopathy and malformation by inhibition of Foxo3a activation. American journal of obstetrics and gynecology. 2010;203:75, e1–6. doi: 10.1016/j.ajog.2010.02.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Yang P, Li X, Xu C, et al. Maternal hyperglycemia activates an ASK1-FoxO3a caspase 8 pathway that leads to embryonic neural tube defects. Science signaling. 2013;6:ra74. doi: 10.1126/scisignal.2004020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Yang P, Zhao Z, Reece EA. Involvement of c-Jun N-terminal kinases activation in diabetic embryopathy. Biochemical and biophysical research communications. 2007;357:749–54. doi: 10.1016/j.bbrc.2007.04.023. [DOI] [PubMed] [Google Scholar]
  • 16.Armstrong EJ, Bischoff J. Heart valve development: endothelial cell signaling and differentiation. Circulation research. 2004;95:459–70. doi: 10.1161/01.RES.0000141146.95728.da. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Zhao Z. Cardiac malformations and alteration of TGFbeta signaling system in diabetic embryopathy. Birth defects research Part B, Developmental and reproductive toxicology. 2010;89:97–105. doi: 10.1002/bdrb.20225. [DOI] [PubMed] [Google Scholar]
  • 18.Topouzis S, Majesky MW. Smooth Muscle Lineage Diversity in the Chick Embryo. Developmental biology. 1996;178:430–45. [PubMed] [Google Scholar]
  • 19.Sanford LP, Ormsby I, Gittenberger-De Groot AC, et al. TGFbeta2 knockout mice have multiple developmental defects that are non-overlapping with other TGFbeta knockout phenotypes. Development. 1997;124:2659–70. doi: 10.1242/dev.124.13.2659. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Compton LA, Potash DA, Brown CB, Barnett JV. Coronary vessel development is dependent on the type III transforming growth factor beta receptor. Circulation research. 2007;101:784–91. doi: 10.1161/CIRCRESAHA.107.152082. [DOI] [PubMed] [Google Scholar]
  • 21.Giacco F, Brownlee M. Oxidative stress and diabetic complications. Circulation research. 2010;107:1058–70. doi: 10.1161/CIRCRESAHA.110.223545. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Al Ghafli MH, Padmanabhan R, Kataya HH, Berg B. Effects of alpha-lipoic acid supplementation on maternal diabetes-induced growth retardation and congenital anomalies in rat fetuses. Molecular and cellular biochemistry. 2004;261:123–35. doi: 10.1023/b:mcbi.0000028747.92084.42. [DOI] [PubMed] [Google Scholar]
  • 23.Badr G, Mahmoud MH, Farhat K, Waly H, Al-Abdin OZ, Rabah DM. Maternal supplementation of diabetic mice with thymoquinone protects their offspring from abnormal obesity and diabetes by modulating their lipid profile and free radical production and restoring lymphocyte proliferation via PI3K/AKT signaling. Lipids in health and disease. 2013;12:37. doi: 10.1186/1476-511X-12-37. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Persson B. Prevention of fetal malformation with antioxidants in diabetic pregnancy. Pediatric research. 2001;49:742–3. doi: 10.1203/00006450-200106000-00004. [DOI] [PubMed] [Google Scholar]
  • 25.Sen S, Simmons RA. Maternal antioxidant supplementation prevents adiposity in the offspring of Western diet-fed rats. Diabetes. 2010;59:3058–65. doi: 10.2337/db10-0301. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Hagay ZJ, Weiss Y, Zusman I, et al. Prevention of diabetes-associated embryopathy by overexpression of the free radical scavenger copper zinc superoxide dismutase in transgenic mouse embryos. American journal of obstetrics and gynecology. 1995;173:1036–41. doi: 10.1016/0002-9378(95)91323-8. [DOI] [PubMed] [Google Scholar]
  • 27.Weng H, Li X, Reece EA, Yang P. SOD1 suppresses maternal hyperglycemia- increased iNOS expression and consequent nitrosative stress in diabetic embryopathy. American journal of obstetrics and gynecology. 2012;206:448, e1–7. doi: 10.1016/j.ajog.2012.02.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Li H, Sekine M, Seng S, Avraham S, Avraham HK. BRCA1 interacts with Smad3 and regulates Smad3-mediated TGF-beta signaling during oxidative stress responses. PloS one. 2009;4:e7091. doi: 10.1371/journal.pone.0007091. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Liu RM, Gaston Pravia KA. Oxidative stress and glutathione in TGF-beta-mediated fibrogenesis. Free radical biology & medicine. 2010;48:1–15. doi: 10.1016/j.freeradbiomed.2009.09.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Zhao W, Zhao T, Chen Y, Ahokas RA, Sun Y. Oxidative stress mediates cardiac fibrosis by enhancing transforming growth factor-beta1 in hypertensive rats. Molecular and cellular biochemistry. 2008;317:43–50. doi: 10.1007/s11010-008-9803-8. [DOI] [PubMed] [Google Scholar]
  • 31.Hashimoto H, Yuasa S, Tabata H, et al. Time-lapse imaging of cell cycle dynamics during development in living cardiomyocyte. Journal of molecular and cellular cardiology. 2014;72:241–9. doi: 10.1016/j.yjmcc.2014.03.020. [DOI] [PubMed] [Google Scholar]
  • 32.Yang P, Reece EA. Role of HIF-1alpha in maternal hyperglycemia-induced embryonic vasculopathy. American journal of obstetrics and gynecology. 2011;204:332, e1–7. doi: 10.1016/j.ajog.2011.01.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Chang TI, Horal M, Jain SK, Wang F, Patel R, Loeken MR. Oxidant regulation of gene expression and neural tube development: Insights gained from diabetic pregnancy on molecular causes of neural tube defects. Diabetologia. 2003;46:538–45. doi: 10.1007/s00125-003-1063-2. [DOI] [PubMed] [Google Scholar]
  • 34.Kowluru RA, Kennedy A. Therapeutic potential of anti-oxidants and diabetic retinopathy. Expert opinion on investigational drugs. 2001;10:1665–76. doi: 10.1517/13543784.10.9.1665. [DOI] [PubMed] [Google Scholar]
  • 35.McDonagh PF, Hokama JY. Microvascular perfusion and transport in the diabetic heart. Microcirculation. 2000;7:163–81. [PubMed] [Google Scholar]
  • 36.Vinik AI, Park TS, Stansberry KB, Pittenger GL. Diabetic neuropathies. Diabetologia. 2000;43:957–73. doi: 10.1007/s001250051477. [DOI] [PubMed] [Google Scholar]
  • 37.Yang P, Cao Y, Li H. Hyperglycemia induces inducible nitric oxide synthase gene expression and consequent nitrosative stress via c-Jun N-terminal kinase activation. American journal of obstetrics and gynecology. 2010;203:185, e5–11. doi: 10.1016/j.ajog.2010.05.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Yang P, Zhao Z, Reece EA. Blockade of c-Jun N-terminal kinase activation abrogates hyperglycemia-induced yolk sac vasculopathy in vitro. American journal of obstetrics and gynecology. 2008;198:321, e1–7. doi: 10.1016/j.ajog.2007.09.010. [DOI] [PubMed] [Google Scholar]
  • 39.King GL, Loeken MR. Hyperglycemia-induced oxidative stress in diabetic complications. Histochemistry and cell biology. 2004;122:333–8. doi: 10.1007/s00418-004-0678-9. [DOI] [PubMed] [Google Scholar]
  • 40.Reece EA, Wu YK. Prevention of diabetic embryopathy in offspring of diabetic rats with use of a cocktail of deficient substrates and an antioxidant. American journal of obstetrics and gynecology. 1997;176:790–7. doi: 10.1016/s0002-9378(97)70602-1. discussion 97-8. [DOI] [PubMed] [Google Scholar]
  • 41.Reece EA, Wu YK, Wiznitzer A, et al. Dietary polyunsaturated fatty acid prevents malformations in offspring of diabetic rats. American journal of obstetrics and gynecology. 1996;175:818–23. doi: 10.1016/s0002-9378(96)80005-6. [DOI] [PubMed] [Google Scholar]
  • 42.Reece EA, Wu YK, Zhao Z, Dhanasekaran D. Dietary vitamin and lipid therapy rescues aberrant signaling and apoptosis and prevents hyperglycemia-induced diabetic embryopathy in rats. American journal of obstetrics and gynecology. 2006;194:580–5. doi: 10.1016/j.ajog.2005.08.052. [DOI] [PubMed] [Google Scholar]
  • 43.Pardali E, Ten Dijke P. TGFbeta signaling and cardiovascular diseases. International journal of biological sciences. 2012;8:195–213. doi: 10.7150/ijbs.3805. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Furnsinn C, Sanderson AL, Radda GK, Leighton B. Effects of glucosamine on insulin-stimulated glucose metabolism in rat soleus muscle. The international journal of biochemistry & cell biology. 1995;27:805–14. doi: 10.1016/1357-2725(95)00048-t. [DOI] [PubMed] [Google Scholar]
  • 45.Akhurst RJ, Lehnert SA, Faissner A, Duffie E. TGF beta in murine morphogenetic processes: the early embryo and cardiogenesis. Development. 1990;108:645–56. doi: 10.1242/dev.108.4.645. [DOI] [PubMed] [Google Scholar]
  • 46.Camenisch TD, Molin DG, Person A, et al. Temporal and distinct TGFbeta ligand requirements during mouse and avian endocardial cushion morphogenesis. Developmental biology. 2002;248:170–81. doi: 10.1006/dbio.2002.0731. [DOI] [PubMed] [Google Scholar]
  • 47.Molin DG, Bartram U, Van der Heiden K, et al. Expression patterns of Tgfbeta1-3 associate with myocardialisation of the outflow tract and the development of the epicardium and the fibrous heart skeleton. Developmental dynamics : an official publication of the American Association of Anatomists. 2003;227:431–44. doi: 10.1002/dvdy.10314. [DOI] [PubMed] [Google Scholar]
  • 48.Lubos E, Handy DE, Loscalzo J. Role of oxidative stress and nitric oxide in atherothrombosis. Frontiers in bioscience : a journal and virtual library. 2008;13:5323–44. doi: 10.2741/3084. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Saura M, Zaragoza C, Herranz B, et al. Nitric oxide regulates transforming growth factor-beta signaling in endothelial cells. Circulation research. 2005;97:1115–23. doi: 10.1161/01.RES.0000191538.76771.66. [DOI] [PubMed] [Google Scholar]
  • 50.Sugimura Y, Murase T, Oyama K, et al. Prevention of neural tube defects by loss of function of inducible nitric oxide synthase in fetuses of a mouse model of streptozotocin-induced diabetes. Diabetologia. 2009;52:962–71. doi: 10.1007/s00125-009-1312-0. [DOI] [PubMed] [Google Scholar]
  • 51.Niessen K, Fu Y, Chang L, Hoodless PA, McFadden D, Karsan A. Slug is a direct Notch target required for initiation of cardiac cushion cellularization. The Journal of cell biology. 2008;182:315–25. doi: 10.1083/jcb.200710067. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Hall-Glenn F, Lyons KM. Roles for CCN2 in normal physiological processes. Cellular and molecular life sciences : CMLS. 2011;68:3209–17. doi: 10.1007/s00018-011-0782-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Jun JI, Lau LF. Taking aim at the extracellular matrix: CCN proteins as emerging therapeutic targets. Nature reviews Drug discovery. 2011;10:945–63. doi: 10.1038/nrd3599. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Ellina O, Chatzigeorgiou A, Kouyanou S, et al. Extracellular matrix-associated (GAGs, CTGF), angiogenic (VEGF) and inflammatory factors (MCP-1, CD40, IFN-gamma) in type 1 diabetes mellitus nephropathy. Clinical chemistry and laboratory medicine : CCLM / FESCC. 2012;50:167–74. doi: 10.1515/cclm.2011.881. [DOI] [PubMed] [Google Scholar]
  • 55.Zhang B, Zhou KK, Ma JX. Inhibition of connective tissue growth factor overexpression in diabetic retinopathy by SERPINA3K via blocking the WNT/beta-catenin pathway. Diabetes. 2010;59:1809–16. doi: 10.2337/db09-1056. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Cozzolino M, Biondi ML, Banfi E, et al. CCN2 (CTGF) gene polymorphism is a novel prognostic risk factor for cardiovascular outcomes in hemodialysis patients. Blood purification. 2010;30:272–6. doi: 10.1159/000320706. [DOI] [PubMed] [Google Scholar]
  • 57.Karkera JD, Lee JS, Roessler E, et al. Loss-of-function mutations in growth differentiation factor-1 (GDF1) are associated with congenital heart defects in humans. American journal of human genetics. 2007;81:987–94. doi: 10.1086/522890. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Narchi H, Kulaylat N. Heart disease in infants of diabetic mothers. Images in paediatric cardiology. 2000;2:17–23. [PMC free article] [PubMed] [Google Scholar]
  • 59.Cai GJ, Sun XX, Zhang L, Hong Q. Association between maternal body mass index and congenital heart defects in offspring: a systematic review. American journal of obstetrics and gynecology. 2014;211:91–117. doi: 10.1016/j.ajog.2014.03.028. [DOI] [PubMed] [Google Scholar]
  • 60.Gilboa SM, Correa A, Botto LD, et al. Association between prepregnancy body mass index and congenital heart defects. American journal of obstetrics and gynecology. 2010;202:51, e1–51, e10. doi: 10.1016/j.ajog.2009.08.005. [DOI] [PubMed] [Google Scholar]
  • 61.Kase BA, Northrup H, Au KS. Novel single nucleotide polymorphisms in the superoxide dismutase 1 and 2 genes among children with myelomeningocele. American journal of obstetrics and gynecology. 2013;209:388, e1–7. doi: 10.1016/j.ajog.2013.06.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Bahado-Singh RO, Akolekar R, Mandal R, et al. Metabolomic analysis for first-trimester Down syndrome prediction. American journal of obstetrics and gynecology. 2013;208:371, e1–8. doi: 10.1016/j.ajog.2012.12.035. [DOI] [PubMed] [Google Scholar]
  • 63.Bahado-Singh RO, Akolekar R, Chelliah A, et al. Metabolomic analysis for first-trimester trisomy 18 detection. American journal of obstetrics and gynecology. 2013;209:65, e1–9. doi: 10.1016/j.ajog.2013.03.028. [DOI] [PubMed] [Google Scholar]
  • 64.Bahado-Singh RO, Ertl R, Mandal R, et al. Metabolomic prediction of fetal congenital heart defect in the first trimester. American journal of obstetrics and gynecology. 2014;211:240, e1–40, e14. doi: 10.1016/j.ajog.2014.03.056. [DOI] [PubMed] [Google Scholar]
  • 65.Ferguson KK, McElrath TF, Chen YH, Loch-Caruso R, Mukherjee B, Meeker JD. Repeated measures of urinary oxidative stress biomarkers during pregnancy and preterm birth. American journal of obstetrics and gynecology. 2014 doi: 10.1016/j.ajog.2014.08.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Parker SE, Yazdy MM, Tinker SC, Mitchell AA, Werler MM. The impact of folic acid intake on the association among diabetes mellitus, obesity, and spina bifida. American journal of obstetrics and gynecology. 2013;209:239, e1–8. doi: 10.1016/j.ajog.2013.05.047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Correa A, Gilboa SM, Botto LD, et al. Lack of periconceptional vitamins or supplements that contain folic acid and diabetes mellitus-associated birth defects. American journal of obstetrics and gynecology. 2012;206:218, e1–13. doi: 10.1016/j.ajog.2011.12.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Oakley GP., Jr Failing to prevent birth defects caused by maternal diabetes mellitus. American journal of obstetrics and gynecology. 2012;206:179–80. doi: 10.1016/j.ajog.2011.12.019. [DOI] [PubMed] [Google Scholar]

RESOURCES