Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2016 May 1.
Published in final edited form as: Mol Cancer Res. 2015 Jan 30;13(5):923–933. doi: 10.1158/1541-7786.MCR-14-0536

mTOR/MYC Axis Regulates O-GlcNAc Transferase (OGT) Expression and O-GlcNAcylation in Breast Cancer

Valerie L Sodi 1, Sakina Khaku 1, Raisa Krutilina 2, Luciana P Schwab 2, David J Vocadlo 3, Tiffany N Seagroves 2, Mauricio J Reginato 1,4
PMCID: PMC4433402  NIHMSID: NIHMS660778  PMID: 25636967

Abstract

Cancers exhibit altered metabolism characterized by increased glucose and glutamine uptake. The hexosamine biosynthetic pathway (HBP) utilizes glucose and glutamine, and directly contributes to O-linked-β-N-acetylglucosamine (O-GlcNAc) modifications on intracellular proteins. Multiple tumor types contain elevated total O-GlcNAcylation, in part, by increasing O-GlcNAc transferase (OGT) levels, the enzyme that catalyzes this modification. Although cancer cells require OGT for oncogenesis, it is not clear how tumor cells regulate OGT expression and O-GlcNAcylation. Here, it is shown that the PI3K/mTOR/MYC signaling pathway is required for elevation of OGT and O-GlcNAcylation in breast cancer cells. Treatment with PI3K and mTOR inhibitors reduced OGT protein expression and decreased levels of overall O-GlcNAcylation. In addition, both AKT and mTOR activation is sufficient to elevate OGT/O-GlcNAcylation. Downstream of mTOR, the oncogenic transcription factor c-MYC is required and sufficient for increased OGT protein expression in an RNA-independent manner and c-MYC regulation of OGT mechanistically requires the expression of c-MYC transcriptional target HSP90A. Lastly, mammary tumor epithelial cells derived from MMTV-c-myc transgenic mice contain elevated OGT and O-GlcNAcylation and OGT inhibition in this model induces apoptosis. Thus, OGT and O-GlcNAcylation levels are elevated via activation of an mTOR/MYC cascade.

Keywords: O-GlcNAc, OGT, metabolism, mTOR, c-Myc, HSP90, breast cancer

Introduction

Cancer cells alter cellular metabolic pathways in order to support the energetic demands of increased biomass and replication (1). Otto Warburg first noted cancer cells rapid conversion of glucose to lactate, even in the presence of sufficient oxygen concentrations, now termed the “Warburg Effect” (2). This term encompasses altered utilization of glucose required to supply necessary building blocks for sustained proliferation. Oncogenic drivers alter gene expression that sustain changes in metabolic pathways, including genes involved in intermediate steps regulating metabolism (3).

Although the majority of glucose taken up by the cell is metabolized through the glycolytic pathway, 3–5% is diverted into the hexosamine biosynthetic pathway (HBP) (4), where it is converted to glucosamine-6-phosphate (GlucN-6-P) by the rate limiting enzyme glutamine:fructose-6-phosphate amidotransferase (GFAT) (5). Subsequently, GlucN-6-P is converted to uridine-5-diphosphate-N-acetylglucosamine (UDP-GlcNAc), which then serves as a substrate for N-linked glycosylation of proteins in the ER and Golgi as well as O-linked glycosylation of nuclear and cytoplasmic proteins (6). The enzyme O-GlcNAc transferase (OGT) uses UDP-GlcNAc as a substrate to add O-linked sugar moieties onto serine and threonine residues of a diverse range of nuclear and cytoplasmic proteins (7). The process of O-GlcNAc cycling is highly dynamic, and the addition and removal of O-GlcNAc is performed solely by the two enzymes OGT and O-GlcNAcase (OGA), respectively. The addition of this unique O-linked sugar is an important post-translational modification with the ability to influence many biological processes by altering protein stability, interaction capabilities and phosphorylation status (8). The role of O-GlcNAc extends to diverse cellular processes, as it is known to modify a wide range of proteins including transcription factors, signaling proteins and receptors (9). O-GlcNAcylation plays an important role in normal biology and is deregulated in a wide range of pathologies including cardiovascular and neurodegenerative diseases as well as metabolic syndromes such as diabetes (10).

Critical regulators of oncogenesis, including the c-Myc oncogene (11), the tumor suppressor p53 (12), and viral oncoprotein SV40 large T antigen (13), have been previously shown to be O-GlcNAcylated lending the idea that O-GlcNAcylation may play a key role in the pathogenesis of tumors (14) (15). Based on this earlier work, as well as more recent data showing the critical role of O-GlcNAcylation on NF-κB (16) function, our lab provided the first evidence that total O-GlcNAcylation and OGT was elevated in cancer cells and that OGT was required for tumor growth in vitro and in vivo (17). A number of groups have subsequently shown that OGT and O-GlcNAcylation levels are elevated in various different epithelial cancers including breast (18) (19), prostate (20) (21), lung (22), colon (23), liver (24), bladder (25) as well as in chronic lymphatic leukemia (CLL) (26). A critical role for O-GlcNAcylation in cancer metabolism has emerged as it has been shown to regulate a major glycolytic driver, hypoxia-inducible factor (HIF-1α), along with its transcriptional target glucose transporter 1 (GLUT1). This mechanism is critical for breast cancer cell survival both in vitro and in vivo (27). O-GlcNAcylation has also recently been shown to influence the Pentose Phosphate Pathway through regulation of Phosphofructokinase 1 activity (22). In some cancers, increased total O-GlcNAcylation may be due to increased OGT levels and/or decreased OGA levels as seen in breast (27,28), liver (24) and colon (29) cancers. While it has become evident that OGT and O-GlcNAc play critical roles in cancer metabolism and survival, it remains unclear how OGT and O-GlcNAcylation levels are elevated in cancer cells.

The phosphoinositol 3-kinase (PI3K)/AKT pathway directly contributes to altered metabolism of cancer cells by inducing cells to take up excess glucose via regulation of glucose transporters (30) (3) and via activation of the mammalian target of rapamycin (mTOR) signaling pathway (31). The mTOR pathway senses the energy status of a cell in response to a number of environmental cues and in turn alters cell growth and metabolism. Once induced, mTOR increases cell growth and proliferation through activation of two effector molecules p70S6K and 4EBP1 leading to a global increase in protein translation (31). One key transcription factor regulated by mTORC1 signaling is c-MYC (32). The oncogene c-MYC is involved in the regulation of cell cycle progression, cell growth, and glycolysis (33) and is commonly amplified in breast cancer. Moreover, MYC overexpression is associated with highly aggressive clinical features correlating with poor patient outcome (34).

Here, we show that the master nutrient signaling PI3K/AKT/mTOR pathway is required for elevation of OGT and O-GlcNAcylation in breast cancer cells. We also demonstrate that hyperactivation of AKT or mTOR is sufficient to elevate OGT protein and O-GlcNAcylation levels. Downstream of mTOR activation, we observe that c-MYC is required and sufficient to drive OGT protein elevation and increase O-GlcNAcylation in cancer cells via c-MYC regulation of its transcriptional target HSP90A. Importantly, we show that Myc-driven cancer cells elevate OGT and O-GlcNAcylation and require OGT activity for cancer cell survival. Our data is the first to link mTOR/MYC activity to increased OGT/O-GlcNAcylation that contributes to the oncogenic phenotype seen in multiple cancers.

Materials and Methods

Cell lines

MCF-10A, SKBR-3, MDA-MB-231, SUM-159 and MCF-7 cells were acquired from ATCC (American Type Culture Collection, Manassas, VA, USA) and cultured following ATCC instructions. Wild type and TSC2−/− MEFS were a gift from Aristotelis Astreinidis, Drexel University College of Medicine. CommaD cells were a gift from Senthil Muthuswamy, University of Toronto. MCF-10A-ErbB2 (NeuT) (17), MCF-10A-AKT (Myr-AKT1) (35) and MCF-10A-MEK2 (MEK2-DD) (35) cells have been previously described. The pWZL-Blast-c-MYC plasmid (kindly provided by Michael Amatangelo, Drexel University) was used to make MCF-10A cells stably overexpressing c-MYC (MCF-10A-c-MYC). Cells were infected with retrovirus and selected as previously described (17).

Inhibitors and treatments

Cell were seeded at 5 × 106 were treated for 16 hours with either; 0.1% DMSO (Sigma, St. Louis, MO, USA), LY294002 30 μM (Promega WI, USA), Rapamycin 50 nM (Enzo Biochem NY, USA) or U0126 30 μM (Promega WI, USA). OGT inhibitor Ac-5SGlcNAc has been previously described (36) and HSP90 inhibitor 17-AAG (Selleck Biochem, Houston, TX, USA) was used at indicated concentrations. Lactacystin (Calibiochem, Billerica, MA, USA) was used at 10 μM in combination with indicated treatments (16 hrs).

Animals and Establishing MMTV-Myc cells

MMTV-c-Myc transgenic females were procured from the Mouse Models of Human Cancer Consortium (MMHCC; stock O1XG2) under protocols approved by the University of Tennessee Health Science Center. Mammary epithelial tumor cell (MTEC) lines were generated from late stage carcinomas, grown in DMEM/F12 + 2% FBS and then routinely passaged in culture using a 3:1 ratio of dispaseII/tryspin as previously described (37).

Western blot Analysis

Cells were collected in RIPA lysis buffer (150mM NaCl, 1% NP40, 0.5% DOC, 50mM Tris-HCl at pH 8, 0.1% SDS, 10% glycerol, 5mM EDTA, 20mM NaF and 1mM Na3VO4, 1 μg/ml each of pepstatin, leupeptin, and aprotinin, 200 μg/ml phenyl-methylsulfonyl-fluoride). Lysates were cleared by centrifugation at 14,000 x g for 20 minutes at 4 °C and analyzed by SDS-PAGE and autoradiography. Western blots were then analyzed with the following antibodies; anti-Actin, anti-c-MYC, anti-ERK2 (D-2), anti-O-GlcNAc (RL2), anti-Cyclin D1 (Santa Cruz Biotechnology, Santa Cruz, CA, USA), anti-phospho-Akt (Ser473), anti-phospho-Akt (T308), anti- P70 S6 Kinase, anti-Tuberin/TSC2, anti-AKT, anti-phospho-P70-S6 Kinase (T389) and anti-phospho-4EBP1 (T70), anti-4EBP1 (53H17), Cleaved Caspase 3 (D175), anti-BIM, anti-CHOP (L63F7), anti-phospho-eIF2α, anti-eIF2α (Cell Signaling, Danvers, MA, USA), anti-phospho-ERK (T185/Y187) (Invitrogen Corporation, Carlsbad, CA, USA), anti-OGT, anti-O-GlcNAc (CTD110.6) (Sigma, St Louis, MO, USA), anti-HSP90 alpha (Enzo Life Sciences, Farmingdale, NY, USA) and anti-MGEA5 (OGA) (Proteintech Group, Chicago, IL, USA). Densitometry was performed using Image J Software (National Institutes of Health, Bethesda, MA).

Quantitative RT-PCR (qRT-PCR)

Total RNA was isolated using RNeasy Mini kit (Qiagen) according to the manufacturer’s protocol for monolayer cell RNA extraction. Levels of OGT, HSP90 and cyclophilinA (PPIA) were determined using the Applied Biosystems 7500, with Brilliant II qRT-PCR Master Mix Kit (Stratagene) according to the manufacturer’s protocol. TaqMan gene expression assay primer probes for cyclophilin A (Hs99999904_m1), OGT (Hs00914634_g1), c-MYC (Hs00905030_m1) and HSP90AA1 (Hs00743767_sH) were purchased from Applied Biosystem (Foster City, CA). Expression levels were analyzed using Data Assist v2.0 (Life Technologies, Grand Island, NY, USA).

RNA interference

Stable cell lines were generated by infection with the lentiviral vector pLKO.1-puro carrying shRNA sequence: control-scrambled CCTAAGGTTAAGTCGCCCTCGCTCTAGCGAGGGCGACTTAACCTT (Addgene, Cambridge, MA, USA), c-Myc#1 CCGGCAGGAACTATGACCTCGACTACTCGAGTAGTCGAGGTCATAGTTCCTGTTTTTG, c-Myc#2 CCGGCAGGAACTATGACCTCGACTACTCGAGTAGTCGAGGTCATAGTTCCTGTTTTTG, HSP90 #1 CCGGGAAGGATGGTGACAAGAAGAACTCGAGTTCTTCTTGTCACCATCCTTCTTTTTG, HSP90#2 CCGGTATGGCATGACAACTACTTTACTCGAGTAAAGTAGTTGTCATGCCATATTTTG (Sigma Aldrich, St. Louis, MO, USA). Lentivirus was generated and cells were infected and selected as described previously (17).

Statistical analysis

All results shown as averages are presented as mean ± SE from three or more independent experiments. Unless otherwise noted, p values were calculated using Student’s two-tailed test: (*p < 0.05).

Results

O-GlcNAcylation and OGT levels require PI3K and mTOR activation in cancer cells

We have previously demonstrated that breast cancer cells contain elevated OGT and O-GlcNAcylation levels compared to normal mammary epithelial cells (17). In addition, stable overexpression of the active form of the receptor tyrosine kinase ErbB2/HER2 in non-transformed mammary epithelial MCF-10A cells resulted in elevated OGT and O-GlcNAc levels (Supplemental Figure 1) (17). Since ErbB2 activation stimulates numerous signaling cascades including PI3K/AKT, Ras/MEK/ERK and mTOR (34), we examined which signaling pathway was responsible for increased OGT and O-GlcNAc levels in breast cancer cells. We tested a panel of breast cancer cells that represent different breast cancer subtypes including: estrogen receptor positive (MCF-7 cells), ErbB2/HER2 positive (SKBR-3 cells), and triple negative/basal breast cancers (MDA-MB-231 and SUM-159 cells) (38). Cells were treated with vehicle control or pharmacological inhibitors against the PI3K, mTOR and MEK signaling pathways. Treatment of all breast cancer cells with PI3K (LY294002) and mTOR inhibitor (Rapamycin) reduced O-GlcNAc levels compared to control (Figure 1A–E) and decreased OGT levels (Figure 1E, Figure 1A–D). Treatment of breast cancer cells with PI3K inhibitor (LY294002) significantly reduced OGT levels in MDA-MB-231, SKBR-3, MCF-7 but not SUM-159 cells (Figure 1D–E). Inhibition of MEK (U0126) had negligible effects on OGT levels and O-GlcNAcylation (Figure 1A–E). These data suggest that the PI3K /mTOR pathway is a key regulator of OGT and O-GlcNAc levels in multiple breast cancer cell lines with different genetic origins. To determine if the PI3K/mTOR pathway regulates OGT at the level of RNA, quantitative real-time PCR (qRT-PCR) was performed. Treatment of breast cancer cells MDA-MB-231, MCF-7, SKBR-3 and SUM-159 (Supplemental Figure 2) with inhibitors of PI3K, mTOR or MEK pathways did not significantly inhibit OGT RNA levels suggesting that PI3K/mTOR-mediated regulation of OGT protein levels is RNA-independent. Interestingly, protein levels of OGA were not elevated in breast cancer cells treated with PI3K or mTOR inhibitors (Supplemental Figure 3) suggesting that the decrease in O-GlcNAcylation caused by inhibitors of PI3K/mTOR pathway is primarily a result of diminished OGT protein levels. Thus, OGT protein and global cellular O-GlcNAcylation levels are maintained in breast cancer cells via PI3K and mTOR activation independent of OGT mRNA regulation.

Figure 1. The PI3K and mTOR pathways regulate OGT and O-GlcNAc levels in cancer cells.

Figure 1

Open in a new tab

(A) MDA-MB-231 (B) SKBR-3 (C) MCF-7 and (D) SUM-159 cells were treated for 16 hours with 0.1% DMSO, 30 μM LY294002 (PI3K inhibitor), 50 nM Rapamycin (mTOR inhibitor) or 30 μM U0126 (MEK inhibitor). Protein lysates were collected for immunoblot analysis and probed with the indicated antibodies. (E) Levels of OGT and c-MYC protein were quantified between different treatments in indicted breast cancer cells and normalized to actin. Mean ± SE represents at least three independent experiments; *p < 0.05.

AKT or mTOR activation is sufficient to elevate OGT protein expression and O-GlcNAcylation

Since cancer cells require PI3K and mTOR activation to maintain OGT and O-GlcNAc levels, we examined whether these pathways were sufficient to increase OGT and O-GlcNAcylation levels. PI3K can activate many pathways including the kinase AKT (Protein Kinase B)(39). To determine whether AKT activation alone was sufficient to increase OGT and O-GlcNAc levels in epithelial cells, we stably overexpressed an active form of AKT1 (Myr-AKT1) in the normal mammary epithelial cell line MCF-10A. Cells stably expressing Myr-AKT contained increased phosphorylated AKT and activated mTOR pathway as measured by phosphorylation of p70 S6 kinase (S6K) (T389) as well as elevated OGT protein levels and increased overall protein O-GlcNAcylation compared to control cells (Figure 2A). Consistent with the MEK-inhibitor results, MCF-10A cells overexpressing a constitutively active form of MEK2 (MEK2-DD) did not alter OGT and protein O-GlcNAcylation levels (Supplemental Figure 4A). This result is notable since MCF-10A-MEK2-DD cells have a pronounced phenotype when cultured in a three-dimensional (3D) culture system (Supplemental Figure 4B) that allows bypass of growth suppression and anoikis resistance (40). Thus, OGT and O-GlcNAcylation levels are not elevated simply as a result of hyperproliferation but are specifically regulated by the PI3K/AKT pathway. We conclude that activation of the AKT pathway, but not MEK/ERK pathway, is sufficient to elevate OGT and O-GlcNAcylation levels in human breast epithelial cells.

Figure 2. AKT and mTOR activation are sufficient to elevate OGT and O-GlcNAc levels.

Figure 2

Open in a new tab

(A) Protein lysates were collected from MCF-10A Control (pBabe) or MCF-10A-MYR-AKT cells and analyzed using western blot analysis with indicated antibodies. (B) Top: Lysates from wildtype MEFs or TSC2 (−/−) null MEFs were collected for immunoblot analysis and probed with the indicated antibodies. Bottom: Levels of OGT protein were compared between wild type and TSC2 null MEFs and quantified graphically. Mean ± SE; *p < 0.05. (C) TSC2 −/−MEFs were treated for 16 hours with 0.1% DMSO or 50nM Rapamycin. Protein lysates were collected for immunoblot analysis and probed with the indicated antibodies.

To test whether mTOR activation is also sufficient to increase levels of OGT and O-GlcNAcylation, we examined OGT/O-GlcNAc levels in mouse embryo fibroblasts (MEFs) containing deletion of TSC2. TSC1 and TSC2 are components of a complex that negatively regulates mTORC1 nutrient signaling and inactivation of either TSC1 or TSC2 results in elevated mTOR activity, is associated with uncontrolled cell growth and division, and is linked to benign tumor growth (31). To determine if mTOR activation was sufficient to increase OGT and O-GlcNAc levels, wild-type and TSC2 deficient MEFs were analyzed. As expected, basal phosphorylation levels of mTOR targets p70 S6K (T389) and 4EBP1(T70) were elevated in the TSC2 null cells compared to wildtype MEFs (Figure 2B) verifying constitutive mTOR activation. Interestingly, TSC2 null cells showed elevated OGT and O-GlcNAc levels (Figure 2B) further implicating the mTOR pathway in the regulation of O-GlcNAc cycling. However, TSC2 null cells also displayed significantly lower OGA levels (Supplemental Figure 5) suggesting that increased O-GlcNAcylation in these cells may be due to both elevation of OGT and reduction of OGA. To determine if OGT and O-GlcNAc levels were directly controlled by deregulated mTOR activity in these cells, TSC2 null MEFs were treated with Rapamycin. Similar to the cancer cells, inhibition of mTOR in TSC2 null MEFs resulted in a decrease in OGT and O-GlcNAcylation (Figure 2C). These results reveal that, in addition to AKT, activation of mTOR is also sufficient to increase OGT protein levels and increase O-GlcNAcylation.

c-MYC regulates O-GlcNAcylation and OGT protein expression in cancer cells

Many pathways are altered by activation of mTOR (31). Since OGT is required for metabolic pathways in cancer cells (27), we hypothesized that pathways downstream of mTOR associated with metabolic regulation may be involved in OGT/O-GlcNAc regulation. Since c-MYC is a key metabolic transcription factor downstream from the mTOR pathway (32), we examined whether this transcription factor is involved in OGT and O-GlcNAc regulation in cancer cells. c-MYC is amplified in multiple cancers and plays a significant role in cancer cell proliferation, growth and apoptosis and has been strongly implicated in cancer metabolism (33). To verify that c-MYC expression is downstream of mTOR in breast cancer cells, we examined c-MYC levels in breast cancer cells after treatment with Rapamycin or LY294002. Inhibition of PI3K and mTOR, but not MEK, significantly reduced c-MYC expression in MDA-MB-231, SKBR-3, MCF-7 and SUM-159 breast cancer cells and correlated with reduced OGT protein levels in these cells (Figure 1A–E). To test whether c-MYC was required for OGT expression in breast cancer cells, we targeted c-MYC with two different lentiviral shRNA constructs and determined that decreasing MYC expression in MDA-MB-231 resulted in significantly reduced OGT levels and an overall reduction in O-GlcNAcylation compared to cell containing control shRNA (Figure 3A). Consistent with our data regarding OGT expression under conditions of inhibition of PI3K and mTOR, there was no significant difference in OGT mRNA in cells expressing c-MYC RNAi as compared to control cells (Supplemental Figure 6A). Thus, both PI3K/mTOR and c-MYC regulate OGT protein levels independently of mRNA. To determine if c-MYC expression is sufficient to regulate OGT expression, we overexpressed c-MYC in MCF-10A cells. Cells overexpressing c-MYC displayed increased expression of its transcriptional target cyclin D1 (Figure 3B) and significantly upregulated OGT protein levels and O-GlcNAcylation compared to control cells (Figure 3B). The increase in OGT protein levels in MYC-overexpressing MCF-10A cells was also independent of changes in OGT RNA levels (Supplemental Figure 6B). Thus, downstream from mTOR, c-MYC is required and sufficient to regulate OGT protein levels and O-GlcNAc cycling in an RNA-independent fashion.

Figure 3. OGT expression in breast cancer cells requires c-MYC.

Figure 3

Open in a new tab

(A) MDA-MB-231 cells stably expressing either control, MYC#1 or MYC#2 shRNA were lysed and immunoblotted with indicated antibodies. Expression of OGT and c-MYC is quantified below. (B) Protein lysates were collected from MCF-10A Control (pWZL) or MCF-10A-c-MYC and were analyzed using western blot analysis with indicated antibodies. Data are quantified (n=3). * p-value <0.05 (C) Cell lysates from control or c-Myc shRNA containing MDA-MB-231 treated with control (DMSO) or Lactacysin (10 μM) were collected and analyzed by immunoblotting. Quantification of OGT/Acin is quantified below OGT blot.

c-MYC regulation of HSP90A is required for OGT expression in cancer cells

Recent studies have shown that the chaperone HSP90A can bind OGT and regulate its proteasomal degradation in endothelial cells (41). Interestingly, HSP90A is a c-MYC transcriptional target and contributes to c-MYC-induced transformation (42), thus we examined the potential connection between c-MYC, HSP90A and proteasomal degradation of OGT in cancer cells. To test whether reducing c-MYC levels in cancer cells led to reduction of OGT protein via the proteasome, we treated MDA-MB-231 cells containing c-MYC RNAi with proteasome inhibitor lactacystin. Cells treated with lactacystin reversed MYC-RNAi induced reduction of OGT protein compared to control treated cells (Figure 3C). Consistent with the idea that mTOR regulation of Myc can control OGT via proteasomal degradation, we found that the decrease in OGT protein levels observed with Rapamycin treatment was also reversed following lactacystin treatment (Supplemental Figure 7A, B). Thus, mTOR and c-MYC regulation of OGT protein levels is proteasomal-dependent.

Consistent with previous findings that c-MYC regulates HSP90A, MDA-MB-231 cells stably expressing c-MYC shRNA contained significant decreases in HSP90A protein levels (Figure 3A, Supplemental Figure 8A) and RNA levels (Supplemental Figure 8B) compared to control RNAi cells. Conversely, MCF-10A cells overexpressing c-MYC contained increased levels of HSP90 compared to control cells (Figure 3B). To determine whether OGT interacts with HSP90 in breast cancer cells, we immunoprecipitated either OGT or HSP90 and examined interaction between these two proteins. Immunoprecipitating either OGT (Figure 4A) or HSP90 (Figure 4B) from MDA-MB-231 cell lysates showed that endogenous OGT and HSP90 interact in breast cancer cells. To test whether HSP90A activity in cancer cells is associated with OGT and O-GlcNAc cycling, we treated MDA-MB-231 cells with HSP90 specific inhibitor 17-Demethoxy-17-allyaminogeldanmycin (17-AAG) (43). Inhibition of HSP90 increases ubiquitination and proteasome-dependent degradation of client proteins (44). Consistent with the idea that OGT is an HSP90A client protein, MDA-MB-231 cells treated with 17-AAG displayed decreased OGT and O-GlcNAcylation levels compared to control cells (Supplemental Figure 8C). This decrease in OGT expression was independent of changes in Myc levels (Supplemental Figure 8C) and was partially reversed when cells were also treated with lactacystin to block proteasomal degradation (Supplemental Figure 7). To test directly whether HSP90A is required for OGT expression in cancer cells, we reduced HSP90A expression in breast cancer cells using two different RNAi constructs. Reducing HSP90A levels in MDA-MB-231 cells resulted in significant decreases in OGT protein levels and reduced O-GlcNAcylation (Figure 4C). Conversely, overexpressing HSP90 in HEK-293T cells increased both OGT levels and elevated O-GlcNAcylation (Supplemental Figure 8D). In addition, MCF-10A-MYC overexpressing cells contain increased HSP90A expression and increased OGT and O-GlcNAcylation as mentioned above, (Figure 3B) suggesting increased association between OGT and HSP90A in a MYC-dependent manner. Reducing HSP90A levels via RNAi in MYC-overexpressing cells resulted in significant inhibition of OGT protein levels and reduced total O-GlcNAcylation (Figure 4D). Together these results show that MYC regulation of HSP90A controls OGT protein levels and O-GlcNAcylation in cancer cells.

Figure 4. MYC transcriptional target HSP90 is required for OGT/O-GlcNAc regulation.

Figure 4

Open in a new tab

(A–B) Protein lysates from MDA-MB-231 cells were subjected to immunoprecipitation with the indicated antibodies. Pull down is quantified below immunoblots. (C) Cell lysates from control or HSP90 shRNA containing MDA-MB-231 were collected and analyzed by immunobloting. Protein expression is quantified below. (D) MCF10A control or MCF10A-c-MYC cell lysates stably expressing control or HSP90 shRNA were collected and analyzed by immunobloting. Relative OGT and HSP90 protein levels were normalized to actin and quantified (n=3). Quantification represents mean ± S.E. of least three independent experiments * p-value<0.05.

Myc-driven tumor cells contain elevated OGT and O-GlcNAc levels and require OGT for survival

Overexpression of c-Myc under the control of mouse mammary tumor virus (MMTV) results in the development of mammary tumors (45). To determine if c-MYC driven tumors show elevated OGT and O-GlcNAcylation, we compared COMMA-D cells, isolated from a mid-pregnant Balb/C mouse, to mammary tumor epithelial cells (MTECs) isolated from MMTV-MYC transgenic mice. The MTEC-MYC cells displayed elevated c-MYC levels as well as an increase in both OGT and O-GlcNAcylation (Figure 5A) compared to COMMA-D cells. To examine whether MYC-driven tumors have altered OGT and O-GlcNAcylation in vivo, we compared the levels of OGT and O-GlcNAc from mammary tissues harvested over the course of tumor progression from nulliparous female MMTV-MYC transgenic mice. O-GlcNAcylation was elevated in MYC-driven hyperplasic lessions compared with normal mammary glands of Myc+ females, and was further increased in late stage carcinomas relative to the hyperplasias (Figure 5B). Tumor tissue also displayed significantly upregulated OGT expression compared to normal mammary glands (Figure 5B, Supplemental Figure 9A).

Figure 5. Myc-driven tumors contain elevated OGT and O-GlcNAc levels and require OGT for survival.

Figure 5

Open in a new tab

(A) CommaD and MTEC-Myc cell lysates were collected and analyzed by immunoblotting with indicated antibodies. (B) Expression of OGT and O-GlcNAcylated proteins was compared by immunoblotting of HS-WCE (10 μg/lane) prepared from mammary tissue of normal (unaffected) glands, hyperplastic glands or late-stage carcinomas that originated from 4 independent MMTV-MYC transgenic females (FVB/N strain). Blots are representative of 3 normal mammary glands, 3 hyperplasias, and 4 carcinomas. (C) MCF10A and MTEC-MYC cells were treated with control (DMSO) or Ac-5s-GlcNAc (100 μM) for 48 hours then protein lysates were collected and analyzed by immunoblotting. (D) MCF10A and MTEC-MYC cells were treated with control or Ac-5s-GlcNAc at indicated doses for 48 hours and then stained with crystal violet. (E) MCF10A and MTEC-MYC cells were placed in 3D basement membrane cultures. On day 5, cells were treated with control (DMSO) or Ac-5s-GlcNAc at indicated doses for 48 hours, fixed and stained with indicated antibodies and representative images were taken using confocal microscopy. (F) Model of OGT regulation by mTOR/MYC/HSP90 in cancer cells.

MYC-driven cancers are known to be highly proliferative but also have high levels of apoptosis (33). We examined whether targeting OGT using a chemical inhibitor could sensitize these cells to apoptosis compared to non-tumorigenic mammary epithelial cells. Treatment of MTEC-MYC cells or MCF-10A cells with OGT inhibitor Ac-5SGlcNAc reduced total levels of O-GlcNAcylation (Figure 5C, Supplemental Figure 9C). However, Ac-5SGlcNAc treatment increased caspase-3 cleavage (Figure 5C) and significantly reduced cell viability as measured by crystal violet staining (Figure 5D, Supplemental Figure 9B) solely in the MTEC-MYC cells as apoptotic markers and cell viability was not altered in MCF-10A cells upon treatment. Since we have recently shown that reducing OGT in cancer cells leads to ER stress and apoptosis in a CHOP-dependent manner (27) we examined whether inhibiting OGT in MYC-driven cancer cells also activated ER stress. Indeed, treating MTEC-MYC cells with OGT inhibitor Ac-5SGlcNAc induced phosphorylation of eIF2α, increased expression of CHOP, and increased Bcl-2 BH3-only pro-apoptotic protein Bim (Figure 5C). Importantly, treating MCF-10A cells with this inhibitor did not activate ER stress or induce expression of these markers (Figure 5C). This selective cell death of MYC-driven cancer cells was also observed in 3D culture as MTEC-MYC cells treated with the OGT inhibitor contained elevated cleaved caspase-3 staining compared to MCF-10A cells (Figure 5E). Thus, Myc-driven breast cancer cells increase OGT and O-GlcNAcylation and inhibition of O-GlcNAcylation in these cells induces ER stress and apoptosis.

Discussion

Elevation of O-GlcNAcylation has been implicated in a wide range of cancers. However, the pathways responsible for the regulation of OGT and the O-GlcNAc modification in cancer cells remained unclear. Here, we show for the first time that the PI3K/mTOR pathway via regulation of the oncogenic transcription factor c-MYC is responsible for increased OGT and O-GlcNAcylation levels observed in breast cancer cells. We demonstrate that downstream of the receptor tyrosine kinase ErbB2, the AKT/mTOR, but not MEK/ERK, pathways were sufficient to elevate OGT and O-GlcNAcylation. Additionally, we found that elevation of OGT and O-GlcNAcylation in cancer cells is regulated by the oncogenic transcription factor c-MYC. Indeed, c-MYC is both required and sufficient to elevate OGT protein levels and global O-GlcNAcylation in breast cancer cells. Importantly, we found that c-MYC driven tumor cells also displayed elevated OGT and O-GlcNAcylation in vivo. Our data is consistent with previous work showing that c-MYC can regulate total O-GlcNAcylation as Rat1A myc+/+ fibroblasts contained increased O-GlcNAcylation compared to Rat1A myc−/− cells (46). However, this change in O-GlcNAcylation in Rat1A cells was not associated with changes in OGT expression as found in our study. It is likely that c-MYC also contributes to the supply of essential substrates required for hexosamine biosynthesis as c-MYC can increase glucose and glutamine flux in these cells (46) as well as in cancer cells (47).

Interestingly, c-MYC regulates OGT at the post-transcriptional level as we did not detect changes in OGT mRNA expression in cells with altered c-MYC or PI3K/mTOR pathways. This may help explain why OGT RNA levels are not found to be elevated in breast cancer microarray analysis (27). Although c-MYC is commonly known for its role as a transcription factor, it has been shown to stabilize protein levels of the enzyme glutaminase without affecting RNA expression levels (48). c-MYC also directly increases transcription of the heat shock protein HSP90A (42) which plays an important role in protein folding, degradation and maturation. HSP90A is also known to stabilize a subset of kinases, steroid receptors, and transcription factors, which are overexpressed in cancers (49). It was recently demonstrated that HSP90A directly interacts with OGT, and inhibition of HSP90 reduces the half-life of the OGT protein, leading to decreased global O-GlcNAcylation in endothelial cells (41). Consistent with this data, we showed that MYC–induced regulation of OGT, in part, requires HSP90A expression in cancer cells. Therefore, we propose a model (Figure 5F) in which MYC regulation of OGT occurs via its transcriptional activation of HSP90A which facilitates maintenance of OGT protein through stabilization or prevention of degradation by the proteasome.

Previous studies have found that c-MYC can be O-GlcNAcylated (50) (11) in normal cells, and more recently in prostate cancer cells (21). Reducing O-GlcNAcylation in PC-3 prostate cancer cells leads to reduced c-MYC protein O-GlcNAcylation, decreased c-MYC stability and was associated with decreased growth and survival of prostate cancer cells (21). HSP90A has also been shown to be O-GlcNAcylated (51). These data, together with our results, suggest that c-MYC, HSP90A and OGT/O-GlcNAcylation may be part of a feed-forward-regulatory loop present in cancer cells. Amplification of c-MYC in cancer cells can transcriptionally induce HSP90A expression leading to increased OGT levels and total O-GlcNAcylation that feeds back to O-GlcNAcylate c-MYC, increasing its stability and thus enabling cancer cell growth GlcNAcylation (Figure 5F). Consistent, with this idea, we show that MYC overexpression leads to elevated HSP90A protein levels that are required for increased OGT and O-GlcNAcylation levels. Importantly, we show that OGT is required for MYC-mediated cancer cell survival.

Since increased O-GlcNAcylation can also positively regulate c-MYC and other oncogenic transcription factors including FoxM1 (17) (20) as well as HIF-1α(27), reducing O-GlcNAcylation in cancer cells via OGT inhibition may be an important therapeutic option for a number of cancers. Our results also suggest that OGT may also serve as potential therapeutic target in MYC-amplified breast cancers, and potentially other cancers with amplification of this oncogene, such as prostate, neuroblastoma and multiple myeloma.

Supplementary Material

1

IMPLICATIONS.

Implications: Evidence indicates OGT as a therapeutic target in c-MYC-amplified cancers.

Acknowledgments

We thank Gieira Jones, Gregg Johannes and Kevin Truskowski for technical assistance. We thank Christina M. Ferrer for helpful discussions and critically reading this manuscript. Research reported in this publication was supported by the National Cancer Institute of the National Institutes of Health under Award Number: RO1CA155413 (to M.J.R) and R01CA138488 (to T.N.S.) and by the American Cancer Society (RSG0702901CNE to T.N.S.). D.J.V. thanks the Natural Sciences and Engineering Research Council of Canada for support through an E.W.R Steacie Memorial Fellowship and Dr. Lehua Deng for the synthesis of compounds.

Footnotes

The authors declare no conflict of interest.

References

  • 1.Deberardinis RJ, Sayed N, Ditsworth D, Thompson CB. Brick by brick: metabolism and tumor cell growth. Current opinion in genetics & development. 2008;18:54–61. doi: 10.1016/j.gde.2008.02.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Warburg O. On the origin of cancer cells. Science. 1956;123:309–314. doi: 10.1126/science.123.3191.309. [DOI] [PubMed] [Google Scholar]
  • 3.Vander Heiden MG, Cantley LC, Thompson CB. Understanding the Warburg effect: the metabolic requirements of cell proliferation. Science. 2009;324:1029–1033. doi: 10.1126/science.1160809. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Marshall S, Bacote V, Traxinger RR. Discovery of a metabolic pathway mediating glucose-induced desensitization of the glucose transport system. Role of hexosamine biosynthesis in the induction of insulin resistance. J Biol Chem. 1991;266:4706–4712. [PubMed] [Google Scholar]
  • 5.McClain DA. Hexosamines as mediators of nutrient sensing and regulation in diabetes. Journal of diabetes and its complications. 2002;16:72–80. doi: 10.1016/s1056-8727(01)00188-x. [DOI] [PubMed] [Google Scholar]
  • 6.Hanover JA, Krause MW, Love DC. Bittersweet memories: linking metabolism to epigenetics through O-GlcNAcylation. Nature reviews Molecular cell biology. 2012;13:312–321. doi: 10.1038/nrm3334. [DOI] [PubMed] [Google Scholar]
  • 7.Hart GW, Housley MP, Slawson C. Cycling of O-linked beta-N-acetylglucosamine on nucleocytoplasmic proteins. Nature. 2007;446:1017–1022. doi: 10.1038/nature05815. [DOI] [PubMed] [Google Scholar]
  • 8.Hart GW, Slawson C, Ramirez-Correa G, Lagerlof O. Cross talk between O-GlcNAcylation and phosphorylation: roles in signaling, transcription, and chronic disease. Annual review of biochemistry. 2011;80:825–858. doi: 10.1146/annurev-biochem-060608-102511. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Comer FI, Hart GW. O-GlcNAc and the control of gene expression. Biochimica et biophysica acta. 1999;1473:161–171. doi: 10.1016/s0304-4165(99)00176-2. [DOI] [PubMed] [Google Scholar]
  • 10.Bond MR, Hanover JA. O-GlcNAc Cycling: A Link Between Metabolism and Chronic Disease. Annual review of nutrition. 2013;33:205–229. doi: 10.1146/annurev-nutr-071812-161240. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Chou TY, Dang CV, Hart GW. Glycosylation of the c-Myc transactivation domain. Proc Natl Acad Sci U S A. 1995;92:4417–4421. doi: 10.1073/pnas.92.10.4417. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Shaw P, Freeman J, Bovey R, Iggo R. Regulation of specific DNA binding by p53: evidence for a role for O-glycosylation and charged residues at the carboxy-terminus. Oncogene. 1996;12:921–930. [PubMed] [Google Scholar]
  • 13.Medina L, Grove K, Haltiwanger RS. SV40 large T antigen is modified with O-linked N-acetylglucosamine but not with other forms of glycosylation. Glycobiology. 1998;8:383–391. doi: 10.1093/glycob/8.4.383. [DOI] [PubMed] [Google Scholar]
  • 14.Chou TY, Hart GW. O-linked N-acetylglucosamine and cancer: messages from the glycosylation of c-Myc. Advances in experimental medicine and biology. 2001;491:413–418. doi: 10.1007/978-1-4615-1267-7_26. [DOI] [PubMed] [Google Scholar]
  • 15.Hanover JA. Glycan-dependent signaling: O-linked N-acetylglucosamine. FASEB journal: official publication of the Federation of American Societies for Experimental Biology. 2001;15:1865–1876. doi: 10.1096/fj.01-0094rev. [DOI] [PubMed] [Google Scholar]
  • 16.Yang WH, Park SY, Nam HW, Kim do H, Kang JG, Kang ES, Kim YS, Lee HC, Kim KS, Cho JW. NFkappaB activation is associated with its O-GlcNAcylation state under hyperglycemic conditions. Proceedings of the National Academy of Sciences of the United States of America. 2008;105:17345–17350. doi: 10.1073/pnas.0806198105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Caldwell SA, Jackson SR, Shahriari KS, Lynch TP, Sethi G, Walker S, Vosseller K, Reginato MJ. Nutrient sensor O-GlcNAc transferase regulates breast cancer tumorigenesis through targeting of the oncogenic transcription factor FoxM1. Oncogene. 2010;29:2831–2842. doi: 10.1038/onc.2010.41. [DOI] [PubMed] [Google Scholar]
  • 18.Gu Y, Mi W, Ge Y, Liu H, Fan Q, Han C, Yang J, Han F, Lu X, Yu W. GlcNAcylation plays an essential role in breast cancer metastasis. Cancer research. 2010;70:6344–6351. doi: 10.1158/0008-5472.CAN-09-1887. [DOI] [PubMed] [Google Scholar]
  • 19.Champattanachai V, Netsirisawan P, Chaiyawat P, Phueaouan T, Charoenwattanasatien R, Chokchaichamnankit D, Punyarit P, Srisomsap C, Svasti J. Proteomic analysis and abrogated expression of O-GlcNAcylated proteins associated with primary breast cancer. Proteomics. 2013;13:2088–2099. doi: 10.1002/pmic.201200126. [DOI] [PubMed] [Google Scholar]
  • 20.Lynch TP, Ferrer CM, Jackson SR, Shahriari KS, Vosseller K, Reginato MJ. Critical role of O-Linked beta-N-acetylglucosamine transferase in prostate cancer invasion, angiogenesis, and metastasis. J Biol Chem. 2012;287:11070–11081. doi: 10.1074/jbc.M111.302547. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Itkonen HM, Minner S, Guldvik IJ, Sandmann MJ, Tsourlakis MC, Berge V, Svindland A, Schlomm T, Mills IG. O-GlcNAc transferase integrates metabolic pathways to regulate the stability of c-MYC in human prostate cancer. Cancer research. 2013 doi: 10.1158/0008-5472.CAN-13-0549. [DOI] [PubMed] [Google Scholar]
  • 22.Yi W, Clark PM, Mason DE, Keenan MC, Hill C, Goddard WA, 3rd, Peters EC, Driggers EM, Hsieh-Wilson LC. Phosphofructokinase 1 glycosylation regulates cell growth and metabolism. Science. 2012;337:975–980. doi: 10.1126/science.1222278. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Mi W, Gu Y, Han C, Liu H, Fan Q, Zhang X, Cong Q, Yu W. O-GlcNAcylation is a novel regulator of lung and colon cancer malignancy. Biochimica et biophysica acta. 2011;1812:514–519. doi: 10.1016/j.bbadis.2011.01.009. [DOI] [PubMed] [Google Scholar]
  • 24.Zhu Q, Zhou L, Yang Z, Lai M, Xie H, Wu L, Xing C, Zhang F, Zheng S. O-GlcNAcylation plays a role in tumor recurrence of hepatocellular carcinoma following liver transplantation. Medical oncology. 2012;29:985–993. doi: 10.1007/s12032-011-9912-1. [DOI] [PubMed] [Google Scholar]
  • 25.Rozanski W, Krzeslak A, Forma E, Brys M, Blewniewski M, Wozniak P, Lipinski M. Prediction of bladder cancer based on urinary content of MGEA5 and OGT mRNA level. Clinical laboratory. 2012;58:579–583. [PubMed] [Google Scholar]
  • 26.Shi Y, Tomic J, Wen F, Shaha S, Bahlo A, Harrison R, Dennis JW, Williams R, Gross BJ, Walker S, Zuccolo J, Deans JP, Hart GW, Spaner DE. Aberrant O-GlcNAcylation characterizes chronic lymphocytic leukemia. Leukemia. 2010;24:1588–1598. doi: 10.1038/leu.2010.152. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Ferrer CM, Lynch TP, Sodi VL, Falcone JN, Schwab LP, Peacock DL, Vocadlo DJ, Seagroves TN, Reginato MJ. O-GlcNAcylation Regulates Cancer Metabolism and Survival Stress Signaling via Regulation of the HIF-1 Pathway. Molecular cell. 2014;54:820–831. doi: 10.1016/j.molcel.2014.04.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Krzeslak A, Forma E, Bernaciak M, Romanowicz H, Brys M. Gene expression of O-GlcNAc cycling enzymes in human breast cancers. Clinical and experimental medicine. 2012;12:61–65. doi: 10.1007/s10238-011-0138-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Yehezkel G, Cohen L, Kliger A, Manor E, Khalaila I. O-linked beta-N-acetylglucosaminylation (O-GlcNAcylation) in primary and metastatic colorectal cancer clones and effect of N-acetyl-beta-D-glucosaminidase silencing on cell phenotype and transcriptome. J Biol Chem. 2012;287:28755–28769. doi: 10.1074/jbc.M112.345546. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Shaw RJ, Cantley LC. Ras, PI(3)K and mTOR signalling controls tumour cell growth. Nature. 2006;441:424–430. doi: 10.1038/nature04869. [DOI] [PubMed] [Google Scholar]
  • 31.Zoncu R, Efeyan A, Sabatini DM. mTOR: from growth signal integration to cancer, diabetes and ageing. Nature reviews Molecular cell biology. 2011;12:21–35. doi: 10.1038/nrm3025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Schmidt EV, Ravitz MJ, Chen L, Lynch M. Growth controls connect: interactions between c-myc and the tuberous sclerosis complex-mTOR pathway. Cell cycle. 2009;8:1344–1351. doi: 10.4161/cc.8.9.8215. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Dang CV, Le A, Gao P. MYC-induced cancer cell energy metabolism and therapeutic opportunities. Clinical cancer research: an official journal of the American Association for Cancer Research. 2009;15:6479–6483. doi: 10.1158/1078-0432.CCR-09-0889. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Hynes NE, Stoelzle T. Key signalling nodes in mammary gland development and cancer: Myc. Breast cancer research: BCR. 2009;11:210. doi: 10.1186/bcr2406. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Reginato MJ, Mills KR, Paulus JK, Lynch DK, Sgroi DC, Debnath J, Muthuswamy SK, Brugge JS. Integrins and EGFR coordinately regulate the pro-apoptotic protein Bim to prevent anoikis. Nature cell biology. 2003;5:733–740. doi: 10.1038/ncb1026. [DOI] [PubMed] [Google Scholar]
  • 36.Gloster TM, Zandberg WF, Heinonen JE, Shen DL, Deng L, Vocadlo DJ. Hijacking a biosynthetic pathway yields a glycosyltransferase inhibitor within cells. Nature chemical biology. 2011;7:174–181. doi: 10.1038/nchembio.520. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Schwab LP, Peacock DL, Majumdar D, Ingels JF, Jensen LC, Smith KD, Cushing RC, Seagroves TN. Hypoxia-inducible factor 1alpha promotes primary tumor growth and tumor-initiating cell activity in breast cancer. Breast Cancer Res. 2012;14:R6. doi: 10.1186/bcr3087. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Neve RM, Chin K, Fridlyand J, Yeh J, Baehner FL, Fevr T, Clark L, Bayani N, Coppe JP, Tong F, Speed T, Spellman PT, DeVries S, Lapuk A, Wang NJ, Kuo WL, Stilwell JL, Pinkel D, Albertson DG, Waldman FM, McCormick F, Dickson RB, Johnson MD, Lippman M, Ethier S, Gazdar A, Gray JW. A collection of breast cancer cell lines for the study of functionally distinct cancer subtypes. Cancer cell. 2006;10:515–527. doi: 10.1016/j.ccr.2006.10.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Luo J, Manning BD, Cantley LC. Targeting the PI3K-Akt pathway in human cancer: rationale and promise. Cancer cell. 2003;4:257–262. doi: 10.1016/s1535-6108(03)00248-4. [DOI] [PubMed] [Google Scholar]
  • 40.Reginato MJ, Mills KR, Becker EB, Lynch DK, Bonni A, Muthuswamy SK, Brugge JS. Bim regulation of lumen formation in cultured mammary epithelial acini is targeted by oncogenes. Molecular and cellular biology. 2005;25:4591–4601. doi: 10.1128/MCB.25.11.4591-4601.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Zhang F, Snead CM, Catravas JD. Hsp90 regulates O-linked beta-N-acetylglucosamine transferase: a novel mechanism of modulation of protein O-linked beta-N-acetylglucosamine modification in endothelial cells. American journal of physiology Cell physiology. 2012;302:C1786–1796. doi: 10.1152/ajpcell.00004.2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Teng SC, Chen YY, Su YN, Chou PC, Chiang YC, Tseng SF, Wu KJ. Direct activation of HSP90A transcription by c-Myc contributes to c-Myc-induced transformation. The Journal of biological chemistry. 2004;279:14649–14655. doi: 10.1074/jbc.M308842200. [DOI] [PubMed] [Google Scholar]
  • 43.Schulte TW, Neckers LM. The benzoquinone ansamycin 17-allylamino-17-demethoxygeldanamycin binds to HSP90 and shares important biologic activities with geldanamycin. Cancer chemotherapy and pharmacology. 1998;42:273–279. doi: 10.1007/s002800050817. [DOI] [PubMed] [Google Scholar]
  • 44.Solit DB, Scher HI, Rosen N. Hsp90 as a therapeutic target in prostate cancer. Seminars in oncology. 2003;30:709–716. doi: 10.1016/s0093-7754(03)00346-4. [DOI] [PubMed] [Google Scholar]
  • 45.Stewart TA, Pattengale PK, Leder P. Spontaneous mammary adenocarcinomas in transgenic mice that carry and express MTV/myc fusion genes. Cell. 1984;38:627–637. doi: 10.1016/0092-8674(84)90257-5. [DOI] [PubMed] [Google Scholar]
  • 46.Morrish F, Isern N, Sadilek M, Jeffrey M, Hockenbery DM. c-Myc activates multiple metabolic networks to generate substrates for cell-cycle entry. Oncogene. 2009;28:2485–2491. doi: 10.1038/onc.2009.112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Dang CV. MYC, metabolism, cell growth, and tumorigenesis. Cold Spring Harb Perspect Med. 2013:3. doi: 10.1101/cshperspect.a014217. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Dang CV. Rethinking the Warburg effect with Myc micromanaging glutamine metabolism. Cancer research. 2010;70:859–862. doi: 10.1158/0008-5472.CAN-09-3556. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Sawai A, Chandarlapaty S, Greulich H, Gonen M, Ye Q, Arteaga CL, Sellers W, Rosen N, Solit DB. Inhibition of Hsp90 down-regulates mutant epidermal growth factor receptor (EGFR) expression and sensitizes EGFR mutant tumors to paclitaxel. Cancer research. 2008;68:589–596. doi: 10.1158/0008-5472.CAN-07-1570. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Chou TY, Hart GW, Dang CV. c-Myc is glycosylated at threonine 58, a known phosphorylation site and a mutational hot spot in lymphomas. The Journal of biological chemistry. 1995;270:18961–18965. doi: 10.1074/jbc.270.32.18961. [DOI] [PubMed] [Google Scholar]
  • 51.Overath T, Kuckelkorn U, Henklein P, Strehl B, Bonar D, Kloss A, Siele D, Kloetzel PM, Janek K. Mapping of O-GlcNAc sites of 20 S proteasome subunits and Hsp90 by a novel biotin-cystamine tag. Molecular & cellular proteomics: MCP. 2012;11:467–477. doi: 10.1074/mcp.M111.015966. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
NIHMS660778-supplement-1.ppt (1.3MB, ppt)

RESOURCES