Regulation of Staphylococcal Superantigen-Like Gene, ssl8, Expression in Staphylococcus aureus strain, RN6390

Abstract

Staphylococcal superantigen-like (SSL) proteins, which are encoded by a cluster of eleven ssl genes, contribute to the Staphylococcus aureus virulence. Recently we reported ssl8 expression profiles in seven clinically important strains—MW2, USA300FPR3757, MSSA476, Newman, RN6390, Mu50, and N315—and showed the differential expression of ssl8 in Newman, RN6390, and USA300FPR3757 strains, despite harboring identical allelic forms of ssl8, suggesting the roles for different regulatory elements for this gene in different S. aureus strains. In this communication, using RN6390, a common laboratory S. aureus strain and its isogenic knockout mutant strains of agr, sae, sarA, sigB, rot, and the agr-_/sigB⁻ double mutant, we showed that SarA and Rot are inducer and repressor, respectively, for ssl8 expression in RN6390. This is in contrast to the Newman strain, where ssl8 is positively regulated by Sae but negatively by Agr, indicating the variable expression of ssl8 in clinical strains is more likely due to strain-specific regulatory elements.

Pathogenesis of Staphylococcus aureus is complex and involves the coordinate expression of multiple toxin genes that are tightly controlled by global regulators at the transcription level.^1–3 These toxins are synthesized preferentially during the transition between exponential and stationary growth phases.⁴ Among its large number of secreted toxins, is a group of staphylococcal superantigen-like (SSL) proteins encoded by 11 ssl (formerly known as staphylococcal exotoxin-like or set) genes.^5,6 Genes for ssl are located on a highly variable region called RD13 that corresponds to the ssl containing genomic islands (vSaα, SaPIn2, or SaPIm2) in S. aureus strains.^5,7 SSL proteins have limited overall sequence homology to the staphylococcal enterotoxins (SEs) and toxic shock syndrome toxin 1 (TSST-1) and, thus, represent a novel family of exotoxin-like proteins.⁶

ssl genes are present in all S. aureus strains studied so far, suggesting a non-redundant role in bacterial survival.^5,8,9 The overall order of ssl genes is conserved, and the allelic variants of the same gene in different strains share 85% to 100% sequence similarity,⁷ indicating the evidence of selective pressure during the infection. SSL proteins in the same strain have 36% to 67% sequence homology.^6,7 Although the SSL proteins have sequence homology and similar predicted structures,^5,6,8 each protein studied so far has a related but distinct function in host-pathogen interactions.^6,9–12 SSL proteins have been shown to help S. aureus to escape from the protective adaptive immune response of the host and thus may contribute to bacterial pathogenicity.^6,9–12 SSL5 interferes with the interaction between PSGL-1 (P-selectin glycoprotein ligand-1) and P-selectin and prevents neutrophil extravasations toward the site of infection.¹¹ SSL7 inhibits IgA dependent cellular effector functions mediated by FcαRI, such as phagocytosis, degranulation, and respiratory burst.¹² SSL7 and SSL9 interact with human antigen presenting cells (monocytes and dendritic cells) at independent active sites.¹⁰ SSL11 induces proinflammatory cytokines from peripheral blood mononuclear cells.¹³ SSL8 binds to tenascin C (TNC), a glycoprotein and inhibits TNC and fibronectin interaction and cell motility in keratinocytes.¹⁴ ssl8 gene seem to be more frequently present in S. aureus isolates causing atopic dermatitis.¹⁵

The success of S. aureus as a pathogen lies in its ability to exploit multiple virulence factors regulated by complex network of global gene regulators that includes but not limited to Agr(accessory gene regulator), SarA(staphylococcal accessory regulator), Sae (S. aureus exoprotein expression), SigB (sigma factor B) and Rot (repressor of toxins).^{2–4,9,16,17} Recently, we reported the differential expression of ssl8 in seven clinically relevant S. aureus isolates and showed that ssl8 expression in the Newman strain is regulated by Sae and Agr.¹⁶ In this brief communication, we show that the ssl8 expression in the common laboratory strain, RN6390 is regulated differently than the Newman strain suggesting ssl8 regulation is strain dependent.

Materials and Methods

Bacterial Strains, Media and Culture Conditions

The laboratory S. aureus strain RN6390 and its isogenic mutants used in this study are listed in table 1. For each experiment, S. aureus was grown either in tryptic soy broth (TSB) or on tryptic soy agar (TSA) plates (Beckton Dickinson) as needed. For gene expression studies, an overnight shaking culture, grown at 37°C in TSB was used to inoculate 50 ml of fresh TSB (dilution, 1:200). Bacterial growth was subsequently monitored by incubating the flasks at 37°C with constant shaking and measuring the turbidity of the culture every 30 min at OD₆₀₀ using a spectrophotometer (Beckman Coulter, Inc., CA) until the cultures reached the stationary phase. There were no growth differences between RN6390 and mutant strains (data not shown).

Table 1.

S. aureus wild type and mutant strains used in this study.

S. aureus Strains	Genotype description	References
RN6390	Laboratory strain related to 8325-4, rsbU−.	4
RN6911	RN6390 agr::tetM	23
AS5	RN6390 sae::Tn917	30
ALC488	RN6390 sarA::ermC	31
ALC1001	RN6390 sigB::ermC	32
PM783	RN6390 rot::tetM	15
VKS105 (double mutant)	RN6390Δagr::tetM/sigB::kanr	This study

Construction of an agr/sigB Knockout Mutant of RN6390

A agr/sigB mutant in RN6390 background was generated using a phage transduction procedure as described previously.⁹

RNA Extraction

For gene expression studies, both the RN6390 and the mutant strains were grown up to early-stationary phase (5.5 hours) and harvested immediately for RNA isolations. RNA was extracted using a Qiagen RNeasy Mini kit (Qiagen, Valencia, CA) by following the manufacturer’s recommendations with a few modifications. Briefly, a 1.5 mL of bacterial culture was dispensed into 3 mL of RNA Protect (Qiagen Inc, CA) in a 15-mL tube and mixed by vortexing for 5 seconds followed by 5 minutes incubation at room temperature. The cells were pelleted by centrifuging at 1252g for 5 minutes followed by a wash with DEPC treated water and re-suspended into 1.0 mL of TRIzol reagent. The suspension was then transferred to a 2-mL Lysing Matrix tube (MP Biomedicals, Irvine, CA) and homogenized by shaking three times in the mini bead beater for 20 seconds at a speed of 6 m/s. The cells were incubated on ice for 1 minute in between each run. To the homogenate, 200 μL of RNA-grade chloroform was added and vortexed for 15 seconds, followed by a centrifugation at high speed for 5 minutes and carefully aspirated the upper layer. To this supernatant, 500 μL of RNA-grade isopropyl alcohol was added and mixed by inverting the tube several times. This sample (~700 μL) was then transferred to an RNeasy column and centrifuged for 15 seconds at ≥8000g and followed the manufacturer’s guidelines for RNeasy cleanup protocol (Qiagen Inc, CA). Finally, RNA was eluted with 50 μL of DEPC-treated water. RNA concentration was determined by using Bio-Rad SmartSpec Plus Spectrophotometer (Analytical Instruments, LLC, MN). An aliquot of each RNA sample was electrophoresed on a 1.0% agarose gel to assess its integrity and quality.

Quantitative Real-Time PCR Analysis of ssl8 Expression

To quantify the ssl8 transcript levels in RN6390 and its mutant strains, the isolated RNA samples were subjected to DNase treatment with Turbo DNA-free kit (Ambion, Austin, TX) and confirmed to be DNA free by PCR before cDNA synthesis. The first strand cDNA was prepared with 2 μg of total RNA using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Roche, Foster City, CA) according to the manufacturer’s instructions.

From the above reaction mix, 2 μL (~100 to 200 ng) of cDNA template was further used for quantitative real-time PCR in the Light Cycler (Roche Diagnostics Corp, Indianapolis, IN). The reaction was carried out using TaqMan Universal PCR Master Mix (2X) (Applied Biosystems Inc, CA) and the TaqMan Gene Expression Assays [which included PCR forward and reverse primers (900 nM/μL) and 6-FAM dye-labeled MGB probe (250 nM/μL) specific for ssl8, RNAIII and gmk individually] (Applied Biosystems Inc, CA) by following the manufacturer’s instructions. The PCR primers and probes are listed in table 2.

Table 2.

Primers and probes used in this study.

Gene	Primer	Primer sequence (5′ → 3′)	Probe sequence	Reference
ssl8	Forward	CCAACAAAATCAAAAGTTCCA	FAM-CACATGGTTTAGATGT CTTTGCGGTACC-NFQ	This study
	Reverse	CACCACTAACACTAAATATTCTTCCA		This study
Gmk	Forward	ACTAGGGATGCGTTTGAAGCTTTAA	FAM-AAAGATGACCAATTT ATAG AATATG-NFQ	This study
	Reverse	ACCATAATAGTTGCCTACAT		This study
RNAIII	Forward	TCCATTTTACTAAGTCACCGATTGT	FAM-ATCTTGTGCCATTGAAATCACTCCTTCCTT-NFQ	33
	Reverse	TGTGATGGAAAATAGTTGATGAGTTGT		33

Relative quantification of ssl8, RNAIII (target genes), and gmk (guanylate kinase; endogenous control) was performed using 2^−ΔΔCT calculation according to the manufacturer’s guidelines (Roche Diagnostics Corp., Indianapolis, IN). This method compensates for the factors such as variability in cDNA synthesis and template concentration, and calculates transcript ratios (ssl8/gmk and RNAIII/gmk) rather than absolute values. However, the reliability of 2^−ΔΔCT calculation depends on the PCR efficiency. By validation experiment, we confirmed that the PCR efficiency for ssl8, RNAIII and gmk was approximately two, as expected. To quantify the ssl8 and RNAIII expressions in our experiments, we used gmk as a reference gene.^13,19. All the results were obtained from two independent cultures.

Results

RN6390 ssl8 Regulation by SarA and Rot

We have quantified the ssl8 and RNAIII transcript levels in RN6390 and its mutant strains: RN6911 (RN6390 agr::tetM), AS5 (RN6390 sae::Tn917), ALC488 (RN6390 ΔsarA::ermC), ALC1001 (RN6390 ΔsigB::ermC), PM783 (RN6390 Δrot::tetM) and VKS105 (Δagr::tetM/sigB::kan^r double mutant of RN6390).

The ssl8/gmk transcript ratios in RN6390 (5.68 × 10⁻⁰³) were comparable to the ratios in sae⁻ strain, AS5 (5.64 × 10⁻⁰³) and agr⁻ strain, RN6911 (5.48 × 10⁻⁰³). The ssl8/gmk transcript ratios in sarA⁻ strain, ALC488 and sigB⁻ strain, ALC1001 were 1.98 × 10⁻⁰³ and 3.63 × 10⁻⁰³, respectively. In case of rot⁻ strain, PM783 the ratio was 1.57 × 10⁻⁰² and in the double mutant, agr⁻/sigB⁻ strain VKS105, the ratio was 2.20 × 10⁻⁰³ (figure 1).

Figure 1.

Transcript ratios of ssl8/gmk and RNAIII/gmk, quantified at early-stationary phase from RN6390 and its isogenic knockout mutants: RN6911 (RN6390 agr::tetM), AS5 (RN6390 sae::Tn917), ALC488 (RN6390 ΔsarA::ermC), ALC1001 (RN6390 ΔsigB::ermC), PM783 (RN6390 Δrot::tetM) and VKS105 (Δagr::tetM/sigB::kan^r double mutant of RN6390). The striped and dark bars indicate the ssl8 (on primary axis) and RNAIII (on secondary axis) expression levels, respectively. Data represent the mean values of two independent measurements.

The sarA and rot null mutations down-regulated (~3 fold) and up-regulated (~3 fold) ssl8 expression, respectively, suggesting that the SarA is a positive regulator, whereas Rot is a negative regulator of ssl8 expression in RN6390 (figure 1). However, the sae and agr mutations did not change the levels of ssl8 transcripts, in contrast to sigB mutation, which caused ~1.5 fold decrease compared to the RN6390, suggesting SigB could be another positive regulator of ssl8. The double mutant, agr/sigB (VKS105) showed ~2.5 fold repression of ssl8 compared to the RN6390, suggesting agr and sigB act in conjunction to regulate the ssl8 expression.

Since Agr is one of the master regulators of exotoxins, we determined the transcript levels of RNAIII in these strains as well. The RNAIII/gmk transcript ratio in sigB⁻ strain ALC1001 showed 1.2 fold increases compared to its wild type strain, RN6390. However, the RNAIII/gmk transcript ratios in sarA⁻ (ALC488), sae⁻ (AS5), and rot⁻ (PM783) strains showed 2-, 13-, and 85-fold decreases, respectively, compared to the RN6390. As expected, the RNAIII levels were not detectable in agr⁻ strains RN6911 (agr⁻) and VKS105 (agr⁻/sigB⁻). Since Agr does not seem to have a role in regulation of ssl8 in RN6390, the increase and decrease in RNAIII levels did not show any corresponding up or down regulation of ssl8 expression (figure 1).

Discussion

Staphylococcal exotoxins and SSL proteins significantly contribute to the S. aureus pathogenicity.^{1,6,9–11,19–21} Their production is controlled by a network of global regulators, which act both positively and negatively depending on the virulence genes and host strains.^{2–4,9,16,17} We showed here that sarA and rot mutations down-regulated and up-regulated ssl8 expression, respectively, in RN6390, suggesting these two were the positive and negative regulators of ssl8 in this strain (figure 1). SarA is a known positive regulator of a number of genes such as α- and δ-hemolysins, Agr response genes, agrA-D, fnbA and fnbB (fibronectin binding proteins), splA, splB, splD and splF (serine proteases), ssl4, and negative regulator of surface protein A (spa).²² Similarly, a sarA homolog, rot is a known master regulator of a large number of genes as well. Using Affymetrix GeneChip based approach, Said-Salim et al showed that rot up regulates the expression of more than 80 genes (eg, coagulase, clumping factor B) and down regulates ~60 genes (eg, β-hemolysin, serine proteases).⁹ In addition, we observed that sigB mutation also caused reduction in ssl8 transcript levels but not to the extent of sarA mutant, indicating that SigB is a relatively weak positive regulator of ssl8 in RN6390. In the agr⁻/sigB⁻ double mutant, the expression of ssl8 was down regulated. Similar down regulation of exotoxin genes has been shown in sar⁻/agr⁻ double mutants compared to their parental and single mutant strains.²³ Our results indicated that Agr and SigB possibly act in concert to regulate ssl8 expression. It was interesting to note that ssl8 in the Newman strain was positively regulated by Sae and SigB and negatively by Agr, which is in contrast to RN6390.¹⁸ Indeed, others have shown that ssl7 and ssl11 are positively regulated by SaeRS system in Newman strain.²⁴ All of the Sae regulated genes were also found to be influenced by SigB but not always in the same direction.²⁵

RNAIII levels do not seem to have any effect on ssl8 expression in RN6390. However, it was interesting to note that RNAIII levels were highest in RN6390 compared to MW2, Newman, FPR3757, MSSA476, Mu50, and N315 due to deletion in rsbU gene of sigB operon,¹⁸ suggesting the sigB has negative effect on RNAIII expression as has also been shown by others. Lauderdale et al²⁶ had reported that the agr RNAIII levels were elevated in the sigB mutants causing the anti-biofilm phenotypic effect. Unlike previously reported, we observed reduced RNAIII transcript levels in sae⁻ strain of RN6390.²⁷ Curiously, RNAIII levels were also reduced in rot⁻ strain of RN6390 (figure 1). Indeed, RNAIII interacts with rot mRNA and is involved in inhibition of rot mRNA translation.^28,29

In summary, it appears that the expression and regulation of ssl in S. aureus is complicated and is determined by the strain specificity and not necessarily the common genetic background which is probably due to unrelated regulatory pathways. We showed here that the regulatory pathways of ssl8 in RN6390 are different from our findings for the ssl8 in the Newman strain¹⁸ suggesting regulation of many individual virulence factors in S. aureus are strain-specific. This observation further highlights the complexity in regulation of virulence in S. aureus strains and poses challenges in considering all S. aureus as equal.