Skip to main content
Biology of Reproduction logoLink to Biology of Reproduction
. 2012 Oct 24;87(6):143. doi: 10.1095/biolreprod.112.103382

Insulin-Like 3 Signaling Is Important for Testicular Descent but Dispensable for Spermatogenesis and Germ Cell Survival in Adult Mice1

Zaohua Huang 3, Bryan Rivas 3, Alexander I Agoulnik 3,4,2
PMCID: PMC4435430  PMID: 23100620

ABSTRACT

Relaxin family peptide receptor 2 (RXFP2) is the cognate receptor of a peptide hormone insulin-like 3 (INSL3). INSL3 is expressed at high levels in both fetal and adult Leydig cells. Deletion of Insl3 or Rxfp2 genes in mice caused cryptorchidism resulting from a failure of gubernaculum development. Using a novel mouse transgenic line with a knock-in LacZ reporter in the Rxfp2 locus, we detected a robust Rxfp2 expression in embryonic and early postnatal gubernaculum in males and in postmeiotic spermatogenic cells in adult testis. To study the role of INSL3/RXFP2 signaling in male reproduction, we produced a floxed Rxfp2 allele and used the Cre/loxP approach to delete Rxfp2 in different tissues. Using Cre transgene driven by retinoic acid receptor beta promoter, conditional gene targeting in gubernacular mesenchymal cells at early embryonic stages caused high intraabdominal cryptorchidism as in males with a global deletion of Rxfp2. However, when the Rxfp2 was deleted in gubernacular smooth or striated muscle cells, no abnormalities of testicular descent or testis development were found. Specific ablation of Rxfp2 in male germ cells using Stra8-icre transgene did not affect testis descent, spermatogenesis, or fertility in adult males. No significant change in germ cell apoptosis was detected in mutant males. In summary, our data indicate that the INSL3/RXFP2 signaling is important for testicular descent but dispensable for spermatogenesis and fertility in adult males.

Keywords: INSL3, RXFP2, spermatogenesis, testicular descent


Deletion of relaxin family peptide receptor 2 gene in mouse gubernacular mesenchymal cells but not in smooth or striated muscle cells caused cryptorchidism, whereas deletion of the gene in male germ cells had no effect on spermatogenesis and germ cell survival.

INTRODUCTION

During embryonic development in mammals, both male and female gonads are located at a high pararenal position at the time of sex differentiation. The gonads are connected by two ligaments to the body wall: the cranial mesonephric ligament and the caudal genitoinguinal ligament or the gubernaculum [1, 2]. After sex determination, male gonads start the process of testicular descent resulting in testes positioned in the scrotum while female gonads remain in the high abdominal position. Testicular descent can be divided into two phases: the transabdominal phase (in mice from embryonic day 14.5 [E14.5] to E17.5) and the inguinoscrotal phase (in mice from E18 to postnatal day 21 [P21]) [3]. During testicular descent, the cranial ligament regresses while the gubernaculum undergoes a series of differentiation steps. At the transabdominal phase, the gubernaculum differentiates into two structures: the gubernacular cord and the bulb. This is followed by the differentiation of the muscle layers of the bulb, composed primarily of striated and some smooth muscle. Further development of the gubernaculum involves the enlargement of the bulb through cell proliferation and extracellular matrix deposition. In the beginning of the inguinoscrotal phase, the processus vaginalis forms via the outgrowth and invagination of the gubernacular bulb. The components of the fetal gubernaculum or abdominal body wall further differentiate into cremaster muscle and the wall of a cremasteric sac. By P12, the distal end of the processus vaginalis reaches the end of the scrotum, and the epididymis and testis are located inside the scrotum [4].

Insulin-like 3 (INSL3) hormone signaling via its cognate G protein-coupled receptor, relaxin family peptide receptor 2 (RXFP2), and androgen hormone signaling via androgen receptor play crucial roles in the transabdominal and inguinoscrotal phases, respectively [5, 6]. INSL3 is produced in fetal and adult Leydig cells and is first detected at E13.5 in mouse just before the start of testicular descent [7]. Coincidently, the mRNA of Rxfp2 expression was clearly detected at E14.5 specifically in gubernacular tissue [8]. The Insl3 or Rxfp2 global knockout in mice resulted in the same phenotype of high intraabdominal cryptorchidism and male infertility caused by spermatogenesis arrest [9–12]. In contrast, transgenic overexpression of Insl3 induced gubernaculum development and ovary descent in female mice [13]. Quantitative RT-PCR (QRT-PCR) showed an increase in mouse Rxfp2 expression in the postnatal adult cremasteric sac [14]. We also detected strong positive staining in adult cremaster muscles using several commercially available RXFP2 antibodies [14]. There are however some discrepancies in the RXFP2 expression data in the testis. In situ hybridization indicated that Rxfp2 is expressed in rat postmeiotic germ cells of the seminiferous tubules but not in adult Leydig cells [15], whereas the RT-PCR and immunohistochemistry showed the Rxfp2 expression in human, rat, and mouse postnatal germ and interstitial somatic cells [14, 16, 17].

The global deletion of Rxfp2 gene in existing conventional mutants and the somewhat conflicting data on tissue and cellular gene expression make it difficult to identify direct targets of INSL3/RXFP2 signaling in the gubernaculum and testis. In adult male mice, INSL3 is strongly expressed in Leydig cells, but its role in spermatogenesis remains unclear. While the absence of INSL3/RXFP2 signaling in mutant mice could contribute to male infertility, the suppression of spermatogenesis in cryptorchid mutants may be in fact the direct result of abnormal testis position and environment. Indeed, orchiopexy, or surgical correction of the cryptorchid testis position, restored spermatogenesis in mutant mice [10, 11, 18]. On the other hand, it was reported that INSL3 suppressed testis germ cell apoptosis induced by gonadotropin-releasing hormone (GnRH) antagonist injections in rats, suggesting a role for this hormone in germ cell survival [15].

In this study we generated two new alleles of Rxfp2 in mice. To map the expression pattern of Rxfp2, we produced a LacZ knock-in allele. The expression of the LacZ reporter was used to identify potential target cells of INSL3/RXFP2 signaling at different stages of prenatal and postnatal development and in adult male reproductive organs. We also produced a floxed allele of Rxfp2 and analyzed the consequences of Rxfp2 deletion in different cells of the gubernacular ligament and in postnatal male germ cells. The results of this study indicate that INSL3/RXFP2 signaling is important for early stages of testicular descent but is dispensable for spermatogenesis and germ cell survival in adult males.

MATERIALS AND METHODS

Production of New Alleles of Rxfp2 and Mouse Breeding

All the animal studies were approved by the Institutional Animal Care and Use Committees at Florida International University. The embryonic stem (ES) cells with a targeted Rxfp2 allele were obtained from the EuCOMM/EuMMCR collection. The recombinant allele contains an frt-flanked LacZ/neo cassette inserted into the third intron and a floxed fourth exon. This allele is therefore a knock-in, null allele of the gene (Rxfp2LacZ) (Fig. 1). Chimeric mice were produced at the University of Miami Transgenic Core Facility, Miami, FL. Confirmation of germ line transmission of the mutant allele was performed by PCR using the genomic DNA isolated from ear pieces with primers specific for LacZ: LacZF, CAGACGATGGTGCAGGATAT, and LacZR, ATACAGCGCGTCGTGAT. Mice with the floxed Rxfp2 allele (Rxfp2fl) were produced by breeding Rxfp2LacZ females with ROSA-FLP (Gt [ROSA] 26Sortm1[FLP1]Dym/RainJ) transgenic mice [19] obtained from The Jackson Laboratory. The PCR primers used for genotyping of Rxfp2fl allele were: FP, CCAAATCAAATATCCATAGGATCAGC, and RP1, TTAGTGGATCCACTGAGCCCTTCC. Excision of the floxed fourth exon resulted in a deleted allele, Rxfp2Δ, which was detected by PCR using primers FP and RP2, TGAACTGATGGCGAGCTCAGACC. The latter combination of primers did not detect wild-type allele.

FIG. 1.

FIG. 1

LacZ knock-in and floxed alleles of Rxfp2. A) Schematic representation of Rfxp2LacZ, Rxfp2fl, and Rxfp2Δ alleles. Exons are shown as solid black bars and marked by a number underneath. SA is a splicing acceptor; IRES is an internal ribosome entry site; b-Gal is a beta-galactosidase gene; pA is a poly (A) signal, beta-actin::Neo is a neomycine resistant gene driven by β-actin promoter; FLP is flp recombinase; and CRE is cre recombinase. Rxfp2fl allele is produced by flp-induced recombination, and the deleted allele is produced by cre-induced recombination as shown. The position of the primers used for genotyping is shown with arrows. B) Detection of Rxfp2fl floxed allele with primers FP/RP1. The floxed allele produced a 551-bp band, and the wild-type allele produced a 461-bp band. C) Detection of Rxfp2Δ deleted allele with FP/RP2 primers. The floxed allele produced a 974-bp band, and the deleted allele produced a 240-bp band. The wild-type allele is not detectable with this primer pair.

Conditional inactivation of Rxfp2 was achieved by crossing Rxfp2fl/fl mice with Cre-transgenic mice and backcrossing to Rxfp2−/− [9] or crsp/crsp (deletion alleles of Rxfp2) [10] female mice. Four different Cre-transgenic strains were used: Rarb-cre (Tg [Rarb-cre]1Bhr) [20], a generous gift from Dr. Richard Behringer (MD Anderson Cancer Center), ACTA1-cre (Tg [ACTA1-cre] 79Jme/J) [21], Tagln-cre (Tg [Tagln-cre] 1Her/J) [22], and Stra8-icre (Tg [Stra8-icre] 1Reb/J) [23], all from The Jackson Laboratory. Animal genotyping was performed with cre primers creF, ATCAACGTTTTCTTTTCGG, and creR, ATTTGCCTGCATTACCGGTC, and the primers for different Rxfp2 alleles and icre described in the original publications.

For fertility testing, individual mutant male mice and control male mice were each mated continuously with two wild-type CD-1 (Charles River) females for 2 mo. The number of litters and the litter sizes were recorded and compared. At least three males of each genotype were used in the analysis. To assess sperm count and motility, sperm was released from the cauda epididymis into M2 medium (Millipore), and the motility and numbers were scored using microscopic observations.

Histology, Immunohistochemistry, and Apoptosis Detection

Adult mouse organs were collected and fixed in 4% paraformaldehyde or Bouin solution, washed with phosphate-buffered saline (PBS), stored in 70% ethanol at 4°C overnight, embedded in paraffin, and sectioned at 6 or 7 μm using standard protocols. Hematoxylin and eosin (H&E) staining was performed for routine analysis of the sections. A TUNEL assay was performed using an ApopTag Plus peroxidase in situ apoptosis detection kit (Millipore). Stained slides were examined with a Carl Zeiss Axio A1 microscope, and images were captured by an AxioCam MRc5 CCD camera. Three animals were used for each genotype, and for each animal testis section, over 200 tubules were counted and the number of apoptotic cells per tubule was used for comparison.

RNA Isolation and cDNA Synthesis and Real-Time QRT-PCR

Total RNA was isolated from mouse testis with Trizol (Invitrogen) according to the manufacturer's protocol. Complementary DNA was synthesized using Verso cDNA kit (Thermo Scientific) according to the manufacturer's protocol. The expression of Rxfp2 gene was evaluated by conventional RT-PCR and real-time QRT-PCR. GoTaq qPCR master mix (Promega) kit was used for real-time QRT-PCR. Primers were designed to span a long intron to avoid amplification from contaminating genomic DNA. The primer sequences are: 1) for β-actin (Actb) gene used in RT-PCR and QRT-PCR: ActbF, CTAAGGCCAACCGTGAAAAG, and ActbR, ACCAGAGGCATACAGGGACA; 2) for Rxfp2 gene used in RT-PCR: mRxfp2ex2F, GTGGGAATCTCACCAAATGC, and mRxfp2ex4R, GTGCTGTGGATACTGGCTGA; and 3) for Rxfp2 gene used in QRT-PCR: mRxfp2ex3F, CCATGGGAATGTCAATAAAGTG, and mRxfp2ex4R, TCTGCAGTAACAGTGCTGTGG. The SybrGreen real-time protocol was run on an Eppendorf Mastercycler ep realplex instrument (Eppendorf). The relative fold change in mRNA level was calculated by the comparative Ct (2−ΔΔCt) method, where the β-actin expression was used for normalization of the SybrGreen data. Student t-test for two group comparisons was used to assess the significance of differences. Differences were expressed as a mean ± SEM; P < 0.05 was considered significant. All the analyses were performed using the GraphPad Software package (GraphPad Software).

X-Gal Staining

Briefly, after fixing for 60 min in 4% formaldehyde in PBS at 4°C, tissues were rinsed for 45 min in 0.02% Nonidet P-40, 2 mM MgCl2, and 0.01% sodium deoxycholate with shaking, and stained with X-gal staining solution (1 mg/ml) at 37°C in a humid chamber overnight [24]. The tissue was then washed with PBS, postfixed overnight in 4% formaldehyde in PBS, and then processed through increasing concentrations of ethanol, dehydrated, and paraffin wax embedded. Seven-micrometer sections were cut and counterstained with eosin.

Propidium Iodide Staining and Flow Cytometry of Mouse Testis Cells

The tunica albuginea was removed from the mouse testis, and decapsulated testes were incubated in Gey balance salt solution (Sigma-Aldrich) containing 0.33 mg/ml collagenase and 3.3 μg/ml DNase (Sigma-Aldrich) for 15 min at 32°C with shaking. The digested tubules were washed twice with PBS and incubated with 1.0 μg/ml trypsin and DNAse in PBS for 15 min at 32°C. Fetal bovine serum was added to stop the digestion and the suspension was mixed by gentle pipetting for 4 min. The cell suspension was filtered through a 100 μm nylon mesh (Fisher Scientific). The filtered single cell suspension was washed twice with PBS, and the cells were counted. After counting, the cells were fixed in 70% ice-cold ethanol and stored at 4°C until flow cytometry analysis. The fixed cells were washed twice in PBS and stained with staining solution containing 25 μg/ml propidium iodide, 40 μg/ml RNase, and 0.3% Tween-20 in PBS at room temperature for 20 min. Later the stained cells were analyzed in an AccuriC6 flow cytometer (Becton-Dickinson Immunocytometry). The fluorescent signals of propidium iodide-stained cells were recorded, and a histogram of DNA intensity versus cell count was used to compare cell populations from different samples. A total of 500  000 events were recorded for each histogram. The relative numbers of cells (1N = haploid, 2N = diploid, 4N = tetraploid, and cells in the S-phase) were calculated using the software of the flow cytometer. Three animals were analyzed for control and mutant groups. Student t-test for two group comparisons was used to assess the significance of the differences. Differences were expressed as a mean ± SEM; P < 0.05 was considered significant. All the analyses were performed using the GraphPad Software package.

RESULTS

Production of Rxfp2LacZ and Rxfp2fl Alleles

To produce the Rxfp2LacZ mouse line, we obtained an ES cell clone with a targeted allele of Rxfp2 from EuCOMM/EuMMCR. The targeting allele contains two FRT sites for flippase recombination. The two FRT sites flank a LacZ gene with an internal ribosome entry site (IRES) and a neomycin resistance (neo) cassette. The target allele also contains three LoxP sites for Cre recombinase on the 5′ and 3′ ends of neo cassette and within intron 4 (Fig. 1A). As the LacZ reporter is transcribed with Rxfp2 mRNA, it faithfully mirrors the expression of the Rxfp2 gene, whereas the expression of endogenous full-length Rxfp2 mRNA is disrupted. Germline transmission of the targeted allele from chimeric males allowed the establishment of the Rxfp2LacZ mutant line. After interbreeding heterozygotes, we obtained homozygous Rxfp2LacZ/Rxfp2LacZ males. We also produced males with the Rxfp2LacZ allele and previously generated Rxfp2− knockout [9] or crsp (complete deletion of Rxfp2 locus) [10] alleles. Males with all three genotypes showed the same high intraabdominal cryptorchidism as Rxfp2−/−, demonstrating the absence of Rxfp2− complementation by Rxfp2LacZ. These results confirmed the loss of function of Rxfp2LacZ allele and the correct targeting of Rxfp2 locus. To produce the Rxfp2fl mice, we bred the Rxfp2LacZ mice with a transgenic mouse line containing a ubiquitously expressed FLP recombinase. In the double mutant mice, the LacZ/neo cassette was removed by flippase-induced recombination in all the tissues including the germ line (Fig. 1A). All the tested progeny of such males had a recombinant Rxfp2fl allele regardless of flippase transgene presence. Males that were homozygous for Rxfp2fl/fl had a normal testis position, indicating that the floxed Rxfp2fl allele was fully functional. Cre-induced recombination of the Rxfp2fl allele led to the deletion of exon 4, a reading frameshift and premature stop codon in Rxfp2Δ allele (Fig. 1).

Rxfp2 Expression in Male Reproductive Tissues

To monitor the Rxfp2 gene expression pattern in male reproductive tissues, we used X-gal staining of tissues obtained from phenotypically wild-type males heterozygous for Rxfp2LacZ allele (Fig. 2). As noted above, the LacZ reporter was driven by the endogenous Rxfp2 promoter as part of Rxfp2 mRNA and was translated through an IRES site. In this study, we focused mainly on the testis and gubernaculum of male mice, the two major sites of Rxfp2 expression. In E17.5 embryos and in newborn males at P1, Rxfp2 was expressed in both the gubernacular cord and the gubernacular bulb (Fig. 2, A and B). In the gubernacular bulb, blue staining was clearly detected in the fibroblast core of the bulb as well as in the muscle cell layer at the rims of this structure (Fig. 2, A2 and B2). No detectable Rxfp2 expression was found at this age in testis. The blue staining was also observed in the stromal and surface epithelial cells of the mutant but not control epididymis (Fig. 2, A2 and B2). In P7 and P14 gubernacula, the overall Rxfp2 expression pattern remained the same (Fig. 2, C1 and C2). At that stage, the gubernacular cord is represented by a small ligament with strong blue staining. It connects developing cremaster muscles with the cauda epididymis. No Rxfp2 expression was detected by LacZ staining in testis (data not shown). In P21, P30, and adult males, no expression of Rxfp2 was found in differentiated cremaster muscle. However, blue staining was still observed in the mesenchymal fibroblast-like cells located between muscle cells of cremasteric sac (Fig. 2, C3–C5) and in epithelial cells surrounding the sac. In testis of P21, P30, and adult males, we detected Rxfp2 expression in postmeiotic spermatogenic cells, but not in the basal layer of spermatogonial or spermatocyte cells, somatic Sertoli, or peritubular myoid cells of testicular seminiferous tubules (Fig. 2, D2, E2, and F2). Strong expression of the endogenous β-galactosidase gene in adult Leydig cells (Fig. 2F1) and the epithelial cells of epididymis (data not shown) from P14 prevented detailed analysis of Rxfp2 expression in these cells at later stages of development.

FIG. 2.

FIG. 2

Rxfp2 expression in the gubernaculum and testis. The representative images of X-gal staining of Rfxp2LacZ/+ male reproductive organs. Blue staining indicates gene expression. A–C) Rxfp2 expression in gubernaculum of pre- and postnatal mice. A) E17.5 control (image no. 1) and mutant (2). B) P1 control (1) and mutant (2). C) Cremasteric sacs of mutants at P7 (1), P14 (2), P21 (3), P30 (4), and P60 (5). D–F) Rxfp2 expression in postnatal testes. D) P21 control (1) and mutant (2). E) P30 control (1) and mutant (2). F) P60 control (1) and mutant (2). Bars = 100 μm. The positive staining is labeled by arrows or arrowheads (in epididymis in A2 and B2). Endogenous expression of β-Gal in adult Leydig cells is indicated by arrowhead in F1. e, epididymis; t, testis; gc, gubernacular cord; gb, gubernacular bulb; cm, cremaster muscle.

Conditional Knockout of Rxfp2 in Gubernacular Embryonic Mesenchymal but Not in Striated or Smooth Muscle Cells Causes Cryptorchidism

To analyze the target cell population of INSL3/RXFP2 signaling in the gubernaculum and the significance of Rxfp2 expression in different cellular components of this organ for testicular descent, we produced three different groups of males with a conditional ablation of Rxfp2. All such males had one floxed Rxfp2fl allele, one Rxfp2− allele, and the tissue-specific Cre transgene. The Rxfp2fl/Rxfp2− males without the Cre transgene from the same crosses were used as controls. The first Cre transgene, Rarb-cre, was previously shown to be expressed in metanephric mesenchyme and its derivatives, including gubernaculum [20, 25, 26]. Conditional ablation of Rxfp2 before or at early stages of gubernacular formation using Rarb-cre led to cryptorchidism with adult testes located in a high intraabdominal position below the kidney (Fig. 3A). Next, we produced mice with conditional ablation of Rxfp2 in striated or smooth muscle cells of the gubernaculum (Fig. 3, B and C). Both ACTA1-cre (striated muscle-specific Cre expression) and Tagln-cre (smooth muscle-specific Cre expression) transgenes were expressed in adult cremaster muscle as detected by RT-PCR (Fig. 3D). As shown in Figure 3E, the analysis of genomic DNA isolated from adult cremasteric sac of both Rxfp2fl/Rxfp2−, ACTA1-cre and Rxfp2fl/Rxfp2−, Tagln-cre revealed the presence of recombinant Rxfp2Δ allele. In the striated muscle-specific knockout, the upper amplicon—corresponding to a floxed nonrecombined allele—was not detected, suggesting that the majority of cells in cremaster muscle are striated muscle cells. Because the smooth muscle cells represent only a fraction of the adult cremasteric sac, both small (Rxfp2Δ) and big (Rxfp2fl) fragments were detected in DNA isolated from Rxfp2fl/Rxfp2−, Tagln-cre males. Despite successful targeting of the Rxfp2 gene in striated and smooth muscle cells, both mutants had a normal testis position (Fig. 3, B and C) and well-developed cremaster muscle (data not shown). The testes were located inside the scrotum of these mice, just as in wild-type control males of the same age (Fig. 3, B and C). The QRT-PCR of the total testis RNA isolated from three to five mutant and control 30-day-old males showed no difference in Rxfp2 gene expression between the two groups (data not shown). The latter result was expected because of the Rxfp2 gene silencing in adult muscle cells.

FIG. 3.

FIG. 3

Conditional knockout of Rxfp2 in embryonic gubernaculum and in gubernacular striated or smooth muscle cells. A–C) Testicular position in adult mice with conditional knockout of Rxfp2 in gubernaculum using the Rarb-cre transgene, in striated muscle cells (ACTA1-cre), or smooth muscle cells (Tagln-cre). The white arrow points to the testis position in the upper row, and the black arrow points to the scrotum in the lower row. Note the high intraabdominal testis position in Rxfp2fl/Rxfp2−, Rarb-cre mutant, but normal scrotal position in the other mutants. D) RT-PCR analysis of cre expression in cremaster muscles in mice with ACTA1-cre and Tagln-cre. The Actb gene expression was used as a positive loading control. E) PCR analysis of genomic DNA isolated from adult cremasteric sac of control Rxfp2fl/Rxfp2−; ACTA1-cre, Rxfp2fl/Rxfp2−; and Tagln-cre, Rxfp2fl/Rxfp2− mice. The lower band corresponds to the deleted allele, and the higher band is the floxed allele as indicated in Figure 1.

Conditional Knockout of Rxfp2 Gene in Germ Cells

The strong Rxfp2 expression in postmeotic germ cells described above suggested a possible role of INSL3/RXFP2 signaling in spermatogenesis and male fertility in mice. To study the effect of the Rxfp2 gene ablation in a normally positioned scrotal testis, we produced germ cell-specific Rxfp2 conditional knockout mice using a Stra8-icre transgene. The Cre expression in this transgenic mice is specific for postnatal germ cells and first detected in premeiotic cells [23]. The mutant Rxfp2fl/Rxfp2fl, Stra8-icre males showed no visible reproductive organ or behavioral abnormalities. Testicular histology was the same in mutants and controls suggesting normal spermatogenesis (Fig. 4A). There were no differences in epididymis, seminal vesicle, and testis weights (Fig. 4, B–D), sperm count (Fig. 4E), and sperm motility (data not shown) between mutant and control males. The fertility testing found no difference in fecundity, with identical litter size (Fig. 4F) and number of litters in the progeny of mutant and control males. PCR analysis of testis genomic DNA PCR confirmed the presence of the Rxfp2Δ allele (Fig. 4G). Genetic testing of the mutant males progeny indicated the presence of Rxfp2Δ allele in all the pups regardless of the presence of Rarb-cre transgene in their genotype (Fig. 4G). QRT-PCR of testis RNA indicated a dramatic decrease in the level of Rxfp2 gene expression in mutant testis versus control (Fig. 4H). Conventional RT-PCR of the total RNA isolated from the mutant testis failed to detect the Rxfp2 expression. The results confirmed that the Cre-induced recombination in germ cells was very efficient and that in postnatal adult testis the Rxfp2 gene is expressed only in germ cells. DNA staining and fluorescence-activated cell sorting (FACS) was performed to analyze quantitatively the possible changes in different germ cells during spermatogenesis in mutant testis. The FACS histogram suggested that the germ cell populations of haploid, diploid, S-phase, and tetraploid cells were not different both in ratio and numbers between control and mutant mice (Fig. 5). Finally, we conducted a TUNEL assay for analysis of cell apoptosis in seminiferous tubules to study the possible role of INSL3/RXFP2 signaling in germ cell survival. The results indicated no significant difference in germ cell apoptosis between control and mutant mice under normal conditions (Fig. 6).

FIG. 4.

FIG. 4

Normal phenotype of mice with conditional deletion of Rxfp2 in male germ cells. A–F) Comparisons of spermatogenesis (H&E staining), epididymis weight, seminal vesicle weight, testis weight, sperm count, and the litter size in 4-mo-old control and Rxfp2fl/Rxfp2fl, Stra8-icre mutant males. Bar in A = 100 μm. No differences were detected between the two groups. G) Analysis of genomic DNA isolated from the testis of Rxfp2fl/Rxfp2fl, Stra8-icre male (P) and from the ear genomic DNA of his F1 progeny. A band corresponding to a deleted allele was detected in all the samples, indicating efficient recombination in mutant germ cells. M, 1-kb marker; - indicates a negative control. H) QRT-PCR and conventional RT-PCR (image below) analysis of Rxfp2 expression in adult control and mutant testes. No Rxfp2 expression was detected in mutant testis. Data are shown as mean ± SEM. The analysis of Actb expression was used as a positive control.

FIG. 5.

FIG. 5

Flow cytometry analysis of testis from males with germ cell-specific inactivation of Rxfp2. A) Flow cytometry histograms of the control and mutant testis. The y axis is the cell count, and the x axis represents the DNA intensity. Testis cells have three cell populations distinguished by DNA intensity: 1N (haploid), 2N (diploid), and S (S-phase) plus 4N (quadriploid). A representative image of one of three males analyzed in each group is presented. B) Quantitative analysis of different germ cell populations in the control and mutant testis. No statistically significant differences were detected. Data are shown as mean ± SEM.

FIG. 6.

FIG. 6

Analysis of germ cell apoptosis in males with germ cell-specific inactivation of Rxfp2. A) Representative images of control and mutant testis TUNEL analysis. Apoptotic cells are indicated by black arrows. Bar = 100 μm. B) Apoptotic cell number per seminiferous tubule was used for comparison between control and mutant groups. The difference is not statistically significant. Data are shown as mean ± SEM.

DISCUSSION

The role of INSL3/RXFP2 signaling in testicular descent was first recognized based on the cryptorchid phenotype of mutant mice with Insl3 or Rxfp2 ablation [9–12]. It was shown that the gubernaculum, the inguinoscrotal ligament connecting the epididymis with the caudal abdominal wall, was a primary target of INSL3/RXFP2 signaling; in the mutant males this structure failed to differentiate. It was suggested that INSL3/RXFP2 signaling might induce myogenic differentiation of gubernacular mesenchymal cells leading to the formation of cremaster muscle [26]. Interestingly, while the INSL3 peptide is highly expressed in both fetal and adult Leydig cells, its role in postnatal reproductive organs is not quite clear. In this report, we describe the generation of two new alleles of Rxfp2. The first, with the knock-in LacZ reporter, was used to examine which cells express Rxfp2 at different stages of reproductive organs development. Using the floxed allele of Rxfp2, we have shown that while conditional deletion of the gene in metanephric mesenchyme, the gubernaculum anlage, caused cryptorchidism, the Rxfp2 ablation in differentiated muscle cells did not affect testicular descent. Surprisingly, despite strong expression of Rxfp2 in postmeiotic germ cells, conditional inactivation of the gene in germ cells had no effect on spermatogenesis, germ cell survival, and male fertility.

Previously, Rxfp2 expression in male reproductive organs was studied using an array of methods. The different approaches led, however, to somewhat different results and conclusions. In situ hybridization showed a specific expression in the mouse gubernacular ligament and perhaps in at least parts of the Wolffian duct derivatives at E14.5 [8]. The RT-PCR data and the use of transgenic Rxfp2-cre mice, where Cre expression was driven by the partial Rxfp2 promoter, suggested a wider gene expression at prenatal stages including testis [14]. However, the available RXFP2 antibodies failed to detect protein expression during embryonic development [14]. On the other hand, a strong reactivity to the RXFP2 antibodies was detected in the cremaster muscle and in the testicular interstitial compartment in addition to the germ cells [14, 16, 17].

The use of a reporter LacZ knock-in allele enables the direct visualization of endogenous gene expression. Our data confirmed an early and ubiquitous expression of Rxfp2 in mesenchymal cells of the embryonic gubernaculum, but we did not detect any reporter activity in adult cremaster muscle cells. In adults, the Rxfp2 gene was expressed in nondifferentiated interstitial cells located between muscle layers and in epithelial cells lining the cremasteric sac. One possibility is that the interstitial cells represent a stem cell population supplying new myoblasts. Indeed, we have previously shown a strong LacZ expression in adult cremaster muscle cells in mice with Rxfp2-cre and ROSA26 reporter [14]. Because Rxfp2 is not expressed in adult muscle cells, this suggests that the progenitor cells, marked by the Rxfp2-cre-activated ROSA26 allele, differentiated into the muscle cells. We have previously shown that in mice with a partial suppression of Rxfp2 gene expression the cremaster muscle was poorly differentiated [26]. This suggests that the INSL3/RXFP2 signaling might provide some stimuli for myogenic differentiation of mesenchymal cells. Indeed, as we have demonstrated here, the early conditional deletion of Rxfp2 caused by Rarb-cre transgene completely disrupted gubernaculum differentiation. While the Rarb-cre expression is not limited to gubernaculum, it is strongly expressed there [20, 25, 26]. On the other hand, the inactivation of Rxfp2 in smooth or striated muscle cells had no effect on testicular descent. No visible changes in cremaster muscle development were detected. In our experiments, we used Cre transgenes driven by promoters of early markers of striated or smooth muscle cells, ACTA1 and TANGL. Although the exact cell type where the ablation of the gene occurred was not defined in our experiments, both transgenes were expressed in cremaster muscle leading to the recombination of floxed allele. Thus, while Rxfp2 expression might be important for initiation of myogenic differentiation pathway, the muscle-specific ablation of INSL3/RXFP2 signaling appears to be not required for normal testicular descent.

In the adult testis, we detected strong Rxfp2 expression in postmeiotic germ cells, confirming previously published data [14–17]. Indeed, the expression of the knock-in LacZ reporter was first detected in P21 testis, when the first wave of spermatogenesis reached the postmeiotic stage. It was suggested that INSL3/RXFP2 signaling had a prosurvival effect on germ cells, as the cotreatment of male rats with a GnRH antagonist and INSL3 reduced germ cell apoptosis compared to the treatment with GnRH antagonist alone [15]. The INSL3/RXFP2 signaling, however, appears to be not essential for spermatogenesis because the surgical correction of cryptorchid testes in Rxfp2- or Insl3-deficient mice rescued spermatogenesis [10, 11, 18]. To directly investigate the role of Rxfp2 deficiency in testis, we used a Stra8-icre transgene to target germ cells in fully descended testes. Conditional inactivation of the Rxfp2 gene was highly efficient as was demonstrated by the presence of only deleted, but not floxed, alleles in the progeny of mutant males. Absence of the Rxfp2 gene expression in mutant testes pinpoints germ cells as the source of Rxfp2 in male gonads. Germ cell Rxfp2 deficiency had no effect on fertility, reproductive organ weights, spermatogenesis, sperm count, motility, or germ cell survival in the mutant testis. Thus, our data indicate that under normal conditions, INSL3/RXFP2 signaling has no effect on germ cell differentiation and development in adult testis. It is possible, however, that INSL3/RXFP2 signaling still might be required for germ cell survival under GnRH antagonist treatment or some other assaults, such as the use of antiandrogens or testicular heat, or even during the establishment of spermatogenesis in puberty. It is also possible that INSL3 may be used as germ cell antiapoptotic treatment at high pharmacological doses. The availability of previously designed conventional and now conditional mutants of Rxfp2 will allow for the further investigation of these questions.

In conclusion, we produced the first LacZ knock-in reporter and floxed Rxfp2 alleles in mice. Analysis of gene expression combined with the conditional targeting of Rxfp2 in gubernacular cell populations and in testicular germ cells demonstrated the importance of INSL3/RXFP2 signaling in testicular descent. Germ-cell deletion of Rxfp2 did not affect spermatogenesis, germ cell survival, or male fertility in adult mice.

ACKNOWLEDGMENT

We thank Dr. Richard Behringer (University of Texas MD Anderson Cancer Center, Houston, Texas) for the Rarb-cre mice and the University of Miami Transgenic Core for help with the transgenic mouse production. We also thank Dr. Lydia Ferguson for her comments and Asiel Roque, Rachel Freidin, and Carolina Lopez for help with animal maintenance and technical assistance.

Footnotes

1

Supported by the Eunice Kennedy Shriver National Institute of Child Health & Human Development grant R01HD37067.

REFERENCES

  1. Hutson JM, Balic A, Nation T, Southwell B. Cryptorchidism. Semin Pediatr Surg 2010; 19: 215 224. [DOI] [PubMed] [Google Scholar]
  2. Barteczko KJ, Jacob MI. The testicular descent in human. Origin, development and fate of the gubernaculum Hunteri, processus vaginalis peritonei, and gonadal ligaments. Adv Anat Embryol Cell Biol 2000; 156 (III–X): 1 98. [PubMed] [Google Scholar]
  3. Hutson JM. A biphasic model for the hormonal control of testicular descent. Lancet 1985; 2: 419 421. [DOI] [PubMed] [Google Scholar]
  4. van der Schoot P. Towards a rational terminology in the study of the gubernaculum testis: arguments in support of the notion that the cremasteric sac should be considered the gubernaculum in postnatal rats and other mammals. J Anat 1996; 189 (Pt 1): 97 108. [PMC free article] [PubMed] [Google Scholar]
  5. Adham IM, Agoulnik AI. Insulin-like 3 signalling in testicular descent. Int J Androl 2004; 27: 257 265. [DOI] [PubMed] [Google Scholar]
  6. Bogatcheva NV, Agoulnik AI. INSL3/LGR8 role in testicular descent and cryptorchidism. Reprod Biomed Online 2005; 10: 49 54. [DOI] [PubMed] [Google Scholar]
  7. Zimmermann S, Schottler P, Engel W, Adham IM. Mouse Leydig insulin-like (Ley I-L) gene: structure and expression during testis and ovary development. Mol Reprod Dev 1997; 47: 30 38. [DOI] [PubMed] [Google Scholar]
  8. Agoulnik AI. Mouse mutants of relaxin, insulin-like 3 peptide and their receptors. Curr Med Chem Immunol Endocr Metab Agents 2005; 5: 411 419. [Google Scholar]
  9. Gorlov IP, Kamat A, Bogatcheva NV, Jones E, Lamb DJ, Truong A, Bishop CE, McElreavey K, Agoulnik AI. Mutations of the GREAT gene cause cryptorchidism. Hum Mol Genet 2002; 11: 2309 2318. [DOI] [PubMed] [Google Scholar]
  10. Overbeek PA, Gorlov IP, Sutherland RW, Houston JB, Harrison WR, Boettger-Tong HL, Bishop CE, Agoulnik AI. A transgenic insertion causing cryptorchidism in mice. Genesis 2001; 30: 26 35. [DOI] [PubMed] [Google Scholar]
  11. Zimmermann S, Steding G, Emmen JM, Brinkmann AO, Nayernia K, Holstein AF, Engel W, Adham IM. Targeted disruption of the Insl3 gene causes bilateral cryptorchidism. Mol Endocrinol 1999; 13: 681 691. [DOI] [PubMed] [Google Scholar]
  12. Nef S, Parada LF. Cryptorchidism in mice mutant for Insl3. Nat Genet 1999; 22: 295 299. [DOI] [PubMed] [Google Scholar]
  13. Adham IM, Steding G, Thamm T, Bullesbach EE, Schwabe C, Paprotta I, Engel W. The overexpression of the insl3 in female mice causes descent of the ovaries. Mol Endocrinol 2002; 16: 244 252. [DOI] [PubMed] [Google Scholar]
  14. Feng S, Bogatcheva NV, Truong A, Korchin B, Bishop CE, Klonisch T, Agoulnik IU, Agoulnik AI. Developmental expression and gene regulation of insulin-like 3 receptor RXFP2 in mouse male reproductive organs. Biol Reprod 2007; 77: 671 680. [DOI] [PubMed] [Google Scholar]
  15. Kawamura K, Kumagai J, Sudo S, Chun SY, Pisarska M, Morita H, Toppari J, Fu P, Wade JD, Bathgate RA, Hsueh AJ. Paracrine regulation of mammalian oocyte maturation and male germ cell survival. Proc Natl Acad Sci U S A 2004; 101: 7323 7328. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Filonzi M, Cardoso LC, Pimenta MT, Queiroz DB, Avellar MC, Porto CS, Lazari MF. Relaxin family peptide receptors Rxfp1 and Rxfp2: mapping of the mRNA and protein distribution in the reproductive tract of the male rat. Reprod Biol Endocrinol 2007; 5: 29. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Anand-Ivell RJ, Relan V, Balvers M, Coiffec-Dorval I, Fritsch M, Bathgate RA, Ivell R. Expression of the insulin-like peptide 3 (INSL3) hormone-receptor (LGR8) system in the testis. Biol Reprod 2006; 74: 945 953. [DOI] [PubMed] [Google Scholar]
  18. Nguyen MT, Showalter PR, Timmons CF, Nef S, Parada LF, Baker LA. Effects of orchiopexy on congenitally cryptorchid insulin-3 knockout mice. J Urol 2002; 168: 1779 1783; discussion, 1783. [DOI] [PubMed] [Google Scholar]
  19. Farley FW, Soriano P, Steffen LS, Dymecki SM. Widespread recombinase expression using FLPeR (flipper) mice. Genesis 2000; 28: 106 110. [PubMed] [Google Scholar]
  20. Kobayashi A, Kwan KM, Carroll TJ, McMahon AP, Mendelsohn CL, Behringer RR. Distinct and sequential tissue-specific activities of the LIM-class homeobox gene Lim1 for tubular morphogenesis during kidney development. Development 2005; 132: 2809 2823. [DOI] [PubMed] [Google Scholar]
  21. Miniou P, Tiziano D, Frugier T, Roblot N, Le Meur M, Melki J. Gene targeting restricted to mouse striated muscle lineage. Nucleic Acids Res 1999; 27: e27. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Holtwick R, Gotthardt M, Skryabin B, Steinmetz M, Potthast R, Zetsche B, Hammer RE, Herz J, Kuhn M. Smooth muscle-selective deletion of guanylyl cyclase-A prevents the acute but not chronic effects of ANP on blood pressure. Proc Natl Acad Sci U S A 2002; 99: 7142 7147. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Sadate-Ngatchou PI, Payne CJ, Dearth AT, Braun RE. Cre recombinase activity specific to postnatal, premeiotic male germ cells in transgenic mice. Genesis 2008; 46: 738 742. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Kamat AA, Feng S, Bogatcheva NV, Truong A, Bishop CE, Agoulnik AI. Genetic targeting of relaxin and insulin-like factor 3 receptors in mice. Endocrinology 2004; 145: 4712 4720. [DOI] [PubMed] [Google Scholar]
  25. Kaftanovskaya EM, Huang Z, Barbara AM, De Gendt K, Verhoeven G, Gorlov IP, Agoulnik AI. Cryptorchidism in mice with an androgen receptor ablation in gubernaculum testis. Mol Endocrinol 2012; 26: 598 607. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Kaftanovskaya EM, Feng S, Huang Z, Tan Y, Barbara AM, Kaur S, Truong A, Gorlov IP, Agoulnik AI. Suppression of insulin-like3 receptor reveals the role of beta-catenin and Notch signaling in gubernaculum development. Mol Endocrinol 2011; 25: 170 183. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Biology of Reproduction are provided here courtesy of Oxford University Press

RESOURCES