Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2015 May 18.
Published in final edited form as: Oral Microbiol Immunol. 2008 Dec;23(6):474–481. doi: 10.1111/j.1399-302X.2008.00452.x

Treponema denticola Does Not Induce Production of Common Innate Immune Mediators from Primary Gingival Epithelial Cells

Catherine A Brissette 1,2,*, Thu-Thao T Pham 2,3, Steven R Coats 2,3, Richard P Darveau 2,3, Sheila A Lukehart 1,2,4
PMCID: PMC4435560  NIHMSID: NIHMS688973  PMID: 18954353

Abstract

It has been hypothesized that the neutrophil chemoattractant IL-8 forms a gradient in the oral cavity, with the highest concentration of IL-8 produced closest to the bacterial biofilm. In periodontitis, this gradient is disrupted, impairing neutrophil chemotaxis to diseased sites. Treponema denticola is prominently associated with periodontal disease, yet little is known about its ability to modulate production of inflammatory mediators by epithelial cells. Others have shown that dentilisin, the major outer membrane protease of T. denticola, degrades IL-8 in vitro. We now provide evidence that T. denticola also fails to induce IL-8 production from primary gingival epithelial cells (PGEC). The lack of IL-8 production is not explained by IL-8 degradation, as a protease mutant that does not degrade IL-8 also does not induce IL-8 production by these stimuli. The lack of innate immune mediator production may be a more global phenomenon, as T. denticola fails to induce IL-6 or ICAM-1 production from PGEC. T. denticola also fails to induce transcription of IL-8 and hβD-2 mRNA. The lack of immune mediator production is not explained by failure of T. denticola to interact with TLR-2, as T. denticola stimulates NFκB nuclear translocation in TLR-2 transfected HEK293 cells. Not only can T. denticola degrade IL-8 present in the periodontal lesion, but this organism also fails to induce of IL-8 protein by PGEC. The lack of epithelial cell response to T. denticola may contribute to the pathogenesis of periodontitis by failing to trigger chemotaxis of neutrophils into the periodontal pocket.

INTRODUCTION

Periodontal disease is remarkably widespread, afflicting 50% of adults in the United States (36, 49), with severe disease affecting 6 million Americans. The ability of PGEC to respond to microorganisms is crucial, as homeostasis of the epithelial barrier depends on low-level inflammation. Epithelial cells can be major participants in the innate immune response to microorganisms. In addition to serving as an initial barrier to infection, epithelial cells produce chemical mediators that recruit phagocytes and antigen presenting cells to sites of bacterial attachment. Primary gingival epithelial cells (PGEC) express pattern recognition receptors such as Toll-like receptor 2 (TLR-2), display cell adhesion proteins on their surface, secrete chemokines, and produce antibacterial peptides (27, 28, 31). PGEC are known to upregulate mRNA and protein for several of these innate immune mediators in response to bacterial components (27, 28). Live oral bacteria such as Fusobacterium nucleatum induce production of these mediators, including interleukin-8 (IL-8), intercellular adhesion molecule-1 (ICAM-1), and β-defensins by PGEC (8, 18, 22).

Many oral bacteria, commensals and pathogens alike, induce IL-8 by PGEC (18, 22, 28). Three organisms (Porphyromonas gingivalis, Bacteriodes forsythus, [now Tannerella forsythia] (37, 48) and Treponema denticola) have been identified as the “red complex” of bacteria that are highly associated with severe periodontal disease (51). The chronic nature of periodontitis dictates that these bacteria must have well-developed mechanisms for evading or impeding the host’s innate immune response. Indeed, P. gingivalis degrades IL-8 protein, fails to induce IL-8 transcription by epithelial cells and decreases the amount of IL-8 produced by these cells in response to other stimuli (11, 23) a phenomenon called local chemokine paralysis (11).

Many bacterial species have evolved strategies to evade host innate immune defenses, including the ability to inhibit cytokine production, evasion of complement, and modified outer surface molecules such as LPS that are poorly recognized by Toll-like receptors (TLRs) (9, 15, 26, 56). In this work, we demonstrate that T. denticola is such a pathogen, in that it does not induce IL-8 production by the epithelial barrier.

Spirochetal lipoproteins from T. pallidum subsp. pallidum, and Borrelia burgdorferi readily activate macrophages to produce IL-8 and other cytokines (32, 50). The major outer surface protein of oral treponemes T. maltophilum and T. lecithinolyticum upregulates ICAM-1 and proinflammatory cytokine production in monocytic cells (29). T. denticola also activates macrophages, but little is known about the effects of T. denticola on gingival epithelial cells, with respect to cytokine or antimicrobial peptide production (46). Published studies indicate that gingival fibroblasts and an oral epithelial cell line fail to respond to T. denticola by producing IL-8 protein (13, 41). Another study demonstrated T. denticola induction of IL-8 mRNA and NFκB activation in a different oral epithelial cell line (2). To more closely mimic the in vivo situation, we examined the effects of T. denticola on IL-8 production in low passage primary gingival epithelial cells. In this paper, we demonstrate that T. denticola fails to induce IL-8, IL-6, or ICAM-1 protein from PGEC. In addition, T. denticola also does not induce transcription of IL-8 and hβD-2. This lack of responsiveness is not limited to PGEC, as human umbilical vein endothelial cells (HUVEC) also fail to produce IL-8 protein in response to T. denticola. These data suggest that T. denticola is a pathogen able to exist in the periodontal pocket without triggering a response from epithelial and endothelial cells.

MATERIALS AND METHODS

Bacterial strains and culture

T. denticola strains 35404, 33520, 33521 and GM-1 were a gift from Pamela Braham (University of Washington, Seattle, WA). Strain K1 (dentilisin mutant) and its 35405 parent were a gift from Kazuyuki Ishihara (Tokyo Dental College, Chiba, Japan) (24). T. denticola was maintained in GM-1 medium (4) in an anaerobic jar at 37°C. K1 cultures were supplemented with 40 μg/ml erythromycin (Sigma Chemicals, St. Louis, MO).

Tissue culture

Primary gingival epithelial cells (PGEC) were provided by the Comprehensive Center for Oral Health Research (University of Washington; Director, Beverly Dale). Cells were isolated from excess tissue from retromolar extractions of consenting healthy adult donors, as approved by University of Washington Human Subjects Division (42). Epithelial cells from at least 10 individuals were used for these studies. Pooled primary normal human dermal epithelial keratinocytes (NHEK) were obtained from Cambrex, Walkersville, MD. All epithelial cells were maintained in keratinocyte basal medium (KBM) supplemented with Bronchial Epithelium Growth Supplements (BEGM) and 0.03mM Ca2+ (Cambrex), and cells were used between passages 3–6. Human umbilical vein endothelial cells (HUVEC) were obtained from Clonetics (San Diego, CA) and cultured as previously described (9). Peripheral blood mononuclear cells (PBMC) were isolated from a consenting normal donor. Briefly, 50 ml of whole blood was drawn into a syringe containing 5,000 units of heparin and leukocytes isolated by Ficoll gradient centrifugation according to manufacturer’s instructions (GE Health Care, Piscataway, NJ). Cells were cultured in complete RPMI-1640 (Invitrogen, Carlsbad, CA) + heat inactivated, pooled AB human serum (Sigma Chemicals) and stimulated 48 hours later as described below for PGEC.

Cell wall preparation

F. nucleatum ATCC 25586 was purchased from ATCC. Frozen stocks were streaked on blood agar and grown anaerobically for 5–7 days at 37°C. F. nucleatum was transferred to liquid culture (Mycoplasma Broth Base, supplemented with 1 mg/ml menadione and 5 mg/ml hemin) for cell wall preparation. Log phase organisms were collected by centrifugation at 4°C at 10,000 × g for 20 minutes. Pellets were washed once and resuspended in phosphate buffered saline (PBS). Cells were disrupted by passage 3× through a French pressure cell at 1000 psi. The cell walls were centrifuged and washed to remove debris. Protein concentration was determined by bicinchoninic acid assay (Pierce, Rockford, IL). T. denticola cell walls were prepared as follows. Log phase organisms were collected by centrifugation at 4°C, 10,000 × g for 20 minutes. Pellets were washed once and resuspended in phosphate buffered saline (PBS). Organisms were sonicated on ice 6×, 1 minute each, or until no intact treponemes were visible by darkfield microscopy. Sonicated material was collected by centrifugation at 4°C, 10,000 × g for 20 minutes; supernatant was then centrifuged at 4°C, 40,000 × g for 60 minutes and the pellet resuspended in PBS. Protein concentration was determined as for F. nucleatum cell walls.

Stimulation of PGEC

Cells at passage 3–6 were plated in 96 well plates (100 μl of 1 × 105 cells/ml) or 24 well plates (250 μl of 3 × 105 cells/ml) or 6 well plates (1 ml of 5 × 105 cells/ml) and incubated overnight at 37°C, 5% CO2. Cells were washed once with Hank’s balanced salt solution, and medium replaced with antibiotic-free KBM + BEGM supplements plus 1% normal human serum. Four-day log phase cultures of T. denticola (various strains) were pelleted at 10,000 × g for 10 minutes, 20°C, and washed once in PBS. To determine the optimal MOI of T. denticola to PGEC, dose responses were performed; an MOI of 100:1 was optimal (1000:1 resulted in PGEC toxicity; data not shown). FNCW protein (described above) or the synthetic lipopeptide (S)-(2,3-bis(palmitoyloxy)-(2RS)-propyl)-N-palmitoyl-(R)-Cys-(S)-Ser(S)-Lys4-OH, trihydrochloride (PAM; EMD Biosciences, San Diego, CA) was added at a final concentration of 10 μg per ml (lower concentrations of FNCW or PAM failed to induce IL-8 production from PGEC; data not shown). Cells were stimulated for 2–24 hours; 4 hours was determined to be optimal for collection of chemokine RNA, while 24 hours of stimulation was optimal for IL-8 protein detection (data not shown). Supernatants were removed and stored in low-binding polypropylene plates at −20°C for later analysis by ELISA. The proteolytic capability of T. denticola cells was assessed by monitoring degradation of recombinant IL-8 protein (R&D Systems, Minneapolis, MN) by ELISA. Dentilisin activity was confirmed by examining T. denticola-induced cleavage of a chromogenic target of chymotrypsin-like activity, succinyl-ala-ala-pro-phe-p-nitroanilide (SAAPFNA, Sigma Chemicals) (10, 12). The viability of treated epithelial cells was confirmed by trypan blue dye exclusion or Alamar Blue (Invitrogen) assay for metabolic activity (14).

Stimulation of HUVEC

Culture plates were coated with 50 μg/ml rat tail collagen in 1 N acetic acid (Becton Dickinson, Franklin Lakes, NJ) for 1 hour and then washed 3 × with PBS. Cells at passage 3–6 were plated in 96 well plates (100 μl of 1 × 105 cells/ml) or 24 well plates (250 μl of 3 × 105 cells/ml) and incubated overnight at 37°C, 5% CO2 before treatment as described above for PGEC.

ELISA

IL-8 was detected using a standard capture ELISA assay (11). Briefly, 96 well Maxisorp plates (Nunc, Rochester, NY) were coated overnight at 4°C with 1 μg/ml monoclonal anti-human IL-8 (Pierce). Plates were blocked with 2% bovine serum albumin for 1 hour at RT, and then washed 1× with PBS + 0.05% Tween 20. After addition of test supernatants, a second monoclonal biotinylated anti-human IL-8 (0.5 μg/ml; Pierce) was added, followed by incubation at RT for 2 hours with shaking. Plates were washed 3 × with PBS + 0.05% Tween 20. Following incubation with strepavidin-conjugated horseradish peroxidase (Vectastain, Vector Laboratories, Burlingame, CA) for 1 hour at 37°C, plates were washed and IL-8 was indirectly detected after 3,3,5′5-tetramethylbenzidine (TMB) substrate (Sigma Chemicals). Concentration was determined by comparison to a standard curve (range: 2000 pg/ml to 31.3 pg/ml). IL-6 was detected using a capture ELISA kit (R&D Systems) according to the manufacturer’s instructions. ICAM was detected using a capture ELISA modified from (9). Briefly, stimulated PGEC (24 hours) were fixed with 0.5% gluteraldehyde for 1 hour at RT and blocked with PBS, 0.02M EDTA, and 3% goat serum for an additional hour. Monoclonal anti-human ICAM-1 (R&D Systems) was added at 0.25 μg/ml, and plates incubated with shaking for 1 hour at RT. Following washes (3 × with PBS + 0.05% Tween 20), ICAM-1 was detected indirectly after addition of anti-mouse IgG-horseradish peroxidase for 1 hour at 37°C (Jackson Immunochemicals, West Grove, PA) and TMB substrate as described above for the IL-8 ELISA.

Isolation and detection of PGEC mRNA

PGEC were incubated with a 100:1 multiplicity of infection (MOI) of intact T. denticola type strain 35404, FNCW (10 μg/ml protein), PAM (10 μg/ml protein), or no stimulus. PGEC were washed with Hank’s balanced salt solution and collected in Ultraspec at 4 hours (Biotecx Laboratories, Houston, TX) for RNA isolation by the phenol/chloroform method (7). DNAse-treated RNA was reverse transcribed into cDNA using Superscript First-Strand Synthesis System for RT-PCR (Invitrogen). Constitutively transcribed hypoxanthine phosphoribosyltransferase (HPRT) message was used as a positive control for PCR. The primers used for amplification of HPRT, IL-8 and hβD-2 cDNA from stimulated and control cells were synthesized by Oligos, Etc. (Wilsonville, OR). IL-8 primers: sense: 5′ CTCTCTTGGCAGCCTTCCT; antisense: 5′ TGAATTCTCAGCCCTCTTCAA; HPRT primers: sense: 5′ CCCTGCTGGATTACATCAAAG; antisense: 5′ CGTCCAACACTTCGTGGGGTCCT; hβD-2 primers: sense: 5′ TCAGCCATGAGGGTCTTGTA; antisense: 5′ CTGATGAGGGAGCCCTTTCT Real-time PCR was performed in a total volume of 20 μl in LightCycler (Roche, Indianapolis, IN) glass capillaries. For the PCR, 5 μl of cDNA were placed into a 20-μl reaction volume containing 5 μl of the sense primer (4 μM), 5 μl of the antisense primer (4 μM), 2.0 μl of the LightCycler Fast Start DNA Master Reaction Mix (10 × concentration of FastStart Taq DNA polymerase, reaction buffer, dNTP mix, SYBR Green I dye, and 10mM MgCl2), 0.2 μl PCR-grade H2O, and 2.8 μl 25mM MgCl2. The PCR reaction was initiated with a 10-minute denaturation at 95°C and terminated with a 30 second cooling step at 40°C. The cycling protocol consisted of a denaturation step at 95°C for 10 s, annealing at 62°C for 5 s, and extension at 72°C for 10 s, and repeated for 45 cycles. Fluorescence detection was performed at the end of each annealing step.

For quantification, a calibration curve was obtained by using an external standard plasmid. To construct the plasmid, total RNA was prepared from FNCW stimulated PGEC, and cDNA synthesis was performed as described above. HPRT, IL-8 and hβD-2 were amplified using primers described above and the products cloned into TOPO II TA cloning vector (Invitrogen) and transformed into One Shot chemically competent E. coli (Invitrogen). Clones containing HPRT, IL-8 and hβD-2 inserts were identified by standard screening procedures and confirmed by restriction digestion and sequencing. Plasmid from 2 liters of E. coli containing the appropriate clone was isolated and purified using a Qiagen (Valencia, CA) plasmid mini-kit. Concentration of plasmid was determined spectrophotometrically, and copy number was determined using the formula 6 × 1023 (copies/mol) × concentration (g/μl) / MW of plasmid. Known amounts of plasmid (copies/μl) were used to generate optimal standard curves (mean squared error of ≤0.05 and a slope near -3.32 to ensure a PCR efficiency near 2.0E= (10−1 slope) (30) for HPRT, IL-8, and hβD-2. An anchor point (103 copies) was run in triplicate in each LightCycler reaction as a reference. To adjust for differences in cDNA concentration between control and stimulated samples, copy number was normalized to HPRT by multiplication with a conversion factor, calculated as: control (no stimulus) HPRT copy number/stimulus HPRT copy number ×1000.

Transfection of HEK293 cells and stimulation assay

Human embryonic kidney (HEK) 293 cells were maintained in Dulbecco’s modified Eagle’s medium (Invitrogen) with 10% heat-inactivated fetal calf serum (HyClone, Logan, Utah). The NF-B reporter construct (ELAM-1 firefly luciferase), the ß-actin-Renilla luciferase reporter construct, the modified pDisplay expression vector, and the expression constructs for human TLR2 (phuTLR2), TLR1 (phuTLR1), and membrane-bound CD14 (phumCD14) have been described previously (16, 17). HEK 293 cells were transfected by calcium phosphate precipitation and exposed as described previously with the modifications reported for a 96-well plate assay format (16, 17). Cells were washed twice with medium 3 h after transfection and exposed 20 to 24 h posttransfection. Exposures to T. denticola cell walls (1–100 μg/ml) or peptidoglycan from Staphylococcus aureus (Sigma; 1–100 μg/ml) were performed in Dulbecco’s modified Eagle’s medium containing 10% human serum, for 4 h at 37°C. After exposure, cells were rinsed with phosphate-buffered saline (Invitrogen) and lysed with 50 μl of passive lysis buffer (Promega, Madison, WI). Reporter gene expression in each lysate (10 μl) was measured using the Dual Luciferase reporter assay system (Promega). Data are expressed as the fold increase in relative light units (which represents the ratio of ELAM-luciferase to ß-actin Renilla-luciferase expression) relative to that of a no-stimulant medium control.

RESULTS

T. denticola does not induce IL-8 protein from PGEC

Many bacteria stimulate chemokine production, particularly IL-8, from epithelial cells. To establish whether T. denticola induces IL-8 production, PGEC were stimulated with 100:1 MOI T. denticola (several strains) or 10 μg/ml FNCW in 1% normal human serum for up to 18 hours. Preliminary experiments suggested that higher inocula of T. denticola (e.g., 1000:1 MOI) were detrimental to epithelial cell viability, while lower inocula (e.g., 10:1, 100:1 MOI) did not affect epithelial cell viability. Maximum IL-8 accumulation in the culture supernate after FNCW stimulation occurred 12–18 hours post stimulation (data not shown). Supernatants from stimulated cells were collected for analysis by ELISA. PGEC responded to F. nucleatum cell walls by producing significant amounts of IL-8 protein (p<0.001, Student’s t-test, assuming unequal variances) compared to unstimulated cells; these data are represented in Figure 1 as % basal levels IL-8 where the baseline (unstimulated) value is 100%. In contrast, PGEC failed to produce IL-8 protein in response to T. denticola strains 35405, 35404, 33520, 33521, or GM-1. In addition, none of the tested strains of T. denticola significantly reduced the basal levels of IL-8 protein present in the epithelial cell supernatants (Figure 1, p >0.1, Student’s t-test, assuming unequal variances). The ability of PGEC to produce IL-8 in response to FNCW is not universally observed. In our experience, only 30% of PGEC isolates tested between passes 3 and 6 are responsive to FNCW. In contrast, 70% of PGEC isolates produce IL-8 in response to PAM. Consequently, only those experiments in which the positive control (FNCW or PAM) resulted in IL-8 expression are included in our data. Epithelial cells were unresponsive to FNCW in the absence of serum, as epithelial cells lack surface expression of CD14. Epithelial cell viability during the stimulation period was not affected by incubation with T. denticola, as determined by trypan blue dye exclusion or Alamar Blue assay for metabolic activity (data not shown). Commercially available pooled primary normal human dermal epithelial keratinocytes (NHEK) showed a similar lack of IL-8 production in response to T. denticola (data not shown). Taken together, these results suggest that T. denticola does not induce production of IL-8 protein by primary human gingival epithelial cells.

Figure 1. T. denticola does not induce production of IL-8 protein from PGEC.

Figure 1

Open in a new tab

1 ×105 PGEC were incubated with 100:1 MOI T. denticola, 10 μg/ml FNCW or 10 μg/ml PAM for 24 hours at 37°C. Culture supernates were assayed for IL-8 protein by ELISA. % Basal IL-8 is expressed as (amount IL-8 produced in response to stimulus/amount IL-8 produced in absence of stimulus) × 100. Data represent the mean and standard error from 4 or more experiments with 6 replicates per experiment; *** = p < 0.001 compared to unstimulated, Student’s t-test assuming unequal variances on the raw data. This figure shows the results as % basal (unstimulated) levels, with the basal IL-8 level adjusted to 100%.

To determine whether the apparent lack of IL-8 production in response to T. denticola exposure is due to proteolysis of secreted IL-8, we tested the K1 dentilisin-deficient mutant. As shown in Figure 2, K1, like its 35405 parent, failed to induce IL-8 protein. K1 failed to demonstrate dentilisin activity in the SAAPFNA assay, and did not degrade exogenous IL-8 protein in our assay, while the parent strain did demonstrate dentilisin activity in the SAAPFNA assay, did degrade IL-8, and this degradation could be inhibited by chymostatin (Figure 3, and data not shown). The inactivation of dentilisin does not affect the activities of other T. denticola peptidases, suggesting that dentilisin is solely responsible for IL-8 degradation by 35405 (36). These results suggest the apparent failure of T. denticola to induce production of IL-8 protein (described above) is not due to dentilisin-mediated IL-8 degradation.

Figure 2. T. denticola 35405 dentilisin mutant does not induce production of IL-8 protein.

Figure 2

Open in a new tab

1 ×105 PGEC were incubated with 100:1 MOI T. denticola, 10 μg/ml FNCW or 10 μg/ml PAM for 24 hours at 37°C. Culture supernates were assayed for IL-8 protein by ELISA. % Basal IL-8 is expressed as (amount IL-8 produced in response to stimulus/amount IL-8 produced in absence of stimulus) × 100. Data represent the mean and standard error from 4 or more experiments with 6 replicates per experiment; *** = p< 0.001 compared to unstimulated, Student’s t-test assuming unequal variances on the raw data. This figure shows the results as % basal (unstimulated) levels, with basal IL-8 level adjusted to 100%.

Figure 3. T. denticola dentilisin mutant, K1, does not degrade IL-8 protein.

Figure 3

Open in a new tab

25 ng/ml human recombinant IL-8 was incubated in preblocked polypropylene tubes with or without 3 ×107 T. denticola 35405 parent or K1 mutant or 5 μg/ml chymostatin (CHY) at 37°C overnight. Proteinase K (PK) was added to separate tubes at 25 ng/ml as a positive control for IL-8 degradation. Proteases were inactivated with Roche Complete protease inhibitor cocktail according to manufacturer’s instructions. IL-8 was measured by capture ELISA. Data represent the means and standard errors from 5 experiments with 2 replicates per experiment. * = p < 0.05 compared to 35405+ IL-8 in the absence of chymostatin, Student’s t-test assuming unequal variances.

To determine whether the observed unresponsiveness of PGEC to T. denticola is limited to IL-8 or represents more generalized unresponsiveness, we tested the ability of PGEC to secrete IL-6 protein or express surface-associated ICAM-1 following incubation with T. denticola. PGEC were stimulated as described previously, and supernatants (for IL-6) or fixed cells (for ICAM-1) were examined by ELISA. As shown in Figure 4A, strain 35404 (other strains were not tested) did not induce production of IL-6 by PGEC, while a TLR-2 agonist, PAM, induced modest but significant IL-6 secretion. In addition, T. denticola strains 35404, 35405 parent, 35405 K1, and GM-1 failed to induce production of ICAM-1 from PGEC, while exposure to PAM resulted in a significant increase in ICAM-1 (Figure 4B). To confirm that immortalized gingival epithelium responded to T. denticola as has been previously demonstrated (2, 11), we stimulated KB cells, a widely used oral epithelial cell line, with T. denticola strain 35405 (MOI 100:1) or E. coli LPS (1 μg/ml) in the presence of 1% human serum. At 24 hours post-stimulation, LPS induced IL-8 production 266% over the basal levels, and T. denticola induced IL-8 at 249% of the basal levels (N=5). To determine whether the observed unresponsiveness was specific to primary epithelial cells, we tested the ability of HUVEC and peripheral blood mononuclear cells (PBMC) to respond to T. denticola by producing IL-8. In general, these cell types are more responsive to bacterial stimulation, and produce more IL-8 than PGEC (compare FNCW stimulation, Figure 1 (PGEC) versus Figure 5 (HUVEC); (32). As seen with PGEC, HUVEC failed to produce IL-8 secretion in response to T. denticola strains 35404, 35405, GM-1 and 35405 K1 (Figure 5); although the production of IL-8 in response to K1 appears to be higher than baseline, this difference is not statistically significant. PBMC respond to stimulation with spirochetal components by production of proinflammatory cytokines (32, 46, 50). PBMC produced considerable IL-8 in response to T. denticola: LPS positive control induced 251% over background IL-8 production; T. denticola induced 218% over background IL-8 production).

Figure 4. T. denticola does not induce production of IL-6 or ICAM-1 protein by PGEC.

Figure 4

Open in a new tab

1 ×105 PGEC were incubated with 100:1 MOI T. denticola or 10 μg/ml PAM for 24 hours at 37°C. Culture supernates were assayed for IL-6 protein by ELISA, while intact PGEC monolayers were assayed for ICAM-1. % Basal protein is expressed as (amount mediator produced in response to stimulus/amount mediator produced in absence of stimulus) × 100. Data represent the mean and standard error from 4 or more experiments with 6 replicates per experiment; * = p < 0.05 compared to unstimulated, Student’s t-test assuming unequal variances on the raw data. This figure shows the results as % basal (unstimulated) levels with basal IL-6 and ICAM-1 levels adjusted to 100%.

Figure 5. T. denticola does not induce IL-8 protein from HUVEC.

Figure 5

Open in a new tab

5 ×105 HUVEC were incubated with 100:1 MOI T. denticola or 10 μg/ml FNCW for 24 hours at 37°C. % Basal IL-8 is expressed as (amount IL-8 produced in response to stimulus/amount IL-8 produced in absence of stimulus) × 100. Data represent the mean and standard error from 4 or more experiments with 6 replicates per experiment; * = p < 0.05 compared to unstimulated, Student’s t-test assuming unequal variances on the raw data. This figure shows the results as % basal (unstimulated) levels, with basal IL-8 level adjusted to 100%.

T. denticola does not induce IL-8 transcription from PGEC

To ascertain whether T. denticola induces transcription of innate immune mediators, we examined the effects of stimulation by T. denticola on transcription of IL-8 mRNA. PGEC were stimulated with T. denticola 35404 or FNCW. At 4 hours post-stimulation, RNA was collected in Ultraspec and extracted by standard phenol-chloroform methods, followed by cDNA synthesis using random hexamers. In Figure 6A, quantitative real-time PCR was performed using an external standard plasmid containing the gene fragments of interest. T. denticola failed to induce IL-8 transcripts, while both FNCW- and PAM-stimulation induced transcription of IL-8 mRNA. We next tested the ability of PGEC to transcribe hβD-2 after T. denticola stimulation. As shown in Figure 6B, T. denticola did not induce transcription of hβD-2, while PAM stimulated defensin transcription. These results suggest that T. denticola fails to induce IL-8 or hβD-2 transcription in PGEC.

Figure 6. T. denticola does not induce IL-8 or hβD-2 transcription in PGEC.

Figure 6

Open in a new tab

1×105 PGEC were incubated with 100:1 MOI T. denticola, 10 μg/ml FNCW or 10 μg/ml PAM, for 4 hours at 37°C. RNA was isolated from PGEC, cDNA synthesized, and transcripts were detected by real-time RT-PCR. Data are expressed as percent basal IL-8 transcription (A) or percent basal hβD-2 transcription (B) in the absence of stimulus and represent the mean and standard error from three experiments with three replicates. * = p < 0.05, Student’s t-test assuming unequal variances on the raw data. This figure shows the results as % basal (unstimulated) levels, with basal levels adjusted to 100%.

T. denticola engages TLR-2

To ascertain whether T. denticola is recognized by the pattern recognition receptor TLR-2, HEK293 cells were transfected with human TLR-2 (hTLR-2), hTLR-1 and/or human, membrane-bound CD14 (hmCD14). Cells were subsequently stimulated with T. denticola cell walls at varying concentrations. Engagement of the TLR was detected by NFκB translocation and resulting luciferase reporter activity. Peptidoglycan, a known TLR-2 ligand, served as a positive control. As shown in Figure 7, T. denticola cell walls signaled through hTLR2+1 in a dose dependent manner. hmCD14 was not necessary for activation but did enhance the response. Similar results were obtained with HEK293 cells transfected with murine TLR-2 (mTLR-2) and murine mCD14 (data not shown). These results suggest that TLR-2 is a pattern recognition receptor for T. denticola, and that inability to engage this receptor does not explain T. denticola’s failure to stimulate PGEC.

Figure 7. T. denticola activation of TLR-2.

Figure 7

Open in a new tab

HEK 293 cells were transiently transfected with human TLR-2 + 1 with or without mCD14, and exposed to varying concentration of T. denticola cell walls (TDCW) or peptidoglycan. Activation of TLR-2 and subsequent translocation of NFkB translocation was measured by luciferase activity. Results represent the means (fold increase over unstimulated) and standard errors from 2 experiments done in triplicate; *** = p < 0.01, Student’s t-test assuming unequal variances.

DISCUSSION

Dental plaque is an ecologically complex community consisting of over 400 species of microorganisms (44). The healthy dental plaque community is dominated by streptococci and other gram-positive organisms. If this community shifts to a mainly gram-negative anaerobic flora, an inflammatory response is initiated (36). The subsequent destruction of the epithelium, connective tissue, and resorption of bone can result in tooth loss. The gingival epithelium, by producing chemokines, antimicrobial agents, and leukocyte adhesion molecules, plays an important role in limiting the overgrowth of plaque organisms (52, 54).

T. denticola and other oral spirochetes make up a large percentage of the microflora in periodontal pockets (35). Although T. denticola lipoproteins and outer membrane extracts activate monocytic cells (19, 46), the success of T. denticola at colonizing inflamed sites in the mouth suggests an ability to escape immune surveillance at the level of the epithelial cell. T. denticola are often found in close association with the periodontal pathogens P. gingivalis and T. forsythia (‘red complex’) (51). While periodontal pathogens like Actinobacillus actinomycetemcomitans induce IL-8 protein from epithelial cells, the two other members of the red complex (T. forsythia and P. gingivalis) fail to do so (3, 11, 23). We have now shown that T. denticola also fails to induce IL-8 protein from PGEC, and that this phenomenon is found across strains. An important distinction between our studies and previous investigations must be made: earlier studies employed cell lines rather than primary, low passage epithelial cells; changes in these epithelial cell lines during transformation and passage may alter the cell’s response to microbial challenge. Two reports suggest the failure of epithelial cells to respond to T. denticola by producing IL-8 is due to degradation of IL-8 (2, 13). Our data with PGEC suggest that, for most strains of T. denticola, this effect is minor or irrelevant. Further, we have shown that the K1 protease mutant, which does not degrade IL-8 protein (13), also fails to induce IL-8 protein from PGEC, suggesting that another mechanism besides proteolytic degradation of IL-8 is involved. T. denticola has several proteases which could be involved in degradation of host molecules; however, inactivation of dentilisin has no effect on other peptidase activities in the K1 dentilisin knockout (39) and this mutant fails to degrade exogenous IL-8. However, there are other sources of IL-8 besides PGEC in the periodontal pocket; dentilisin is a potent protease and in vivo probably plays an important role in reducing IL-8 and subsequent neutrophil chemotaxis.

The lack of epithelial cell response to T. denticola is not limited to IL-8, as PGEC also fail to produce IL-6 or ICAM-1 protein following incubation with T. denticola. Epithelial cells obtained from sites in contact with commensal bacteria display a screening mechanism in that TLR-2 or TLR-4 ligands such as LTA and LPS do not elicit inflammatory mediator secretion (1, 20, 38, 55). However, PGEC used in this study responded to known TLR-2 agonists, and TLR-2 surface expression on PGEC has been demonstrated previously (31, 53). HUVEC also fail to respond to T. denticola by producing IL-8, which implies a common ‘blindness’ of non-immune cells to this bacterium. Our results with HUVECs are in disagreement with a recent report from Okuda et al. In that study, T. denticola strain 35405 induced IL-8 protein from endothelial cells, while the K1 mutant failed to induce IL-8 protein (43). In our studies, both K1 and its isogenic parent 35405 failed to induce IL-8 protein (Figure 5). While our experimental designs were similar, the sources of HUVECs and their culture media were different, which may explain the discrepancy.

T. denticola does not induce IL-8 transcription compared to FNCW and also fails to induce hβD-2 transcription, while defensin transcripts are upregulated in response to PAM and other stimuli (8, 28, 29). Both IL-8 and hβD-2 transcription can be mediated by the transcription factor NFκB (25, 45); it is possible that T. denticola fails to activate NFκB and its translocation to the nucleus. However, TDCW are capable of activating TLR-2 and NFκB, suggesting that transcription of IL-8 or hβD-2 in response to T. denticola stimulation is blocked downstream of NFκB. Maximal IL-8 expression, for example, is dependent on activation of multiple signaling pathways, transcription factors, and post-transcriptional controls (45). Activation of the MAP kinase p38 is necessary for stabilization of the IL-8 transcript, and blocking its activity results in rapid degradation of the mRNA (57). It is possible that T. denticola either interferes with or fails to induce one of the signaling pathways other than TLR/NFκB that are necessary for maximal transcription of IL-8 or hβD-2. In addition, there are numerous examples of bacterial suppression of chemokine expression. Inhibition of IκB-α ubiquitination, downregulation of pattern-recognition receptors or activation of anti-inflammatory signaling pathways (21, 33, 40) are also mechanisms by which other bacteria affect cell responses and may be relevant to T. denticola. We used T. denticola cell walls to stimulate TLR-2 activation; it is possible that live T. denticola would fail to activate TLR-2, perhaps by degradation of TLR-2 or its co-receptors, although there is no direct evidence for this activity at present.

In summary, T. denticola does not induce production of common innate immune mediators from primary gingival epithelial cells. The ability of T. denticola to prevent the epithelium from producing chemotactic factors may be a necessary adaptation, as oral spirochetes are frequently found in close association with the gingival epithelium (34, 47). Interestingly, T. denticola and other oral treponemes are relatively resistant to killing by epithelium-produced β-defensins (5, 6). This insensitivity to these antimicrobial peptides, in addition to the unresponsiveness of the gingival epithelium to T. denticola, may help explain this organism’s prominence in periodontal disease.

Acknowledgments

The authors thank Heidi Pecoraro and Miko Robertson for manuscript preparation. CAB was supported by NIDCR Training Grant DE07023 and Public Health Service grant DE015354 (SAL) from the National Institutes of Dental and Craniofacial Research.

References

  • 1.Abreu MT, Vora P, Faure E, Thomas LS, Arnold ET, Arditi M. Decreased expression of toll-like receptor 4 and MD-2 correlates with intestinal epithelial cell protection against dysregulated proinflammatory gene expression in response to bacterial lipopolysaccharide. J Immunol. 2001;167:1609–1616. doi: 10.4049/jimmunol.167.3.1609. [DOI] [PubMed] [Google Scholar]
  • 2.Asai Y, Jinno T, Ogawa T. Oral treponemes and their outer membrane extracts activate human gingival epithelial cells through toll-like receptor 2. Infect Immun. 2003;71:717–725. doi: 10.1128/IAI.71.2.717-725.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Bainbridge B, Braham P, Darveau R. Characterization of Tannerella forsythensis lipopolysaccharide. IADR/AADR/CADR 83rd General Session; Baltimore, MD. 2005. [Google Scholar]
  • 4.Blakemore RP, Canale-Parola E. Arginine catabolism by Treponema denticola. J Bacteriol. 1976;128:616–622. doi: 10.1128/jb.128.2.616-622.1976. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Brissette CA, Lukehart SA. Treponema denticola is resistant to human beta-defensins. Infect Immun. 2002;70:3982–3984. doi: 10.1128/IAI.70.7.3982-3984.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Brissette CA, Simonson LG, Lukehart SA. Resistance to human beta-defensins is common among oral treponemes. Oral Microbiol Immunol. 2004;19:403–407. doi: 10.1111/j.1399-302x.2004.00177.x. [DOI] [PubMed] [Google Scholar]
  • 7.Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156–159. doi: 10.1006/abio.1987.9999. [DOI] [PubMed] [Google Scholar]
  • 8.Chung WO, Dale BA. Innate immune response of oral and foreskin keratinocytes: utilization of different signaling pathways by various bacterial species. Infect Immun. 2004;72:352–358. doi: 10.1128/IAI.72.1.352-358.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Coats SR, Reife RA, Bainbridge BW, Pham TT, Darveau RP. Porphyromonas gingivalis lipopolysaccharide antagonizes Escherichia coli lipopolysaccharide at toll-like receptor 4 in human endothelial cells. Infect Immun. 2003;71:6799–6807. doi: 10.1128/IAI.71.12.6799-6807.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Correia FF, Plummer AR, Ellen RP, et al. Two paralogous families of a two-gene subtilisin operon are widely distributed in oral treponemes. J Bacteriol. 2003;185:6860–6869. doi: 10.1128/JB.185.23.6860-6869.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Darveau RP, Belton CM, Reife RA, Lamont RJ. Local chemokine paralysis, a novel pathogenic mechanism for Porphyromonas gingivalis. Infect Immun. 1998;66:1660–1665. doi: 10.1128/iai.66.4.1660-1665.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.DelMar EG, Largman C, Brodrick JW, Geokas MC. A sensitive new substrate for chymotrypsin. Anal Biochem. 1979;99:316–320. doi: 10.1016/s0003-2697(79)80013-5. [DOI] [PubMed] [Google Scholar]
  • 13.Deng QD, Han Y, Xia X, Kuramitsu HK. Effects of the oral spirochete Treponema denticola on interleukin-8 expression from epithelial cells. Oral Microbiol Immunol. 2001;16:185–187. doi: 10.1034/j.1399-302x.2001.016003185.x. [DOI] [PubMed] [Google Scholar]
  • 14.Franzblau SG, Witzig RS, McLaughlin JC, et al. Rapid, low-technology MIC determination with clinical Mycobacterium tuberculosis isolates by using the microplate Alamar Blue assay. J Clin Microbiol. 1998;36:362–366. doi: 10.1128/jcm.36.2.362-366.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Guo L, Lim KB, Gunn JS, et al. Regulation of lipid A modifications by Salmonella typhimurium virulence genes phoP-phoQ. Science. 1997;276:250–253. doi: 10.1126/science.276.5310.250. [DOI] [PubMed] [Google Scholar]
  • 16.Hajjar AM, O’Mahony DS, Ozinsky A, et al. Cutting edge: functional interactions between toll-like receptor (TLR) 2 and TLR1 or TLR6 in response to phenol-soluble modulin. J Immunol. 2001;166:15–19. doi: 10.4049/jimmunol.166.1.15. [DOI] [PubMed] [Google Scholar]
  • 17.Hajjar AM, Ernst RK, Tsai JH, Wilson CB, Miller SI. Human Toll-like receptor 4 recognizes host-specific LPS modifications. Nat Immunol. 2002;25:25. doi: 10.1038/ni777. [DOI] [PubMed] [Google Scholar]
  • 18.Han YW, Shi W, Huang GT, et al. Interactions between periodontal bacteria and human oral epithelial cells: Fusobacterium nucleatum adheres to and invades epithelial cells. Infect Immun. 2000;68:3140–3146. doi: 10.1128/iai.68.6.3140-3146.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Hashimoto M, Asai Y, Ogawa T. Treponemal phospholipids inhibit innate immune responses induced by pathogen-associated molecular patterns. J Biol Chem. 2003;278:44205–44213. doi: 10.1074/jbc.M306735200. [DOI] [PubMed] [Google Scholar]
  • 20.Hedlund M, Wachtler C, Johansson E, et al. P fimbriae-dependent, lipopolysaccharide-independent activation of epithelial cytokine responses. Mol Microbiol. 1999;33:693–703. doi: 10.1046/j.1365-2958.1999.01513.x. [DOI] [PubMed] [Google Scholar]
  • 21.Huang FC, Li Q, Cherayil BJ. A phosphatidyl-inositol-3-kinase-dependent anti-inflammatory pathway activated by Salmonella in epithelial cells. FEMS Microbiol Lett. 2005;243:265–270. doi: 10.1016/j.femsle.2004.12.013. [DOI] [PubMed] [Google Scholar]
  • 22.Huang GT, Haake SK, Kim JW, Park NH. Differential expression of interleukin-8 and intercellular adhesion molecule-1 by human gingival epithelial cells in response to Actinobacillus actinomycetemcomitans or Porphyromonas gingivalis infection. Oral Microbiol Immunol. 1998;13:301–309. doi: 10.1111/j.1399-302x.1998.tb00711.x. [DOI] [PubMed] [Google Scholar]
  • 23.Huang GT, Kim D, Lee JK, Kuramitsu HK, Haake SK. Interleukin-8 and intercellular adhesion molecule 1 regulation in oral epithelial cells by selected periodontal bacteria: Multiple effects of Porphyromonas gingivalis via antagonistic mechanisms. Infect Immun. 2001;69:1364–1372. doi: 10.1128/IAI.69.3.1364-1372.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Ishihara K, Kuramitsu HK, Miura T, Okuda K. Dentilisin activity affects the organization of the outer sheath of Treponema denticola. J Bacteriol. 1998;180:3837–3844. doi: 10.1128/jb.180.15.3837-3844.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Kaiser V, Diamond G. Expression of mammalian defensin genes. J Leukoc Biol. 2000;68:779–784. [PubMed] [Google Scholar]
  • 26.Kawasaki K, Ernst RK, Miller SI. Purification and characterization of deacylated and/or palmitoylated lipid A species unique to Salmonella enterica serovar Typhimurium. J Endotoxin Res. 2005;11:57–61. doi: 10.1179/096805105225006696. [DOI] [PubMed] [Google Scholar]
  • 27.Krisanaprakornkit S, Weinberg A, Perez CN, Dale BA. Expression of the peptide antibiotic human beta-defensin 1 in cultured gingival epithelial cells and gingival tissue. Infect Immun. 1998;66:4222–4228. doi: 10.1128/iai.66.9.4222-4228.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Krisanaprakornkit S, Kimball JR, Weinberg A, Darveau RP, Bainbridge BW, Dale BA. Inducible expression of human beta-defensin-2 by Fusobacterium nucleatum in oral epithelial cells: multiple signaling pathways and role of commensal bacteria in innate immunity and the epithelial barrier. Infect Immun. 2000;68:2907–2915. doi: 10.1128/iai.68.5.2907-2915.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Krisanaprakornkit S, Kimball JR, Dale BA. Regulation of human beta-defensin-2 in gingival epithelial cells: The involvement of mitogen-activated protein kinase pathways, but not the NF-kappa B transcription factor family. J Immunol. 2002;168:316–324. doi: 10.4049/jimmunol.168.1.316. [DOI] [PubMed] [Google Scholar]
  • 30.Kuhne BS, Oschmann P. Quantitative real-time RT-PCR using hybridization probes and imported standard curves for cytokine gene expression analysis. Biotechniques. 2002;33:1078. doi: 10.2144/02335rr03. 1080–1072, 1084 passim. [DOI] [PubMed] [Google Scholar]
  • 31.Kusumoto Y, Hirano H, Saitoh K, et al. Human gingival epithelial cells produce chemotactic factors interleukin-8 and monocyte chemoattractant protein-1 after stimulation with Porphyromonas gingivalis via toll-like receptor 2. J Periodontol. 2004;75:370–379. doi: 10.1902/jop.2004.75.3.370. [DOI] [PubMed] [Google Scholar]
  • 32.Lee SH, Kim KK, Choi BK. Upregulation of intercellular adhesion molecule 1 and proinflammatory cytokines by the major surface proteins of Treponema maltophilum and Treponema lecithinolyticum, the phylogenetic group IV oral spirochetes associated with periodontitis and endodontic infections. Infect Immun. 2005;73:268–276. doi: 10.1128/IAI.73.1.268-276.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Lin M, Rikihisa Y. Ehrlichia chaffeensis downregulates surface Toll-like receptors 2/4, CD14 and transcription factors PU.1 and inhibits lipopolysaccharide activation of NF-kappa B, ERK 1/2 and p38 MAPK in host monocytes. Cell Microbiol. 2004;6:175–186. doi: 10.1046/j.1462-5822.2003.00355.x. [DOI] [PubMed] [Google Scholar]
  • 34.Listgarten MA. Structure of the microbial flora associated with periodontal health and disease in man. A light and electron microscopic study. J Periodontol. 1976;47:1–18. doi: 10.1902/jop.1976.47.1.1. [DOI] [PubMed] [Google Scholar]
  • 35.Loesche WJ. The role of spirochetes in periodontal disease. Adv Dent Res. 1988;2:275–283. doi: 10.1177/08959374880020021201. [DOI] [PubMed] [Google Scholar]
  • 36.Loesche WJ, Grossman NS. Periodontal disease as a specific, albeit chronic, infection: Diagnosis and treatment. Clin Microbiol Rev. 2001;14:727–752. doi: 10.1128/CMR.14.4.727-752.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Maiden MF, Cohee P, Tanner AC. Proposal to conserve the adjectival form of the specific epithet in the reclassification of Bacteroides forsythus Tanner et al. 1986 to the genus Tannerella Sakamoto et al. 2002 as Tannerella forsythia corrig., gen. nov., comb. nov. Request for an Opinion. Int J Syst Evol Microbiol. 2003;53:2111–2112. doi: 10.1099/ijs.0.02641-0. [DOI] [PubMed] [Google Scholar]
  • 38.Melmed G, Thomas LS, Lee N, et al. Human intestinal epithelial cells are broadly unresponsive to Toll-like receptor 2-dependent bacterial ligands: implications for host-microbial interactions in the gut. J Immunol. 2003;170:1406–1415. doi: 10.4049/jimmunol.170.3.1406. [DOI] [PubMed] [Google Scholar]
  • 39.Miyamoto M, Ishihara K, Okuda K. The Treponema denticola surface protease dentilisin degrades interleukin-1 beta (IL-1 beta), IL-6, and tumor necrosis factor alpha. Infect Immun. 2006;74:2462–2467. doi: 10.1128/IAI.74.4.2462-2467.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Neish AS, Gewirtz AT, Zeng H, et al. Prokaryotic regulation of epithelial responses by inhibition of IkappaB-alpha ubiquitination. Science. 2000;289:1560–1563. doi: 10.1126/science.289.5484.1560. [DOI] [PubMed] [Google Scholar]
  • 41.Nixon CS, Steffen MJ, Ebersole JL. Cytokine responses to Treponema pectinovorum and Treponema denticola in human gingival fibroblasts. Infect Immun. 2000;68:5284–5292. doi: 10.1128/iai.68.9.5284-5292.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Oda D, Watson E. Human oral epithelial cell culture I. Improved conditions for reproducible culture in serum-free medium. In Vitro Cell Dev Biol. 1990;26:589–595. doi: 10.1007/BF02624208. [DOI] [PubMed] [Google Scholar]
  • 43.Okuda T, Kimizuka R, Miyamoto M, et al. Treponema denticola induces interleukin-8 and macrophage chemoattractant protein 1 production in human umbilical vein epithelial cells. Microbes Infect. 2007;9:907–913. doi: 10.1016/j.micinf.2007.03.009. [DOI] [PubMed] [Google Scholar]
  • 44.Paster BJ, Boches SK, Galvin JL, et al. Bacterial diversity in human subgingival plaque. J Bacteriol. 2001;183:3770–3783. doi: 10.1128/JB.183.12.3770-3783.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Roebuck KA. Regulation of interleukin-8 gene expression. J Interferon Cytokine Res. 1999;19:429–438. doi: 10.1089/107999099313866. [DOI] [PubMed] [Google Scholar]
  • 46.Rosen G, Sela MN, Naor R, Halabi A, Barak V, Shapira L. Activation of murine macrophages by lipoprotein and lipooligosaccharide of Treponema denticola. Infect Immun. 1999;67:1180–1186. doi: 10.1128/iai.67.3.1180-1186.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Saglie R, Newman MG, Carranza FA, Pattison GL. Bacterial invasion of gingiva in advanced periodontitis in humans. J Periodontol. 1982;53:217–222. doi: 10.1902/jop.1982.53.4.217. [DOI] [PubMed] [Google Scholar]
  • 48.Sakamoto M, Suzuki M, Umeda M, Ishikawa L, Benno Y. Reclassification of Bacteroides forsythus (Tanner et al. 1986) as Tannerella forsythensis corrig., gen. nov., comb. nov. Int J Syst Evol Microbiol. 2002;52:841–849. doi: 10.1099/00207713-52-3-841. [DOI] [PubMed] [Google Scholar]
  • 49.Satcher DS. Oral health in America: A report of the Surgeon General. Rockville, MD: U.S. Department of Health and Human Services, National Institute of Dental and Craniofacial Research, National Institutes of Health; 2000. Linkages with General Health; pp. 95–127. [Google Scholar]
  • 50.Sellati TJ, Bouis DA, Caimano MJ, et al. Activation of human monocytic cells by Borrelia burgdorferi and Treponema pallidum is facilitated by CD14 and correlates with surface exposure of spirochetal lipoproteins. J Immunol. 1999;163:2049–2056. [PubMed] [Google Scholar]
  • 51.Socransky SS, Haffajee AD, Cugini MA, Smith C, Kent RL., Jr Microbial complexes in subgingival plaque. J Clin Periodontol. 1998;25:134–144. doi: 10.1111/j.1600-051x.1998.tb02419.x. [DOI] [PubMed] [Google Scholar]
  • 52.Suchett-Kaye G, Morrier JJ, Barsotti O. Interactions between non-immune host cells and the immune system during periodontal disease: role of the gingival keratinocyte. Crit Rev Oral Biol Med. 1998;9:292–305. doi: 10.1177/10454411980090030301. [DOI] [PubMed] [Google Scholar]
  • 53.Sugawara Y, Uehara A, Fujimoto Y, et al. Toll-like receptors, NOD1, and NOD2 in oral epithelial cells. J Dent Res. 2006;85:524–529. doi: 10.1177/154405910608500609. [DOI] [PubMed] [Google Scholar]
  • 54.Tonetti MS. Molecular factors associated with compartmentalization of gingival immune responses and transepithelial neutrophil migration. J Periodontal Res. 1997;32:104–109. doi: 10.1111/j.1600-0765.1997.tb01389.x. [DOI] [PubMed] [Google Scholar]
  • 55.Uehara A, Yang S, Fujimoto Y, et al. Muramyldipeptide and diaminopimelic acid-containing desmuramylpeptides in combination with chemically synthesized Toll-like receptor agonists synergistically induced production of interleukin-8 in a NOD2- and NOD1-dependent manner, respectively, in human monocytic cells in culture. Cell Microbiol. 2005;7:53–61. doi: 10.1111/j.1462-5822.2004.00433.x. [DOI] [PubMed] [Google Scholar]
  • 56.van der Woude MW, Baumler AJ. Phase and antigenic variation in bacteria. Clin Microbiol Rev. 2004;17:581–611. doi: 10.1128/CMR.17.3.581-611.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Winzen R, Gowrishankar G, Bollig F, Redich N, Resch K, Holtmann H. Distinct domains of AU-rich elements exert different functions in mRNA destabilization and stabilization by p38 mitogen-activated protein kinase or HuR. Mol Cell Biol. 2004;24:4835–4847. doi: 10.1128/MCB.24.11.4835-4847.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES