Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2016 Jul 1.
Published in final edited form as: Virology. 2015 Mar 11;481:73–78. doi: 10.1016/j.virol.2015.01.034

Efficient Human Immunodeficiency Virus (HIV-1) Infection of Cells Lacking PDZD8

Shijian Zhang 1, Joseph Sodroski 1,2,*
PMCID: PMC4437853  NIHMSID: NIHMS665903  PMID: 25771112

Abstract

PDZD8 can bind the capsid proteins of different retroviruses, and transient knockdown of PDZD8 results in a decrease in the efficiency of an early, post-entry event in the retrovirus life cycle. Here we used the CRISPR-CAS9 system to create cell lines in which PDZD8 expression is stably eliminated. The PDZD8-knockout cell lines were infected by human immunodeficiency virus (HIV-1) and murine leukemia virus as efficiently as the parental PDZD8-expressing cells. These results indicate that PDZD8 is not absolutely necessary for HIV-1 infection and diminishes its attractiveness as a potential target for intervention.

Keywords: Retrovirus, host factor, uncoating, capsid, stabilization, CRISPR-CAS9, knockout

Introduction

The mature human immunodeficiency virus (HIV-1) contains a conical capsid comprising ~ 1500 capsid (CA) proteins, surrounding the viral RNA genomes[1]. The CA protein of HIV-1 is composed of N-terminal and C-terminal domains (NTD and CTD) connected by a flexible linker. The CA proteins oligomerize into hexamers or pentamers by the interactions among the NTDs [2]. Interactions between the CTDs connect neighboring hexamers, and the hexamer lattice is closed by pentamers to form the capsid conical structure [3].

After the entry of HIV-1 into host cells, viral capsids slowly disassemble by a process of uncoating. Careful regulation of capsid uncoating is essential for successful viral infection. Changes in HIV-1 capsid stability resulting from alteration of the CA protein or treatment with small compounds significantly attenuate viral reverse transcription or nuclear import [4, 5].

Stability of the HIV-1 capsid can also be influenced by host cellular proteins. The restriction factors TRIM5a and TRIMCyp bind and induce premature uncoating of HIV-1 capsids [6, 7]. By contrast, if aberrantly located in the cytoplasm, the nuclear protein CPSF6 can slow down capsid disassembly and inhibit HIV-1 infection [8–10]. A positive co-factor, cyclophilin A, a CA-binding prolyl isomerase, is required for efficient HIV-1 infection in some cell types and has been implicated in capsid stabilization [10–12].

The host protein PDZD8 was found to interact with the HIV-1 Gag protein [13]. Transient overexpression of PDZD8 enhanced HIV-1 infectivity, and transient knockdown of PDZD8 resulted in an approximately 10-fold reduction in the infection of cells by HIV-1 and murine leukemia virus vectors [13, 14]. Early post-entry events were affected by transient PDZD8 knockdown [13, 14].

In considering a host protein as a target for intervention, one desirable property is that knockdown or inhibition is tolerated by the host, but results in a lasting and substantial disruption of virus replication. Here, we evaluate PDZD8 as a potential target for intervention in HIV-1 infection. Because antibodies to detect endogenous PDZD8 were not previously available, the quantitative dependency of HIV-1 infection on PDZD8 levels could not be assessed in earlier studies [13, 14]. Furthermore, indirect effects of transient PDZD8 knockdown could not be ruled out, particularly because PDZ proteins typically associate with other proteins [15]. By generating antibodies that can detect endogenous PDZD8 and by using CRISPR-CAS9 to knock out PDZD8 expression, we rigorously evaluated the role of PDZD8 in HIV-1 infectivity. The PDZD8-negative cells supported infection by HIV-1 and murine leukemia viruses as efficiently as the parent cells. These results indicate that, at least in some contexts, PDZD8 is not required for HIV-1 infection, thus diminishing the potential attractiveness of PDZD8 as a target for HIV-1 intervention.

Results and Discussion

To evaluate the contribution of PDZD8 to cell viability and HIV-1 infectivity, we wished to knock out the PDZD8 gene in cells using CRISPR-CAS9. Because commercially available anti-PDZD8 antibodies failed to detect endogenous PDZD8 in 293T cells (unpublished results), we generated rabbit antiserum against human PDZD8. The PDZD8 proteins of humans and rabbits share more than 90% identity, so we selected the most divergent region (amino acid residues 438-663) as an immunogen (Supplementary Fig. 1). This sequence was expressed in E. coli as a fusion protein with glutathione S-transferase (GST), which can increase solubility and immunogenicity [16]. The purified GST-PDZD8438-663 protein (Supplementary Fig.2 and Fig. 1A) was used to immunize two rabbits. Antisera from both immunized rabbits detected the PDZD8-flag protein expressed transiently in 293T cells by Western blotting (Fig. 1B). To evaluate the ability of the rabbit antisera to detect endogenous PDZD8, 293T and HeLa cells transfected with PDZD8 siRNAs or negative control siRNAs were lysed and the cell lysates Western blotted. Figure 1C shows that the endogenous PDZD8 protein could be detected by Western blotting. The expression of endogenous PDZD8 was reduced by the PDZD8-specific siRNAs. Both antisera were also able to precipitate endogenous PDZD8 from 293T cells (Fig. 1D).

Figure 1.

Figure 1

Elicitation of anti-PDZD8 antibody in rabbits. (A) Purification of GST-PDZD8438-663. Glutathione-Sepharose 4B was used to purify GST-PDZD8438-663. The gel comparing the purified GST-PDZD8438-663 protein with bovine serum albumin (BSA) was stained with Coomassie Blue. (B) Titration of PDZD8 antisera. PDZD8 antisera were tested at the indicated dilutions for the ability to detect the expression of PDZD8 by Western blotting purified GST-PDZD8438-663 and lysates of 293T cells transfected with a plasmid expressing PDZD8-flag [13], or with an empty vector control. (C) Determination of endogenous PDZD8 in 293T and HeLa cells. PDZD8 siRNAs were transfected into 293T cells, and the lysates were subjected to Western blotting for determination of endogenous PDZD8 expression. The Nctl-siRNA represents a negative control siRNA, and the siRNA-65 and siRNA-67 are PDZD8-specific siRNAs (catalog numbers s42265 and s42267, respectively (Ambion)). (D) Immunoprecipitation (IP) of PDZD8 with rabbit antisera. 293T cells were lysed with IP lysis buffer (Thermo). Cell lysates were incubated with PDZD8 antisera (or with a negative control (ctl) serum) and Protein A-agarose beads (Sigma). The precipitated PDZD8 protein was detected by Western blotting with antiserum #1.

Modification of host genes encoding HIV-1 cofactors is useful to assess their role in the viral life cycle and may eventually prove to be applicable in interventions [17–19]. Advances in gene editing by the CRISPR-CAS9 technology have made the manipulation of target genes simpler [20]. Although the CRISPR-CAS9 system has a low efficiency of gene disruption, the insertion of selectable markers into the target genes can help in screening [21, 22]. To knock out pdzd8 gene expression completely in 293T and HeLa cells, protospacer sequences were selected in regions close to the start codon. As highly condensed regions of the chromosome may decrease the efficiency of CRISPR-CAS9 access to the gene, we selected DNase1-sensitive target regions and used multiple protospacer sequences to increase the success rate. Three protospacer sequences were selected, and the corresponding oligonucleotides were synthesized, annealed and ligated to the digested pX330 vector according to the CRISPR-cloning protocol described in the Materials and Methods (Fig. 2A). The homology arm was amplified by PCR from nucleotides −1107 to 866 of the pdzd8 gene (where the first base of the pdzd8 open reading frame is considered +1, and the upstream sequence, starting with −1, is designated in reverse order). A BamHI restriction site was introduced between the −1 and +1 positions by site-directed PCR mutagenesis, and a GFP-2A-Puromycin cassette was cloned into this site (Fig. 2A). The linearized homology arm containing the GFP-2A-Puromycin cassette was cotransfected with pX330-gRNA1, 2 or 3 into 293T and HeLa cells. Puromycin-resistant cells were selected, but only a small percentage of these detectably expressed GFP. To examine whether PDZD8 expression was altered in the transfected cells, cell lysates were Western blotted with the rabbit anti-PDZD8 antisera. Only the pX330-gRNA1 abolished PDZD8 expression in both 293T and HeLa cells (Fig. 2B). Clones of 293T cells transfected with pX330-gRNA1 were obtained by serial dilution and examined for PDZD8 expression by Western blotting. PDZD8 expression in these 293T clones was below detectable levels (Fig. 2C). The pdzd8 gene of seven clones was amplified by PCR and sequenced. Representative results from two clones are shown in Fig. 2D. PDZD8 knockout (KO) clone 1 sustained a deletion of 11 base pairs. PDZD8 KO7 exhibited random insertions and deletions in the pdzd8 gene, indicative of non-homologous end-joining. No GFP-2A-Puromycin sequences were found in the pdzd8 genes, suggesting that the observed puromycin resistance may have resulted from insertion of either the complete or partial GFP-2A-Puromycin cassette into other genomic sites.

Figure 2.

Figure 2

Establishment of PDZD8 Knockout 293T and HeLa cell lines. (A) Design of the PDZD8 homology arm and selection of protospacer sequences for PDZD8 knock out by CRISPR-CAS9. (B) Determination of PDZD8 expression in 293T and HeLa cell lines. The 293T cells and HeLa cells were transfected with pGEM-T-ArmGP and pX330-gRNA1, pX330-gRNA2 or pX330-gRNA3, and selected with 0.4 µg/ml puromycin. The puromycin-resistant cells were lysed and the cell lysates were subjected to Western blotting with a rabbit anti-PDZD8 antiserum to determine PDZD8 expression. HeLa cells transfected with a negative control (Nctl) siRNA or the PDZD8-specific siRNA-65 are shown for comparison. gRNA1: pX330-gRNA1; gRNA2: pX330-gRNA2; gRNA3: pX330-gRNA3. (C) Clones of 293T cells prepared by serial dilution were examined for PDZD8 expression by Western blotting with rabbit anti-PDZD8 antiserum #1. Control 293T cells were transfected with the anti-PDZD8 siRNA-65 or with a negative control siRNA (Nctl-siRNA). (D) Sequence of the pdzd8 gene in PDZD8 knockout (KO) 293T cell lines. Clones of PDZD8 KO cells were screened by serial dilution. Genomic DNA of PDZD8 KO clones was prepared and the pdzd8 region was amplified with Q5 DNA polymerase by nested PCR. In the upper left panel, the region between −1107 and 866 of the pdzd8 gene was amplified; the product was purified and served as a template to amplify the region between −267and 481 of the gene, the product of which was analyzed on a 1% agarose gel (upper right panel). The pGEM-T easy-arm (arm) and pGEM-T easy-armPG (arm + puroGFP) DNAs were included as PCR controls. The amplified DNA fragments were sequenced along with the wild-type genome as a control. DB: database entry.

The growth and viability of the PDZD8 KO cells were indistinguishable from those of the parent cell lines (unpublished observations). To examine the effect of PDZD8 knockout on retroviral infection in 293T and HeLa cells, PDZD8 KO cells were incubated with different doses of recombinant HIV-1 and MLV vectors pseudotyped with the vesicular stomatitis virus G glycoprotein and expressing GFP (Fig. 3). Two days afterwards, GFP expression in the target cells was measured as a marker of virus infection. No significant difference was observed between the levels of either HIV-1 or MLV infection of parental 293T or HeLa cells and the respective PDZD8 KO cells. Apparently, PDZD8 is not required for efficient infection of these cells by HIV-1 or MLV.

Figure 3.

Figure 3

Effect of PDZD8 knockout (KO) on HIV-1 and MLV infection. Wild-type (wt) or PDZD8 KO 293T (A) or HeLa (C) cells were incubated with various amounts of HIV-GFP or MLV-GFP. GFP signals were determined by flow cytometry and are represented as geometric mean values. The results of a typical experiment are shown. Similar results were obtained in three independent experiments. The expression of PDZD8 in 293T (B) or HeLa (D) cells was determined by Western blotting cell lysates with rabbit anti-PDZD8 antiserum #1.

PDZD8 was implicated as a potential regulator of early events in the retrovirus infection cycle in CHME3, a microglial cell line, and in HeLa cells, using overexpression or siRNA-mediated transient knockdown of PDZD8 [13, 14]. These experiments leave open the possibility that transient variation in PDZD8 levels indirectly affects other moieties (e.g., moesin) [23–25] implicated in retrovirus infection. We generated 293T and HeLa cells with PDZD8 expression knocked out in a stable fashion, using CRISPR-CAS9 gene editing technology. Rabbit antisera against human PDZD8 were used to demonstrate a lack of detectable PDZD8 expression, and disruption of the pdzd8 coding capacity was documented in the PDZD8 KO cells. Although no experiment can rule out a role for PDZD8 in retroviral infection in any circumstance, our results demonstrate that HIV-1 and MLV can negotiate early infection efficiently in the complete absence of PDZD8. Thus, PDZD8 is not absolutely essential for HIV-1 infection. If PDZD8 interaction with the retroviral capsid contributes to HIV-1 infectivity, redundancy in the cellular factors that mediate such interaction must exist. Our results diminish the attractiveness of PDZD8-capsid interaction as a potential target for intervention, as HIV-1 and MLV can bypass any requirement for PDZD8 with apparent ease.

Materials and Methods

Cell lines and cell culture

293T and HeLa cells were obtained from the American Type Culture Collection (ATCC). All cell lines were maintained in Dulbecco's Modified Eagle Medium (Gibco) supplemented with 10% fetal calf serum (FCS) (Invitrogen), and antibiotics (100 U/ml penicillin and 100 mg/ml streptomycin).

siRNA transfection

One day before transfection, cells were plated at a density of 1 × 105 cells/well (293T) or 5×104 cells/well (HeLa) in 24-well plates. Anti-PDZD8 siRNA 21-mers siRNA-65 (Ambion, s42265) or siRNA-67 (Ambion, s42267) were obtained from Life Technologies. PDZD8 siRNAs at a concentration of 20 nM were transfected into 293T or HeLa cells with Lipofectamine RNAiMAX (Life technologies). Two days after transfection, cells were harvested.

Plasmid construction

The sequence encoding human PDZD8438-663 was amplified by PCR, and ligated into pGEX-4T-1 after digestion with BamHI and XhoI. The PCR primer sequences were: forward: 5’-GGATCCGGTGACCGAGTCCTGGTGTACTATGAAAGG-3’, reverse: 5’-CTCGAGTGAAGTGACATCTTTGGCCACTTCTTGCTT-3’.

The pX330-U6-Chimeric_BB-CBh-hSpCas9 (Plasmid: 42230) was obtained from Addgene. The plasmid was digested with BbsI and ligated with annealed protospacer oligo DNAs, following the protocol provided by Dr. Feng Zhang (Addgene). The constructed plasmids are designated pX330-gRNA1, pX330-gRNA2, and pX330- gRNA3, respectively. The protospacer DNA oligonucleotides are: Protospacer1 forward: CACCGATCCTGGCGTCGGCCGTGC, reverse: AAACGCACGGCCGACGCCAGGATC; Protospacer2 forward: CACCGAGGCCGCCCGCGCGGGCGA, reverse: AAACTCGCCCGCGCGGGCGGCCTC; Protospacer3 forward: CACCGTACCTTTATGGCGGCGGC, reverse: AAACGCCGCCGCCATAAAGGTAC.

The genomic DNA template was prepared with a DNeasy Blood & Tissue Kit (Qiagen). The PDZD8 homology arm was amplified with a primer pair: forward: 5’--1107GTCGACCACGCTCTCTGCACCAGTGTTGGCATCTGT--1072-3’, reverse: 5’-866-GCGGCCGCCAATGTCAAATTAGCACAGACCTGGGCT-831-3’, and ligated with pGEM-T easy vector (Promega); the resulting plasmid was named pGEM-T easy-arm. The first base of the pdzd8 open reading frame is considered +1, and the upstream sequence, starting with −1, is designated in reverse order. A BamHI site was introduced into the homology arm with a Q5® Site-Directed Mutagenesis Kit using the following pair of primers: forward: 5’-ggatccCTGCTGCTCATGATCCTGGCGTCG-3’, reverse: 5’-CCCCATCCCGCCACCGCC-3’. The GFP-2A-Puromycin cassette was amplified from the template OCT4-eGFP-2A-Puro from Addgene (Plasmid: 31939), using the primer pair: forward: 5’- GGATCCGTGAGCAAGGGCGAGGAGCTGTTCACCGGG-3’, reverse: 5’- GGATCCATCAGGCACCGGGCTTGCGGGTCATGCACC-3’. The GFP-2A-Puromycin cassette was inserted into the homology arm using the BamHI restriction site; the resulting plasmid was named pGEM-T easy-armPG.

Expression and purification of GST-PDZD8438-663

The pGEX-4T-1-PDZD8438-663 plasmid was transfected into E. coli BL-21(DE3) (Life Technologies), and the bacteria were induced for expression with 0.5 mM IPTG at 37 °C for 2 hours. After induction, the cells were harvested by centrifugation for 15 minutes at 5,000×g at 4 °C, and washed once with 1× PBS. Cells were resuspended in 5 packed cell volumes of 1×PBS with 1 mM EDTA and protease inhibitor cocktail (Roche) and lysed by sonication. Cell lysates were centrifuged at 12,000×g for 15 minutes at 4 °C. The supernatant was incubated with 1× PBS-equilibrated Glutathione-Sepharose 4B (GE) at room temperature for 1 hour by gentle rocking, and loaded onto a Poly-Prep Chromatography Column (BIO-RAD). The beads were washed with a total of 15 bed volumes of 1× PBS, with 5 bed volumes of 1× PBS each time. To elute the protein from the column, 1 bed volume of elution buffer (50 mM Tris HCl, 10 mM reduced glutathione, pH 8.0) was added to the column and incubated at room temperature for 10 minutes. Then, the elution buffer was allowed to flow through by gravity. In total, 5 bed volumes of elution buffer were used to elute the GST-PDZD8438-663 protein.

Screening of PDZD8 Knockout cells

Plasmids were prepared with the MaxiPrep kit (Qiagen). One day before transfection, 8×106 293T or 4 ×106 HeLa cells were seeded into a 10-cm dish. Fifteen µg of pX330-Protospacer1 and 5 µg of linearized pGEM-T-ArmGP were co-transfected into 293T or HeLa cells with Lipofectamine 3000 (Life Technologies). Before transfection, the medium for HeLa cells was changed to Opti-MEM (Gibco), and the next day the medium was changed to Dulbecco's Modified Eagle Medium (Gibco) supplemented with 10% FCS (Invitrogen) and antibiotics (100 U/ml penicillin and 100 mg/ml streptomycin).

Three days after transfection, 0.4 µg/ml puromycin was added to the cells for selection. To obtain single clones of PDZD8-knockout cells, serial dilution was performed to achieve a cell density of 1 cell/300 µl medium, and a 100-µl aliquot was seeded into each well of a 96-well plate.

The pdzd8 gene of expanded single clones was sequenced. A genomic DNA template was prepared using a DNeasy Blood & Tissue Kit (Qiagen). The PDZD8 gene was amplified by nested PCR with two pairs of primers: forward: 5’-1107-GTCGACCACGCTCTCTGCACCAGTGTTGGCATCTGT-1072-3’, reverse: 5’-866-GCGGCCGCCAATGTCAAATTAGCACAGACCTGGGCT-831-3’; forward: 5’-267-AATGAGTGGAGGCCTGAGGGAG--246-3’, reverse: 5’-481-GGATGGTCTTGATGAAGGGCAC-460-3’. DNA fragments were purified with a Gel extraction kit (Qiagen) and used for sequencing.

Infection with viruses expressing GFP

Recombinant HIV-1 vectors expressing green fluorescent protein (GFP) (HIV-1-GFP) were prepared by cotransfecting 293T cells in a 175-mm dish with 13 µg of pHIVvec2.GFP, 13 µg of pCMVgag/pol, and 13 µg of pVPack-VSV-G. The Moloney murine leukemia virus vector expressing GFP (MLV-GFP) was prepared by cotransfecting 293T cells in a 175-mm dish with 17.5 µg of pFB-hrGFP, 17.5 µg of pVPack-GFP, and 4.7 µg of pVPack-VSV-G (all from Stratagene). Forty-eight hours after transfection, medium containing recombinant viruses was harvested and filtered (0.45-µm pore size).

Cells were plated at a density of 1 × 105 cells/well (293T) or 5×104 cells/well (HeLa) in 24-well plates. Medium containing recombinant HIV-1-GFP or MLV-GFP vectors was added in serial dilutions to the cells, which were incubated at 37°C for 2 days. Cells were then trypsinized, and analyzed by fluorescence-activated cell sorting (FACS; Becton Dickinson FACscan). GFP signals were analyzed by Flowjo, and represented by geometric mean values.

Supplementary Material

1

Supplementary Figure 1. Alignment of human and rabbit PDZD8 amino acid sequences. The region of human PDZD8 highlighted in red was included in the fusion protein with glutathione S-transferase (GST).

2

Supplementary Figure 2. Purification of the GST-PDZD8438-663 protein. The pre-induced (pre) and induced whole-cell lysates (wcl) from bacteria producing the GST-PDZD8438-663 protein are shown. The supernatants containing the soluble GST-PDZD8438-663 protein (sup) were applied to a Glutathione-Sepharose 4B column. The flow-through (FT), wash (W1 and W2) and eluate (E1-E3) fractions are shown. The gel was stained with Coomassie Brilliant Blue.

3
4

Highlights.

  • PDZD8 has been suggested to be a positive cofactor for retrovirus infection

  • PDZD8 expression was knocked out with CRISPR-CAS9 technology

  • PDZD8-knockout cells were infected by HIV-1 as efficiently as PDZD8-expressing cells

  • These results diminish PDZD8’s attractiveness as a potential target for intervention

Acknowledgements

We thank Ms. Yvette McLaughlin and Ms. Elizabeth Carpelan for manuscript preparation. We acknowledge the support of the National Institutes of Health (AI063987 and a Center for AIDS Research Award AI06354), the International AIDS Vaccine Initiative, and the late William F. McCarty-Cooper.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  • 1.Ganser BK, et al. Assembly and analysis of conical models for the HIV-1 core. Science. 1999;283(5398):80–83. doi: 10.1126/science.283.5398.80. [DOI] [PubMed] [Google Scholar]
  • 2.Pornillos O, Ganser-Pornillos BK, Yeager M. Atomic-level modelling of the HIV capsid. Nature. 2011;469(7330):424–427. doi: 10.1038/nature09640. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Ganser-Pornillos BK, Cheng A, Yeager M. Structure of full-length HIV-1 CA: a model for the mature capsid lattice. Cell. 2007;131(1):70–79. doi: 10.1016/j.cell.2007.08.018. [DOI] [PubMed] [Google Scholar]
  • 4.Forshey BM, et al. Formation of a human immunodeficiency virus type 1 core of optimal stability is crucial for viral replication. J Virol. 2002;76(11):5667–5677. doi: 10.1128/JVI.76.11.5667-5677.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Shi J, et al. Small-molecule inhibition of human immunodeficiency virus type 1 infection by virus capsid destabilization. J Virol. 2011;85(1):542–549. doi: 10.1128/JVI.01406-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Stremlau M, et al. Specific recognition and accelerated uncoating of retroviral capsids by the TRIM5alpha restriction factor. Proc Natl Acad Sci U S A. 2006;103(14):5514–5519. doi: 10.1073/pnas.0509996103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Sayah DM, et al. Cyclophilin A retrotransposition into TRIM5 explains owl monkey resistance to HIV-1. Nature. 2004;430(6999):569–573. doi: 10.1038/nature02777. [DOI] [PubMed] [Google Scholar]
  • 8.Lee K, et al. Flexible use of nuclear import pathways by HIV-1. Cell Host Microbe. 2010;7(3):221–233. doi: 10.1016/j.chom.2010.02.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Hori T, et al. A carboxy-terminally truncated human CPSF6 lacking residues encoded by exon 6 inhibits HIV-1 cDNA synthesis and promotes capsid disassembly. J Virol. 2013;87(13):7726–7736. doi: 10.1128/JVI.00124-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Fricke T, et al. Human cytosolic extracts stabilize the HIV-1 core. J Virol. 2013;87(19):10587–10597. doi: 10.1128/JVI.01705-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Li Y, Kar AK, Sodroski J. Target cell type-dependent modulation of human immunodeficiency virus type 1 capsid disassembly by cyclophilin A. J Virol. 2009;83(21):10951–10962. doi: 10.1128/JVI.00682-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Hatziioannou T, et al. Cyclophilin interactions with incoming human immunodeficiency virus type 1 capsids with opposing effects on infectivity in human cells. J Virol. 2005;79(1):176–183. doi: 10.1128/JVI.79.1.176-183.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Henning MS, et al. PDZD8 is a novel Gag-interacting factor that promotes retroviral infection. J Virol. 2010;84(17):8990–8995. doi: 10.1128/JVI.00843-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Guth CA, Sodroski J. Contribution of PDZD8 to stabilization of the human immunodeficiency virus type 1 capsid. J Virol. 2014;88(9):4612–4623. doi: 10.1128/JVI.02945-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Ye R, Zhang M. Structures and target recognition modes of PDZ domains: recurring themes and emerging pictures. Biochem J. 2013;455(1):1–14. doi: 10.1042/BJ20130783. [DOI] [PubMed] [Google Scholar]
  • 16.Walls D, Loughran ST. Tagging recombinant proteins to enhance solubility and aid purification. Methods Mol Biol. 2011;681:151–75. doi: 10.1007/978-1-60761-913-0_9. [DOI] [PubMed] [Google Scholar]
  • 17.Dai L, et al. IL-27 inhibits HIV-1 infection in human macrophages by downregulating host factor SPTBN1 during monocyte to macrophage differentiation. J Exp Med. 2013;210(3):517–534. doi: 10.1084/jem.20120572. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Kim HJ, et al. Targeted genome editing in human cells with zinc finger nucleases constructed via modular assembly. Genome Res. 2009;19(7):1279–1288. doi: 10.1101/gr.089417.108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Tebas P, et al. Gene editing of CCR5 in autologous CD4 T cells of persons infected with HIV. N Engl J Med. 2014;370(10):901–910. doi: 10.1056/NEJMoa1300662. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Hsu PD, Lander ES, Zhang F. Development and applications of CRISPR-Cas9 for genome engineering. Cell. 2014;157(6):1262–1278. doi: 10.1016/j.cell.2014.05.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Cong L, et al. Multiplex genome engineering using CRISPR/Cas systems. Science. 2013;339(6121):819–823. doi: 10.1126/science.1231143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Hou Z, et al. Efficient genome engineering in human pluripotent stem cells using Cas9 from Neisseria meningitidis. Proc Natl Acad Sci U S A. 2013;110(39):15644–15649. doi: 10.1073/pnas.1313587110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Haedicke J, et al. The Ezrin-radixin-moesin family member ezrin regulates stable microtubule formation and retroviral infection. J Virol. 2008;82(9):4665–4670. doi: 10.1128/JVI.02403-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Naghavi MH, et al. Moesin regulates stable microtubule formation and limits retroviral infection in cultured cells. EMBO J. 2007;26(1):41–52. doi: 10.1038/sj.emboj.7601475. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Henning MS, et al. PDZD8 is a novel moesin-interacting cytoskeletal regulatory protein that suppresses infection by herpes simplex virus type 1. Virology. 2011;415:114–121. doi: 10.1016/j.virol.2011.04.006. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1

Supplementary Figure 1. Alignment of human and rabbit PDZD8 amino acid sequences. The region of human PDZD8 highlighted in red was included in the fusion protein with glutathione S-transferase (GST).

2

Supplementary Figure 2. Purification of the GST-PDZD8438-663 protein. The pre-induced (pre) and induced whole-cell lysates (wcl) from bacteria producing the GST-PDZD8438-663 protein are shown. The supernatants containing the soluble GST-PDZD8438-663 protein (sup) were applied to a Glutathione-Sepharose 4B column. The flow-through (FT), wash (W1 and W2) and eluate (E1-E3) fractions are shown. The gel was stained with Coomassie Brilliant Blue.

3
4

RESOURCES