Screening and identification of the differential proteins in kidney with complete unilateral ureteral obstruction

Abstract

Obstructive nephropathy is a major cause of renal failure, particularly in infants and children, and indications for therapeutic intervention remain highly controversial. There is a great need for the development of new methods to monitor patients, and the biomarker research field is a promising approach for this purpose to be used as prognostic tools for early disease detection and the choice of the optimal treatment and monitoring. Here, we presented our comparative proteomics study of rat kidney with complete unilateral ureteral obstruction (CUUO). Proteins from the groups of CUUO and corresponding sham rat kidney tissues were subjected to 2-D gel electrophoresis, and then protein identification by mass spectrometry. We identified 39 proteins with differential expression between kidney tissues from sham operated group and those with CUUO. These identified proteins were reported to be involved in cell apoptosis, energy metabolism and injuries of mitochondrion and oxidative stress, and so on. We confirmed 3 identified proteins by immunoblot analysis and immunofluorescence staining and assessed their mRNA levels in renal tissues. Our results demonstrate protein alterations that reflect the pathological situation of the obstructed kidneys, which may help understand the relationship between oxidative stress and obstructive nephropathy.

Introduction

Antenatal obstruction which results in hydronephrosis constitutes the single most important identifiable cause of renal impairment in infants and children, the natural history of this disorder remains poorly understood, and indications for therapeutic intervention remain highly controversial [1]. The aim is to preserve renal function by selecting the 15-20% of patients who require early surgical intervention from those for whom watchful waiting may be appropriate because of spontaneous resolving/stabilization without a significant loss of renal function. Currently available clinical measures of renal structure and function (including renal ultrasonography, diuretic nuclide renal scans, and plasma creatinine concentration) are poor predictors of the future course for individual patients. Consequently, there is a great need for the development of new methods to monitor patients, and the biomarker research field is a promising approach for this purpose to be used as prognostic tools for early disease detection and the choice of the optimal treatment and monitoring [2].

The congenital obstructive nephropathy is characterized by an initial cellular proliferation, followed by apoptosis that leads to tubular atrophy and inevitable outcome of progressive fibrosis [3]. Epithelial-mesenchymal transition (EMT) is recognized to play pivotal roles in the process of fibrosis [4]. Considering podocytes and tubular cells which both undergo EMT we suspect that their EMT is held to involve an initial phase that results in renal fibrosis. Therefore, we meant to use the time point of podocytes and tubular cells undergoing EMT (1 day and 3 days after CUUO respectively) to search for biomarkers [5].

One approach in the search for biomarkers is to investigate the cytokines already known to be up- or down-regulated in types of nephropathy including hydronephrosis. After tested using acute and chronic obstruction experimental animal models, a prospective study was conducted with the patients referred for pyeloplasty. Another preferred and promising approach is to use a large-scale search by proteome analysis. A significant issue in this research is the inconsistency of the various studies, e.g., different definition criteria for UPJO, different inclusion criteria, different procedures for sample collection, etc [6,7]. Proteome results in disenable prediction of long-term evolution of the severity of the renal lesion.

Thus, we intended to use 2-D electrophoresis (2-DE) gel-based proteomics to analyze the protein profiles of kidney tissues with experimentally induced CUUO. Subsequently, the panel of proteins followed by an examination of the reproducibility of the data in the clinical study was tested to give new clues and thoughts for biomarkers of pathogenesis and renal injury, as well as molecular therapies that will prevent or reverse the renal structural and functional consequences of congenital obstructive nephropathy.

Materials and methods

Experimental animals

Twenty-four 2-month-old Sprague Dawley (SD) Rats weighing 200-250 g, half male and half female, were purchased from the Shengjing Hospital of China Medical University Experimental Animal Center. All animals were housed with a 12-h light/12-h dark cycle at 22°C and 55% ± 5% relative humidity. Food and water were provided ad libitum. All experiments were carried out under the Shengjing Hospital of China Medical University procedural and ethical guidelines.

Patients and specimens

This study was approved by Ethics Committee of China Medical University (Ethical Number: 2012 PS81K). Kidney tissues were obtained from 15 patients (10 males and 5 females) aged from 0.17 to 5 years old with hydronephrosis graded IV by SFU at the Shengjing Hospital of China Medical University. Fifteen control renal biopsy specimens were obtained from patients undergoing nephrectomy for nephroblastoma, and the tissues were confirmed histologically to be unaffected. Hydronephrotic tissues and normal tissues were collected respectively and identified by pathological H&E staining. Each tissue specimen was divided into two pieces, one piece was frozen at -80°C for molecular analysis, and the other piece was fixed in 10% neutral-formalin and embedded with paraffin.

Experimental protocol and surgical procedures

After general anesthesia with chloral hydrate, complete ureteral obstruction was accomplished by double-ligating the left ureter using 6-0 silk ties following a left lateral incision. Sham-operated rats had their ureters exposed and manipulated, but not ligated. The incision was closed in a single layer. The animals were allowed to recover from anesthesia, and then were placed on regular diets. On different time points (12 h, 24 h, 72 h) the animals were sacrificed under anesthesia, and the left kidney was excised, decapsulated, and measured immediately. Half was snap frozen in liquid nitrogen at -80°C. The other half was fixed in 10% neutral-formalin and embedded with paraffin and sectioned (4 μm) on a microtome (Leica) for light microscopy.

Two-dimensional gel electrophoresis

For 2-DE, renal tissues were treated with acetone precipitation method and homogenized in lysis buffer (7 M urea, 2 M thiourea, 4% [W/V] CHAPS, 2% [V/V] IPG buffer [pH 3-10], 40 mM 1, 4-dithioerythritol and 1 mM PMSF) followed by a 4-hour incubation at room temperature. After centrifugation, the supernatant was stored in aliquots at -80°C and the protein concentration was determined using the 2D-Quant Kit. 2-DE was performed as described and modified by Gorg et al [8]. We loaded 900 μg protein extract onto an IPG strip (24 cm, pH 3-10; GE Healthcare, Uppsala, Sweden). For the first-dimension isoelectric focusing, the IPG strip was rehydrated with 450 μl of solubilized sample at 30 V for 12 h on an IPGphor (GE Healthcare). IEF followed a multi-step protocol: 300 V for 900 V hr, gradient up to 600 V for 1350 V hr, gradient up to 1000 V for 2400 V hr, gradient up to 8000 V for 13,500 V hr and finally 8000 V was held for 56,000 V hr at 20°C. The IPG strips were equilibrated in 10 ml equilibration solutions (6 M urea, 30% glycerol, 2% sodium dodecyl sulfate [SDS], 115 mM Tris-HCl [pH 8.8], 20 mM dithiothreitol [DTT]) for 15 min, and then equilibrated in the same solution containing 100 mM iodoacetamide instead of DTT. SDS-PAGE involved use of 12.5% polyacrylamide gels in the Ettan DALT twelve systems (GE Healthcare). Following SDS-PAGE, gels were stained with modified colloidal Coomassie Brilliant Blue (mcCBB) G-250 as described [9]. For 2-DE, we pooled the proteins for 6 kidney tissues from each experimental group. For comparing 4 experimental groups, we ran a set of 12 gels, with one pooled sample run in triplicate per group for good reproducibility.

Image acquisition and data analysis

CBB-stained gels were scanned by use of a PowerLook 2100XL image scanner (Umax, Taiwan). Spot detection, quantification, and matching involved use of 2-D gel analysis software (Image Master 2-D platinum 6.0, GE Healthcare) with the CBB-stained gels. The relative volume of spots [% vol. calculated as the spot volume (the sum of the intensities of the pixel units within the protein spot) normalized as a percentage of the total volume of all the spots present in a gel] was obtained from 3 parallel experiments. Spots with at least 1.5-fold difference in % Vol showing statistical significance (P < 0.05) were defined as differentially expressed proteins and were excised for further analysis.

In-gel digestion and MALDI-TOF MS

Selected spots were chosen manually. CBB-stained spots were destained in 50% acetonitrile (ACN) in 25 mM ammonium bicarbonate buffer and dried in the SpeedVac. The dried gel fragments were re-hydrated in trypsin solution (15 μg/ml) for 1 h at 4°C, followed by the addition of 5 ml 25 mM ammonium bicarbonate buffer to completely immerse the gel fragments. After incubation for 16 h at 37°C, the digested peptides were extracted from the gel fragments with use of 5% trifluoroacetic acid (TFA) and 2.5% TFA/50% ACN at 37°C for 1 h separately. Tryptic peptides were finally dissolved in MALDI matrix (5 mg/ml α-cyana-4-hydroxycinnamic acid in 0.1% TFA and 50% ACN), spotted onto 192-well stainless steel MALDI target plates, and analyzed by use of an ABI 4800 Proteomics Analyzer MALDI-TOF/TOF mass spectrometer (Applied Biosystems, USA). The MS and MS/MS spectra were subsequently searched against the SwissProt 2012_03 rat database, with use of GPS (Applied Biosystems, USA) and MASCOT (Matrix Science, London, UK) database search algorithms with the search criteria trypsin specificity, cysteine carbamidomethylation (C) and methionine oxidation (M) as variable modifications, 1 trypsin miscleavage allowed, 50 ppm MS tolerance and 0.5 Da MS/MS tolerance. Protein identifications were accepted with a Mowse score ≥ 23 and a P < 0.05.

Immunoblot analysis

In total, 20 μg protein extract from rats and patients was separated by 12% SDS-PAGE and then transferred with Tris-HCl methanol (20 mM Tris, 150 mM glycine, 20% methanol) onto polyvinylidene difluoride membranes (Millipore, USA) in a trans-blot electrophoresis transfer cell (Bio-Rad). Blotting was probed with antibodies against PRDX1 (1:2000 Abcam, Hong Kong), GSTP1 (1:3000 Abcam, Hong Kong), GPX1 (1:1000 Abcam, Hong Kong), or actin (1:2000 Santa Cruz Biotechnology). All immunoblots were run at least in triplicate. Visualization of the antigen-antibody complexes involved use of enhanced chemiluminescence reagents (Pierce Biotechnology, Rockford, IL, USA). Detected bands were quantified by ImageJ2x software. The relative density of each protein was calculated by dividing the optical density value of each protein by that of loading control.

Hematoxylin and eosin staining and immunofluorescence staining

Hydronephrotic tissue segments and normal tissue segments from patients were identified by H&E staining (Figure 1). Tissue sections were pre-treated using pressure cooker heat-induced antigen retrieval for 2 minutes and then incubated with polyclonal antibody PRDX1 (1:200), GSTP1 (1:200) and GPX1 (1:200) overnight and then secondary antibody for 4 h at room temperature. DAPI was used to stain the cell nuclei.

Figure 1.

Photomicrographs of hydronephrotic and the control kidney by H&E. A: Hydronephrotic kidney segment tissue. B: Control kidney segment tissue. A and B: × 200.

Real-time quantitative PCR

Total RNA was extracted from patients by use of TRIzol reagent (Invitrogen) according to the manufacturer’s protocol. cDNA syntheses involved use of 3 μg RNA with the TaKaRa RNA PCR kit (Takara). Real-time PCR amplifications were performed in triplicate on a Light Cycler (Roche Applied Science) with the primers in Table 1. The house keeping gene β-actin (Takara DR3783) was used as an endogenous control. The relative mRNA levels for each sample were calculated by the 2^-ΔΔct method.

Table 1.

Primers for real-time PCR

Target	Forward (5’-3’)	Reverse (5’-3’)
PRDX1	CGCGAGATCCCTACTGGCTA	TCCCAACACAAGTCGCAGAA
GSTP1	CTATGGGAAGGACCAGCAGG	TGGTCTCCCACAATG
GPX1	CAGTCGGTGTATGCCTTCTCG	GAGGGACGCCACATTCTCG
β-actin	AGAGCTACGAGCTGC	AGCACTGTGTTGGCG

Statistical analysis

Data for are expressed as means ± SD (vol. % of spots for 2-DE analysis, relative density of bands on immunoblot analysis, and 2^-ΔΔct value of each sample for real-time quantitative PCR as parametric data). Two-tailed Student’s t-test was employed for analyzing significant differences from the sham group. Two-way ANOVA was applied to analyze differences between groups of CUUO. And a P < 0.05 was considered statistically significant.

Results

Morphological changes of the obstructed kidney

By gross anatomy, the rat kidney of CUUO group appeared as increased kidney volume, visible hydronephrosis and dilated renal pelvis. The damage got more and more severe with the obstruction persisting. The rat kidney of sham operated group showed normal morphology.

Protein profiles of rat kidney tissues from sham operated group and those with CUUO

The rat kidney tissue proteome contained about 800 detectable proteins on a single mcCBB-stained 2-DE gel (Figure 2). More than 80% of protein spots were matched on 4 sets of CBB-stained gels. Overall, the 2-DE protein spot patterns across all the gels were similar for sham operated group normal rat kidneys and those with CUUO. We found 69 protein spots with at least 1.5-fold difference in vol. % (P < 0.05) between kidney tissues from sham operated group and those with CUUO and dissected them for further analysis. Of 69 dissected spots, unduplicated 39 were identified by MS as differentially expressed (Table 2A-C).

Figure 2.

2-DE of protein profile of rat kidney tissues from sham operated group and those with CUUO. Representative Coomassie-stained 2-DE gels of expression maps of proteins in CUUO12h (A), CUUO24h (B), CUUO72h (C) and sham operated group (D). Numbers indicate the differently expressed protein spots in Table 2A-C.

Table 2.

Proteins with differential expression in the groups of CUUO and corresponding sham rat kidney tissues identified by MALDI-TOF MS. Spot no. was defined according to spot positions in the 2-DE gel as indicated in Figure 1. ↑ means the protein level in the groups of CUUO increased compare with corresponding sham rat kidney tissues; ↓ means the protein level in the groups of CUUO decreased compare with corresponding sham rat kidney tissues

A. In the groups of CUUO12h and corresponding sham rat kidney tissues
		Protein name	Accession no.	Mr (kDa)/PI	Mascot score	Expression	Function
1	PDIA6	Protein disulfide-isomerase A6	Q63081	48/5.00	43	↑	Inhibit misfolded proteins
2	AGT2	Alanine--glyoxylate aminotransferase 2, mitochondrial	Q64565	57/8.33	100	↑	Energy metabolism
3	ABHEB	Abhydrolase domain-containing protein 14B	Q6DGG1	22/5.65	120	↑	Hydrolase and transcription
4	ARK73	Aflatoxin B1 aldehyde reductase member 3	P38918	36/6.80	83	↑	AFB1 metabolism
5	GPX41	Phospholipid hydroperoxide glutathione peroxidase, mitochondrial	P36970	22/8.74	78	↑	Antioxidation
6	BCAT2	Branched-chain-amino-acid aminotransferase, mitochondrial	O35854	44/8.46	108	↑	Energy metabolism
7	SPA3N	Serine protease inhibitor A3N	P09006	46/5.32	104	↑	Fibrotic remodeling gene
8	MEP1A	Meprin A subunit alpha	Q64230	85/5.65	117	↑	Anti-inflammatory role
9	ODBA	2-oxoisovalerate dehydrogenase subunit alpha, mitochondrial	P11960	50/7.68	43	↑	Energy metabolism
10	GBB2	Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-2	P54313	37/5.60	126	↑	Signaling transduction
11	ANXA1	Annexin A1	P07150	38/6.97	83	↑	Calcium/phospholipid-binding protein
12	THTR	Thiosulfate sulfurtransferase	P24329	33/7.71	141	↑	Import factor for 5S rRNA
13	ANXA2	Annexin A2	Q07936	38/7.55	214	↑	Calcium/phospholipid-binding protein
14	GSTM2	Glutathione S-transferase Mu 2	P08010	25/6.91	104	↑	Reduced glutathione metabolism
15	ETFB	Electron transfer flavoprotein subunit beta	Q68FU3	27/7.61	110	↑	Energy metabolism
16	ATPB	ATP synthase subunit beta, mitochondrial	P10719	56/5.18	334	↑	Energy metabolism
17	VDAC2	Voltage-dependent anion-selective channel protein 2	P81155	31/7.44	35	↑	Channel protein
18	PRDX1	Peroxiredoxin-1	Q63716	22/8.27	47	↑	Antioxidation
19	FIBB	Fibrinogen beta chain	P14480	54/7.89	176	↑	Polymerize into fibrin
20	ATP5h	ATP synthase subunit D, mitochondrial	P31399	18/6.16	65	↑	Energy metabolism
21	PEBP1	Phosphatidylethanolamine-binding protein 1	P31044	20/5.47	48	↑	Raf kinase inhibitory proteins
B. In the groups of CUUO24h and corresponding sham rat kidney tissues
		Protein name	Accession no.	Mr (kDa)/PI	Mascot score	Expression	Function
1	GSTP1	Glutathione S-transferase P	P04906	23/6.89	167	↑	Antioxidation
2	ROA2	Heterogeneous nuclear ribonucleoproteins A2/B1	A7VJC2	37/8.97	304	↑	Pre-mRNA process
3	KAD4	Adenylate kinase isoenzyme 4, mitochondrial	Q9WUS0	25/7.80	265	↑	Energy metabolism
4	ALD1	Aldose reductase-related protein 1	Q5RJP0	36/7.68	26	↑	Antioxidation
5	GATM	Glycine amidinotransferase, mitochondrial	P50442	48/7.17	85	↑	Energy metabolism
6	SPA3N	Serine protease inhibitor A3N	P09006	46/5.32	102	↑	Fibrotic remodeling gene
7	GGT1	Gamma-glutamyltranspeptidase 1	P07314	61/7.21	22	↑	Antioxidation
8	IDH3A	Isocitrate dehydrogenase [NAD] subunit alpha, mitochondrial	Q99NA5	39/6.46	93	↓	Energy metabolism
9	AL9A1	4-trimethylaminobutyraldehyde dehydrogenase	Q9JLJ3	53/6.57	188	↓	Carnitine biosynthesis enzymes
C. In the groups of CUUO72h and corresponding sham rat kidney tissues
		Protein name	Accession no.	Mr (kDa)/PI	Mascot score	Expression	Function
1	3HAO	3-hydroxyanthranilate 3,4-dioxygenase	P46953	32/5.57	101	↑	Catalyzes the oxidative ring
2	Anxa4	Annexin A4	P55260	35/5.30	68	↑	Calcium/phospholipid-binding protein
3	A1AT	Alpha-1-antiproteinase	P17475	46/5.70	107	↑	Inhibitor of serine proteases
4	ALBU	Serum albumin	P02770	68/6.09	188	↑	Colloidal osmotic pressure of blood
5	SPA3N	Serine protease inhibitor A3N	P09006	46/5.32	104	↑	Fibrotic remodeling gene
6	MUP	Major urinary protein	P02761	20/5.85	286	↓	Bind ,release and protect pheromones
7	CMBL	Carboxymethylenebutenolidase homolog	Q7TP52	27/6.24	73	↓	Cysteine hydrolase
8	GSTP1	Glutathione S-transferase P	P04906	23/6.89	363	↓	reduced glutathione metabolism
9	GPX1	Glutathione peroxidase 1	P04041	22/7.70	123	↓	Antioxidation
10	ACY3	Aspartoacylase-2	Q5M876	35/5.42	64	↓	Energy metabolism
11	ODPB	Pyruvate dehydrogenase E1 component subunit beta, mitochondrial	P49432	38/6.20	267	↓	Energy metabolism
12	ACTA	Actin, aortic smooth muscle	P62738	42/5.24	39	↓	Cell motility

Immunoblot analysis of selected proteins

We selected 3 proteins for immunoblot analysis. In rat, PRDX1 was enhanced in CUUO12h and GPX1 was down-regulated in CUUO72h compared with the control group, while GSTP1 was continuously up-regulated with sustained obstruction and in CUUO72h was lower than in control group. The result is consistent with the results of 2D-E (P < 0.05). Similarly, the higher expression of PRDX1, GSTP1 and GPX1 proteins in the hydronephrosis were detected by immunoblot (Figure 3).

Figure 3.

Immunoblot analysis of PRDX1, GSTP1 and GPX1. A: Analysis of protein expressions of PRDX1, GSTP1 and GPX1 with actin as the internal control in rat kidney by immunoblotting. Sham indicates those in control group, C12 indicates those in CUUO12h group, C24 indicates those in CUUO 24 h group, and C72 those in CUUO72h group. B: Quantification of immunoblot result. Relative density of PRDX1, GSTP1 and GPX1 protein in rat kidney. C: Expressions of PRDX1, GSTP1 and GPX1 proteins in the clinical tissues were detected by immunoblot. N indicates those in normal group, and H those in hydronephrosis. D: Quantification of immunoblot result. Relative density of PRDX1, GSTP1 and GPX1 protein in the clinical tissues. *P < 0.05.

Transcription levels of selected proteins

Compared with the normal kidneys, those with hydronephrosis showed increased mRNA levels of GPX1 by 1.51-fold (P < 0.05) (Table 3A). The normal kidneys and those with hydronephrosis did not differ in mRNA expression of PRDX1 or GSTP1 (P > 0.05) (Table 3B and 3C).

Table 3.

The mRNA expressions of GPX1, PRDX1 and GSTP1 with actin as the internal control in hydronephrosis by real-time PCR

A. The relative quantity of GPX1 mRNA in two segments
Segment	GPX1	β-actin	ΔCt	ΔΔCt	Times of gene (compared to normal)
	Average Ct value	Average Ct value
Hydronephrosis	23.25 ± 2.13	23.24 ± 2.46	0.01	-0.57	1.51
Normal	24.52 ± 1.44	23.94 ± 1.45	0.58	0	1
B. The relative quantity of PRDX1 mRNA in two segments
Segment	PRDX1	β-actin	ΔCt	ΔΔCt	Times of gene (compared to normal)
	Average Ct value	Average Ct value
Hydronephrosis	24.06 ± 1.74	23.24 ± 2.46	0.82	-0.19	1.14
Normal	24.95 ± 1.24	23.94 ± 1.45	1.01	0	1
C. The relative quantity of GSTP1 mRNA in two segments
Segment	GSTP1	β-actin	ΔCt	ΔΔCt	Times of gene (compared to normal)
	Average Ct value	Average Ct value
Hydronephrosis	23.33 ± 2.29	23.24 ± 2.46	0.09	-0.12	1.09
Normal	24.15 ± 1.82	23.94 ± 1.45	0.21	0	1

Immunofluorescence staining of selected proteins

The tissue segments were first defined by H&E staining (Figure 1). In hydronephrosis, the tissues appeared as visible dilated tubules mainly located in collecting tubules and other distal tubules, flattened tubular epithelial cells, expansive Bowman capsules and glomerular infiltration by inflammatory cells. As to the control group, no abnormal and tumor cell infiltration were found. Besides, immunofluorescence staining was also found that PRDX1, GSTP1 and GPX1 have a significant increase in cytoplasm of tubules and glomeruli from hydronephrosis compared with normal kidney (Figure 4).

Figure 4.

Expressions of PRDX1, GSTP1 and GPX1 detected by immunofluorescence in hydronephrotic and the control kidney segment tissue (× 400). They all located in cytoplasm of tubules and glomeruli. A: PRDX1 in hydronephrosis. B: PRDX1 in control group. C: GSTP1 in hydronephrosis. D: GSTP1 in control group. E: GPX1 in hydronephrosis. F: GPX1 in control group.

Discussion

Protein ultimately implements function of the gene and therefore is the direct decoder of the complexity and variability of life events. Proteomics studies facilitate the direct understanding of the mechanism of the physiological and pathological process. Post-translational modifications, protein-protein interactions protein conformation, etc. cannot only be solved on an RNA level, but depend on direct study of the protein using proteomic technologies. Therefore, identification of the protein expression profile of renal tissues at the time point of podocytes and tubular cells undergoing EMT helps to explore the pathogenesis of renal injury and look for biomarkers of disease progression, as well as molecular therapies that will prevent or reverse the renal structural and functional consequences of obstructive nephropathy.

In this study, high-resolution, reproducible 2-DE maps for CUUO and sham tissues were prepared. Sixty-nine protein spots differentially expressed proteins by more than 1.5-fold were subjected to peptide mass fingerprinting for protein identification. A total of thirty-nine differential proteins were successfully identified, which participate in the regulation of cytoskeleton, glucose metabolism, signal transduction, cell apoptosis, mitochondrial energy metabolism and oxidative stress, and so on. This reflected the complexity of protein expressions in the process of renal injury.

Among the differently expressed proteins, GSTP1, GSTM2, ALD1, GGT1, GPX1, GPX41 and PRDX1 have functions in the regulation of antioxidation related to oxidative stress which contributes importantly to the pathogenesis of obstructive nephropathy. Various markers of oxidative stress are increased in UUO kidneys, such as the oxidatively damaged protein product, Nε-carboxymethyl-lysine (CML) [10], the marker of DNA oxidant damage, 8-hydroxy-2’-deoxyguanosine (8-OHdG) [11], and lipid peroxidation markers, 4-hydroxynonenal (4-HNE) [12], oxidant stress response molecules like heats hock protein-70 (HSP-70) [13], and hemeoxygenase-1 (HO-1) [14] are strongly expressed after obstruction. Currently, there have no studies on our above-mentioned proteins in obstructed kidneys. Thus, our discovery is expected to give new clues and thoughts for further revealing how the regulations of oxidative stress were involved in the formation stages and pathogenesis of obstructive nephropathy.

These proteins are all known to be involved in oxidative stress. Following the obstruction, a reduction in blood supply [15] (hypoxia or ischemia) mediated by increased activity of the rennin-angiotensin system stimulates the intracellular reactive oxygen species (ROS) production [16,17], which in turn induces oxidative stress. Under more severe and longer oxidative injury, increased renal concentrations of ROS, together with decreased activities of the major protective antioxidant enzymes in obstructed kidneys have been observed [18]. Oxidative stress may contribute to abnormal signal transduction or cellular dysfunction and initiate the monocyte/macrophage (ED-1) infiltration [19] and the apoptosis even fibrosis regulated via the balance between the pro-apoptotic factor like Bax and anti-apoptotic factor Bcl-2 [20] or via the downstream signaling involving TGF-β1, phospholipase D, and Ca²⁺ in mesangial cells [21]. Therefore, oxidative stress plays vital roles in the regulation of inflammation, apoptosis and fibrosis [22,23].

PRDX1, GSTP1 and GPX1 which we have successfully screened are all involved in redox regulation of the cell. With eliminating intracellular concentrations of H₂O₂, PRDX1 plays an important role in reducing peroxides generated during metabolism and regulating cell proliferation, differentiation and apoptosis [24]. GSTP1 gives a full play in antioxidative stress by conjugating of reduced glutathione to a wide number of exogenous and endogenous hydrophobic electrophiles [25]. While GPX1 regulates the oxidative stress by catalyzing glutathione to react with H₂O₂ and decomposing lipid peroxide [26].

Proteomics screening results alone can not serve as the basis for further to determine. So, we performed in-depth studies of the 3 differential expressed proteins and used immunoblot analysis to confirm the proteomics results in rat models and assessed their mRNA and protein levels in clinical studies. We demonstrate protein alterations that reflect the pathological situation of the obstructed kidneys may help understand the relationship between oxidative stress and obstructive nephropathy.

In rat kidney, our immunoblot analysis confirmed their differential expression which is consistent with the results of 2D-E (Figure 3A, 3B). No matter how each protein changes, in general, their expression is relatively high in early obstruction, relatively low in late obstruction. We speculate that their up-regulation in the early may be an attempt to compensate the reduced activity of enzymes, which play the role in oxidative stress with increased levels of ROS. From the viewpoint of EMT, they are bound to become gradually down-regulated with consuming in advanced stages.

The selected panel of anti-oxidative proteins was examined in the animal model of acute obstruction followed by an examination of the reproducibility of the data in the kidney tissue samples from the clinical study. In this section, we used qRT-PCR, immunofluorescence staining and immunoblot based molecular biology study to investigate the differential expressions in mRNA and protein levels between the hydronephrotic kidney and the normal kidney in order to get more information about oxidative stress injury. We analyzed and found that PRDX1, GSTP1 and GPX1 proteins were all up-regulated in hydronephrosis compared with normal kidney by immunoblot (Figure 3C, 3D). However, our real-time PCR analysis revealed only GPX1 with results for mRNA level consistent with those for protein level (Table 3A). It implied the changes of PRDX1 and GSTP1 in clinical was not at the mRNA level (Table 3B, 3C). With the knowledge of noncoding RNA, RNA is not merely an intermediary between DNA and protein. mRNA is not always translated into protein [27]. For example, microRNA base pairs have complimentary regions of target mRNAs to silence gene expression post-transcriptionally. The inconsistency between mRNA and protein expression for PRDX1 and GSTP1 might be caused by posttranscriptional regulation. Similarly, the higher expression of PRDX1, GSTP1 and GPX1 proteins located in cytoplasm of tubules and glomeruli were detected by immunofluorescence staining. With hydronephrosis graded IV by SFU equal to animal models of advanced obstruction, this study showed counter results that their expressions for protein level are all up-regulated, but not down-regulated. For the possible reasons about their higher expression levels in the hydronephrotic tissues, we postulate that the moment when clinical surgical interventions were done, it perhaps was still in a relatively early period of throughout course, and the relief of obstruction at this moment may contribute to long-term recovery of kidney damage. If more sample sizes enable further grouping are obtained, the experimental results might clearly show the correlations between different degrees of hydronephrosis and protein expression levels. Whether upregulation of PRDX1, GSTP1 and GPX1 in hydronephrosis reflects an attempt by antioxidants to increase, a protective effect, or promotion of balance between oxidation and antioxidation is unknown. Further investigation is required to reveal the role of PRDX1, GSTP1 and GPX1 in injury to the obstructed kidneys, which is critical for understanding mechanisms and biomarkers of obstructive nephropathy. Renal injuries may be reduced if we modulate the expressions of PRDX1, GSTP1 and GPX1 by gene therapy besides surgery.

There are also some details about function properties of the three proteins that need further studying. The exact mechanism that how their over expressions affect the development of obstructive nephropathy needs further research. All in all, in this article, our study shows that PRDX1, GSTP1 and GPX1 are differentially expressed in mRNA and/or protein levels between the hydronephrotic and normal tissues, suggesting that they may be a protective factor of the hydronephrosis patients. Their change might provide more resources for further investigation of the mechanisms and biomarkers basis in obstructive nephropathy.

In conclusion, we provide an overview of proteomic changes in the groups of CUUO and corresponding sham rat kidney. We found differentially expressed proteins caused by the primary defect or secondary injuries of the obstructive nephropathy. These proteins possess diverse functions such as cell apoptosis, energy metabolism and injuries of mitochondrion and oxidative stress. The precise role of antioxidant enzymes they play in obstructive nephropathy awaits further investigation. Our study might provide more insights into the pathogenesis of obstructive nephropathy and contribute to looking for biomarkers of renal injury of obstructive nephropathy.

Disclosure of conflict of interest

None.