Skip to main content
Lipids in Health and Disease logoLink to Lipids in Health and Disease
. 2015 May 22;14:49. doi: 10.1186/s12944-015-0045-y

Effect of Ganoderma lucidum spores intervention on glucose and lipid metabolism gene expression profiles in type 2 diabetic rats

Fang Wang 1,4, Zhongkai Zhou 1,4,, Xiaochong Ren 1, Yuyang Wang 1, Rui Yang 1, Jinhua Luo 2, Padraig Strappe 3
PMCID: PMC4443549  PMID: 25994182

Abstract

Background

The fruiting body of Ganoderma lucidum has been used as a traditional herbal medicine for many years. However, to the date, there is no detailed study for describing the effect of G. lucidum spores on oxidative stress, blood glucose level and lipid compositions in animal models of type 2 diabetic rats, in particular the effect on the gene expression profiles associated with glucose and lipid metabolisms.

Methods

G. lucidum spores powder (GLSP) with a shell-broken rate >99.9 % was used. Adult male Sprague–Dawley rats were randomly divided into three groups (n = 8/group). Group 1: Normal control, normal rats with ordinary feed; Group 2: Model control, diabetic rats with ordinary feed without intervention; Group 3: GLSP, diabetic rats with ordinary feed, an intervention group utilizing GLSP of 1 g per day by oral gavages for 4 consecutive weeks. Type 2 diabetic rats were obtained by streptozocin (STZ) injection. The changes in the levels of glucose, triglycerides, total cholesterol and HDL-cholesterol in blood samples were analyzed after GLSP intervention. Meanwhile, gene expressions associated with the possible molecular mechanism of GLSP regulation were also investigated using a quantitative RT-PCR.

Results

The reduction of blood glucose level occurred within the first 2 weeks of GLSP intervention and the lipid synthesis in the diabetic rats of GLSP group was significantly decreased at 4 weeks compared to the model control group. Furthermore, it was also found that GLSP intervention greatly attenuated the level of oxidative stress in the diabetic rats. Quantitative RT-PCR analysis showed up-regulation of lipid metabolism related genes (Acox1, ACC, Insig-1 and Insig-2) and glycogen synthesis related genes (GS2 and GYG1) in GLSP group compared to model control group. Additionally, there were no significant changes in the expression of other genes, such as SREBP-1, Acly, Fas, Fads1, Gpam, Dgat1, PEPCK and G6PC1.

Conclusion

This study might indicate that GLSP consumption could provide a beneficial effect in terms of lowering the blood glucose levels by promoting glycogen synthesis and inhibiting gluconeogenesis. Meanwhile, GLSP treatment was also associated with the improvement of blood lipid compositions through the regulation of cholesterol homeostasis in the type 2 diabetic rats.

Electronic supplementary material

The online version of this article (doi:10.1186/s12944-015-0045-y) contains supplementary material, which is available to authorized users.

Keywords: Ganoderma lucidum, Blood glucose, Lipid composition, Gene expression, Type 2 diabetes

Introduction

Diabetes mellitus (DM) is a metabolic disorder caused by a lack of insulin and/or pancreatic dysfunction characterized by hyperglycemia. DM is a common, morbid and costly disease, affecting more than 1 in 10 adults in both United States and China [1]. DM is the leading cause of new blindness, amputation and end-stage renal diseases and it also contributes to a host of other conditions. Although there is no published data for the medical cost of diabetes in China in recent years, the medical costs of managing DM and its complications exceeded $115 billion in the United States alone in 2011 and the indirect costs added another $58 billion [1]. Evidence suggests that DM complications can be markedly attenuated with appropriate control of blood pressure and hyperglycemia and with successful treatment of hyperlipidemia. Thus, there is a great interest in novel approaches to indirect DM management. However, despite the increasing number of drugs available for DM treatment, significant improvements in the control of DM have not been observed [2].

Previous studies have confirmed that the treatment with natural antioxidants can reduce diabetic complications [3] and the continuous efforts to discover new antioxidants as useful drug candidates to combat diabetic complications are on-going. Ganoderma lucidum (Leyss; Fr) Karst. (Ganodermataceae) is a well-known Chinese traditional medicine which has been clinically used in China, Japan and Korea for more than 2000 years. Mushrooms of the genus Ganoderma have been shown to be a rich source of biologically active metabolites [4], containing many bioactive components, including triterpenoids, polysaccharides, nucleotides, sterols, steroids, peptides and other bioactive ingredients [5]. G. lucidum spores contain high levels of ganoderic acids, ergosterol peroxide and pentadecanoate [6]. Many are active against current major chronic diseases. For example, ganoderic acids, one group of triterpenoids existing in the fruiting body of G. lucidum showed anti-androgenic, anti-5 α-reductase, anti-inflammatory and anti-tumor and a range of other biological activities [79].

Although the fruiting body of G. lucidum has been used as a traditional herbal medicine since ancient times, the spores were utilized only in the late 20th century [10]. The spores contain many bioactive substances, including lanostane type triterpenes [11] and polysaccharides [12] similar to those in the fruiting body [13]. Other characteristics of the bioactive compounds existing in the spores are those they are also rich in fatty acids, in particular long-chain C-19 fatty acids. Previous study demonstrated that these fatty acids could inhibit tumor cell proliferation and induce apoptosis in the HL-60, promyelocytic leukemic cell line [14]. Meanwhile, other research also showed the potential anti-hyperglycemic effect in diabetic rats using polysaccharides extracted from G. lucidum fruiting body [15]. However, to the date, few detailed studies described the effects of G. lucidum spores on blood glucose and lipid compositions in streptozotocin (STZ) induced diabetic rats and neither of the investigation of G. lucidum spores intervention on the gene expression of glucose and lipid metabolisms has been reported in above diabetic model. To the best of our knowledge, there are few reports in the literature evaluating the feasibility of using G. lucidum spores as a potential anti-diabetic agent and the descriptions of the molecular mechanism(s) involved in these processes are also very rare. Moreover, the co-existing of the multi-active compounds in G. lucidum spores might provide a stronger synergistic or positively effect on improving the diabetic status than the consumption of the single active compound. Therefore, in this study, STZ-induced-diabetic rats are used to investigate the changes in the expression levels of genes involved in lipid and glucose metabolisms after G. lucidum spores treatment.

Results

Effect of GLSP intervention on the body mass of diabetic rats

There was no significant difference in the initial weights among the three groups (P = 0.6925) (Additional file 1: Table S1), indicating that the random grouping was acceptable. The body mass of the rats in the normal control group gradually increased at 4 weeks, suggesting that the dietary composition designed was appropriate. After the injection of STZ, the rats in the two diabetic groups (i.e. model control group and GLSP intervention group) displayed a reduction of body mass gain and the weight of the diabetic rats was lower than that of the normal control group (P > 0.01) during the 4 consecutive weeks, suggesting that the diabetic disease greatly affected the normal development of these rats. There was no significant difference in the body mass between the model control and GLSP intervention group (P = 0.6099) within the first 3 weeks. At the fourth week, the body mass of GLSP group was higher by 9.0 % (P > 0.05) compared to that of model group, indicating that GLSP consumption could partially recover the weight loss after 4 weeks treatment.

Effect of GLSP intervention on blood glucose and insulin levels in the diabetic rats

Following the injection of STZ, these animals displayed the expected symptoms of insulin-dependent diabetes mellitus, i.e. hyperglycemia, with glucose level around 30 mmol/L within 72 h of STZ injection. This symptom remained relatively constant during the 4 subsequent weeks. As shown in Table 1, GLSP intervention for 4 weeks led to a 21.0 % reduction of blood glucose level compared to its corresponding initial level. Moreover, the blood glucose level of the rats in GLSP group was significantly lower than that of rats in model control group (P < 0.05). Rats of GLSP intervention at 4 weeks also exhibited a significant increase in the insulin level compared to the rats of model control group (P < 0.05, unpublished data).

Table 1.

Effect of GLSP intervention on blood glucose level

Blood glucose level (mmol/L) RMANOVA F value P value
Group 72 h 1 week 2 week 3 week 4 week
Normal control 5.96 ± 0.64b 5.80 ± 0.83b 5.72 ± 0.29b 5.82 ± 0.79b 6.20 ± 0.52c 0.633 0.646
Model control 32.28 ± 1.00a 30.00 ± 3.32a 24.12 ± 6.60a 30.96 ± 3.04a 32.22 ± 1.71a 3.485 0.028
GLSP intervention 30.79 ± 2.72a 28.19 ± 8.32a 25.27 ± 3.98a 25.52 ± 7.48a 24.31 ± 1.17b 11.125 <0.001**

Results are expressed as means ± SD (n = 8, one-way ANOVA). Different superscript lowercase letters on the table indicate significant difference (P < 0.05). RMANOVA: Repeated measures ANOVA. **Strongly significant (P value: P < 0.001). Normal control: healthy rats without intervention; Model control: STZ induced diabetic rats without intervention; GLSP intervention: STZ induced diabetic rats with GLSP intervention

Effect of GLSP intervention on blood lipid compositions

As shown in Table 2, diabetic rats in the model control group had a significant higher in blood triglyceride (TG) (P < 0.01) and total cholesterol (TC) (P < 0.01) compared to the normal rats. Following the therapeutic treatment of GLSP, the blood TG fell significantly by 49.0 % and TC reduced by 17.8 %, respectively, as compared to the non-treatment group (i.e. model control) (Table 2). Although GLSP intervention did not attenuate the level of TG and TC to a normal status, this study found that G. lucidum intervention could significantly enhance the level of high density lipoproteincholesterol (HDL-c) by 48.6 % (P < 0.01) compared to the model control. It is interesting to note that there was no significant difference in HDL-c between normal group and GLSP intervention group (P = 0.6850).

Table 2.

Effect of GLSP intervention on blood TG, TC and HDL-c in diabetic rats

Group TG (mmol/L) TC (mmol/L) HDL-c (mmol/L)
Normal control 0.29 ± 0.00c 2.96 ± 0.07c 2.90 ± 0.07a
Model control 2.92 ± 0.27b 5.57 ± 0.47b 1.32 ± 0.45b
GLSP intervention 1.49 ± 0.55a 4.58 ± 0.09a 2.57 ± 0.29a

Results are expressed as means ± SD (n = 8, one-way ANOVA). Different superscript lowercase letters on the table indicate significant difference (P < 0.05). TG triglyceride, TC total cholesterol, HDL-c high density lipoprotein cholesterol

Effect of GLSP intervention on oxidative stress level

High level of blood glucose for a long term could induce mitochondrial reactive oxygen species (ROS). Thus, malondialdehyde (MDA) and ROS are the biomarkers commonly used for providing a reasonable index of oxidative stress status. Diabetic disease significantly increased the levels of oxidative stress (Table 3). For example, the blood MDA of diabetic rats without intervention (model control) increased by 42.3 % (P < 0.01) compared to normal ones and this was consistently accompanied by a significant increase in ROS as well (Table 3).

Table 3.

Effect of GLSP intervention on the level of oxidative stress in diabetic rats

Group MDA (nmol/mL) ROS (U/mL) GSH-Px (U/mg prot.) SOD (U/mg prot.)
Normal control 6.49 ± 1.9a 53.96 ± 3.8a 1689.65 ± 220.1a 210.65 ± 7.7b
Model control 11.24 ± 0.2b 65.12 ± 7.6a 1223.26 ± 216.1b 179.26 ± 3.7c
GLSP intervention 9.68 ± 0.7a 61.12 ± 4.2a 1785.26 ± 259.7a 289.13 ± 4.0a

Results are expressed as means ± SD (n = 8, one-way ANOVA). Different superscript lowercase letters on the table indicate significant difference (P < 0.05). MDA malondialdehyde, ROS reactive oxygen species, GSH-Px glutathione peroxidase, SOD superoxide dismutase

As compared with the model control group, the MDA level was 13.9 % lower at 4 weeks in the GLSP group (Table 3) (P < 0.05). Furthermore, there was also a reduction of ROS for GLSP intervention group compared to the model control, although the difference was not significant. Nevertheless, the levels of glutathione peroxidase (GSH-Px) and superoxide dismutase (SOD) were higher by 25.9 % (P < 0.05) and 38.0 % (P < 0.05), respectively, following the GLSP treatment compared to the model control group.

Expression of genes related to glucose metabolism

In order to understand the molecular mechanism associated with the reduction of blood glucose level following GLSP intervention, the expression of a number of genes involved in glucose metabolism in the liver was analyzed and the results are presented in Fig. 1. The analyses of genes encoding enzymes involved in glycogen synthesis, i.e. glycogen synthase2 (GS2) and glycogenin1 (GYG1) showed that, compared to the model control group, the expression level of hepatic GS2, the rate limiting enzyme of glycogen synthesis, was increased by 3-folds and GYG1 also had a more than 2-folds increase at 4 weeks in the GLSP group. Furthermore, insulin-induced genes (Insig-1 and Insig-2) were greatly up-regulated in the livers of GLSP treated type 2 diabetic rats. More importantly, the expression level of isoform 1 of the catalytic subunit of glucose-6-phosphatase (G6PC1) was found to be greatly reduced after GLSP intervention, although there was no significant difference in the expression level of the genes related to gluconeogenesis, i.e., phosphenolpyruvate carboxykinase (PEPCK) between GLSP intervention group and the model control group.

Fig. 1.

Fig. 1

Hepatic gene expression profiles for glucose metabolism. Mean values with unlike letters are significantly different (one way ANOVA). Model control: STZ induced diabetic rats without intervention; Normal control: healthy rats without intervention; GLSP:STZ induced diabetic rats with GLSP intervention. GS2 (glycogen synthase2, liver isoform) and GYG1 (glycogenin 1): related to glycogen synthesis; PEPCK (phosphenolpyruvate carboxykinase) and G6PC1 (isoform 1 of the catalytic subunit of glucose-6-phosphatase): related to gluconeogenesis; Insig-1 (insulin induced gene 1) and Insig-2 (insulin induced gene 2): responsible for glucose homeostasis

Expression of genes related to lipids metabolism

The pathways involved in lipid metabolism are various, complexly inter-related to glucose and protein metabolisms [16]. To assess the changes associated with the control of lipogenesis, the expression level of gene encoding AcetylCoA carboxylase (ACC) was measured and there was no significant difference in the expression level among the three groups (Fig. 2). However, Acyl-CoA oxidase1 (Acox1), which is involved in lipid β-oxidation, was found to have the highest expression level in the type 2 diabetic rats following the GLSP intervention among the three groups. As described above, the expression levels of Insig-1 and Insig-2 were greatly up-regulated in the liver of GLSP treated type 2 diabetic rats compared to either normal rats or model control rats. Once more, there were no significant differences in the gene expression levels of Fads, SREBP-1, Acyl, Gpam and Dgat1 between the model control group and GLSP intervention group (Fig. 2).

Fig. 2.

Fig. 2

Hepatic gene expression profiles for lipid metabolism. Mean values with unlike letters are significantly different (one way ANOVA). ACC (Acetyl-CoA carboxylse) and FAS (fatty acid synthase): related to lipogenesis; Gpam (glycerol-3-phosphate acyltransferase mitochondrial) and Dgat1 (diacylglycerol acyltransferase 1): responsible for triglycerides synthesis; Fads1 (fatty acid desaturase 1): associated with fatty acid desaturation; Acox1 (acyl-CoA oxidase 1): responsible for fatty acid oxidation; Acly (ATP citrate lyase): related to cholesterol biosynthesis; Insig-1 (insulin induced gene 1) and Insig-2 (insulin induced gene 2): regulation of cholesterol homeostasis; SREBP-1 (sterol regulatory element binding protein-1): associated with the regulation of fatty acids and triglycerides syntheses and metabolism

Discussion

Although previous research has shown that the fruiting bodies of G. lucidum could reduce blood glucose and plasma cholesterol levels [1719], few studies have investigated the molecular mechanisms associated with these activities. Our study combines the data of biochemical analysis and gene expression and indicates that GLSP intervention could result in a partial recovery of body weight, reduction of blood glucose level and improvement of lipid compositions and even attenuation of oxidative stress in the STZ-induced diabetic rats. These improvements might be highly associated with the changes in the expression levels of the related genes.

The current study would suggest that GLSP intervention could manipulate hyperglycemic and hyperlipidemic status with a significant reduction of blood glucose level and the improvement of blood lipid compositions (TG, TC, HDL-c) in type 2 diabetic rats (P < 0.01). The GLSP dosage used in this study was 1 g per day, which was about 3 % of the total diet. Although this dosage did not achieve a completely functional recovery of the DM rats to a normal status, it could be used as a reference dosage for improving the symptoms of DM. In contrast, Winther et al. [20] reported that G. lucidum as monotherapy lowered C-peptide significantly (P < 0.001), leaving HDL-c parameter unchanged.

As shown in Table 3, the level of oxidative stress in diabetic rats was improved with the reduction of MDA and the increase of SOD and GSH-Px following GLSP intervention. Meanwhile, The GLSP intervention also led to a reduction of ROS level compared to the model control, although the difference was not significant. Considering that MDA is produced from ROS, the higher level of MDA may promote polyunsaturated fatty acid peroxidation. Previous studies have also shown a strong relationship between MDA levels and different pathological stages of diabetes, because MDA concentration increased considerably in diabetes mellitus [21]. Thus, the controlling of MDA concentration would be helpful in maintaining a suitable level of oxidative stress. Antioxidant enzymes, including SOD and GSH-Px are vital defenses against ROS and they are important in inhibiting oxygen radical formation and usually act as biomarkers for indicating ROS production. This study found that the activities of antioxidant enzymes SOD and GSH-Px were significantly decreased in the model control group compared to the normal controls, indicating a lower antioxidant defense caused by diabetes. However, the administration of GLSP significantly enhanced the activity of SOD and GSH-Px (Table 3), suggesting that the antioxidant compounds present in GLSP might enhance plasma antioxidant capacity in diabetic rats. One plausible mechanism for interpreting the anti-hyperglycemic function of GLSP might be through its scavenging ability to protect pancreatic cells from oxygen-radical damage, supporting an increased secretion of insulin. Previous research has also demonstrated that a high dosage of antioxidant compounds had a favorable effect on glucose homeostasis in obese subjects with the improvements in their Homeostasis Model Assessment (HOMA) index, thus exerting a positive effect on insulin sensitivity [22].

Previous reports have shown the anti-hyperglycemic activity of GLSP [17, 18] and this function was further highlighted in this study (Table 1). A significant elevation of insulin levels in rats was also demonstrated after the administration of GLSP (unpublished data), which was also accompanied by a decreased blood glucose level. The current study is consistent with previously reported work [23]. Thus, the current results could further support the evidence from previous studies on the anti-hyperglycemic effect of GLSP through decreased glucose level in animals accompanied with increased insulin levels and improvements in pancreatic cell function [2427]. However, the mechanisms associated with this benefit are not completely clear. Therefore, in light of our current results, it might be hypothesized that the benefits derived from GLSP intervention in the diabetic rats could be partially associated with its roles in promoting glycogen synthesis although gluconeogenesis was not significantly affected (PECPK and G6PC1 in Fig. 1). Another plausible reason may be associated with insulin regulation. The expression level of insulin induced genes, in particular Insig-1, was enhanced significantly in GLSP intervention group compared to model control group. It has been shown that Insig-1 and Insig-2 play an important role in glucose homeostasis [28] and they also have a key function in the regulation of intracellular cholesterol and fat metabolism [29]. Consistently, previous reports have confirmed that a lower glucose concentration could promote the expression levels of Insig-1 and Insig-2 genes [30] and Insig-1 inhibited lipid accumulation and free fatty acid (FFA) synthesis in a time-dependent manner [31]. In addition, the hepatic over-expression of Insig-1 (or Insig-2) would also inhibit the activation of SREBP-1c in the rat liver [3234], a key factor in the control of hepatic glucose metabolism and the manipulation of glucose homeostasis associated with insulin. Although there was no significant change in the expression level of SREBP-1 with the increased expression level of Insig genes in our study, post transcriptional regulation might play some roles as well.

In this study, the significant improvement of blood lipid compositions confirmed that GLSP could be used as an efficient therapy for treating hyperlipidemia caused by diabetes and these improvements in blood cholesterol and triglyceride levels might be related to the reduced blood glucose level in the diabetic rats [35, 36]. Nevertheless, other study also suggested that G. lucidum consumption could result in a great suppression of elevated total cholesterol levels, which might be associated with the inhibition of the hepatic phosphoenolpyruvate carboxykinase gene expression [17]. The HMG CoA reductase activity associated with lipoprotein metabolism may also contribute to the hypolipidemic effects following GLSP treatment, which is similar to the effects of other plant medicines [37, 38]. Since Insig genes are also associated with lipid metabolism, acyl-CoA oxidase plays an important role in plasma lipid compositions. Fatty acid degradation in most organisms occurs primarily via β-oxidation. Both mitochondrial and peroxisomal β-oxidation catalyze the shortening of acyl-CoA esters chains, which requires the participation of β-oxidation enzymes, including acyl-CoA dehydrogenase and acyl-CoA oxidase (Acox) [39]. In our study, the Acox1 gene was up-regulated by over 5-folds in the diabetic rats following GLSP treatment, which might provide some clear evidences that GLSP could reduce TG level mainly through promoting lipid β-oxidation (Fig. 2). Thus, based on above results in this study, a relationship between GLSP intervention and the expression of genes involved in glucose and lipid metabolisms in the diabetic rats is summarized in Fig. 3. In brief, GLSP in the diet of type 2 diabetic rats could reduce the blood glucose level possibly through the increasing of the gene expression level of glycogen synthesis (GS2 and GYG1) and glucose homeostasis (Insig-1 and Insig-2). In particular, plasma lipid compositions (TG and TC) decreased concomitantly with increased gene expression levels of Acox1 and Insig-1/2.

Fig. 3.

Fig. 3

Gene regulation in metabolic pathways manipulated by GLSP in the diet of type 2 diabetic rats. Arrows in red and green indicate gene up-regulation or down-regulation, respectively. GLSP intervention reduced blood glucose level through increasing glycogen synthesis (GS2 and GYG1) and glucose homeostasis (Insig-1 and Insig-2). Concomitantly, the reduction of plasma lipids occurred following GLSP administration, which might be associated with the increasing of genes expression of Acox1 and Insig-1/2

Conclusion

In summary, this study has shown that G. lucidum spores could be used as an ingredient for attenuating diabetic mellitus through potential anti-hyperglycemic and anti-hyperlipidemic activities. More importantly, the relationships between GLSP intervention and the changes in the gene expression levels of the related glucose and lipid metabolic pathways might highlight a potential model for interpreting the action of GLSP treatment.

Materials and methods

Materials

G. lucidum spores powder (CLSP) with shell-broken rate >99.9 % was provided by Chongqing Biotechnology Institute (Chongqing, China).

Animals and diets

Twenty four healthy male Sprague–Dawley rats of ~200 g weight were purchased from the Animal Resource Centre, Medical College of PLA Military Science (Beijing, China). They were housed in wire-bottomed cages in a room with controlled temperature (23 °C) and lighting (a 12-h-light/-darkcycle) and allowed free access to food and water. The rats were randomly assigned to 3 groups (n = 8/group): normal control, model control and Ganoderma lucidum spores powder (GLSP) treatment. The rats were fed with a basic diet. After 1 week’s adaptive feeding with the basic diet, the rats were fasted for 12 h, followed by a single intravenous injection of 45 mg/ kgb.w STZ except the rats in normal control group. After 72 h injection of STZ, the blood glucose level was higher than 16.7 mmol/L demonstrating a successful induction of diabetes. Normal control and model control animals were fed with the basal diet for 4 weeks without any intervention. In contrast, GLSP was administered for the third group by oral gavages, using a feeding needle with 1 g per day for 4 consecutive weeks before they were sacrificed for the analysis. There were no casualties or obvious signs of toxicity throughout the course of the experiments and all rats involved survived. The basal diet contained 7 % fat and 13 % protein. Group food intakes and individual body weights were monitored daily throughout the study. Experimental procedures were approved by the Animal Ethics Committee of PLA Military Science and complied with the Chinese Code of Practice for the Care and Use of Animals for Scientific Purposes.

Biochemical analysis

During the whole experiment (4 weeks), blood samples from all rats were collected from the tail vein (once a week) for blood glucose level analysis. At the end of the experiments, blood samples were collected from the femoral artery before animals were sacrificed by cervical dislocation. Blood collected was stored at −80 °C prior to chemical analyses. High-density lipoprotein-cholesterol (HDL-c) (North Kangtai Clinical Reagent Co., Beijing, China, F003-2), total cholesterol (TC) (Dong’ou Diagnosis Products Co Ltd, Zhejiang, China, F002-1) and triglyceride (TG) (Dong’ou Diagnosis Products Co Ltd, Zhejiang, China, F001-1) concentrations were measured according to the instructions of their corresponding kits, respectively. Plasma glutathione peroxidase (GSH-Px) (Jiancheng Biological Engineering Institute, Nanjing, China, A061-1), reactive oxygen species (ROS) (Sigma-Aldrich, USA, DCFH-DA, D6883) and superoxide dismutase (SOD) were measured by enzyme-linked immunosorbent assay (ELISA) (Jiancheng Biological Engineering Institute, Nanjing, China, A015). Commercially available ELISA kit was used to determine blood insulin levels (Beinglay Biotech Co., Ltd, Wuhan, China, DRE20732).

Following the cervical dislocation, the rats were dissected immediately with sterile scissors and the liver was removed, weighed and immediately frozen in liquid nitrogen and stored at −80 °C prior to RNA extraction.

Analysis of gene expression associated with lipid and glucose metabolisms

Immediately after sacrifice, livers of all rats were quickly removed, chilled with liquid nitrogen and stored at −80 °C before homogenization for total RNA extraction using the Trizol reagent (Takara). Total RNA isolated from liver was then treated with RNase-free DNase to remove any contaminating genomic DNA and the quality and integrity of RNA were assessed using agarose gel electrophoresis stained with ethidium bromide. For RT-PCR analysis, first strand cDNA was synthesized using the PrimeScript RT reagent kit with gDNA Eraser (Takara) according to the manufacturer’s instructions. PCR was carried out in a 20 μL volume reaction containing 2 μM of each primer, 40 ng of cDNA and 10 μL of SYBR Primix ExTag. Thermal cycling conditions included an initial denaturation step at 95 °C for 5 min and then 40 cycles of 95 °C for 30 s, 58–60 °C for 30 s and 72 °C for 30 s. Fluorescence was measured at the end of each cycle. The 18S rRNA gene was used as an internal control to normalize target genes expression. Three replicates of each reaction were performed and the relative transcript quantity was calculated according to the method of 2-ΔΔCT [40, 41]. Primer sequences are shown in Table 4.

Table 4.

The primer of genes

Gene Accession number Forward primes(5′–3′) Reverse primes(5′–3′) Amplicon product (bp) Annealing temperature (°C)
18S rRNA NR_046237 AAACGGCTACCACATCCAAG TTGCCCTCCAATGGATCCT 159 60
ACC NM_022193 CAACCACTACGGCATGACTCA CGCAGAAGCAGCCCATTACTT 155 60
FAS NM_017332 TGCTCCCAGCTGCAG GCCCGGTAGCTCTGGGTGTA 107 60
Acox1 NM_017340 CAAGGAGAGTGCTACGGGTTA TTCAGGTAGCCGTTATCCAT 137 58
SREBP-1 XM_213329 GCAAGGCCATCGACTACATC TTTCATGCCCTCCATAGACAC 161 60
Insig1 NM_022392 TTGTCGGCTTATTGTATCCCT GCACATTATTGGCGAAATCT 147 55
Insig2 NM_178091 GGCGGAAGGAGAGACGGAGTC AAGCCAGGAACACGCCAATGA 128 60
Acly NM_016987 GCAGACCAGAAGGGCGTGAC CACACTGCCTGGGCGATACAG 135 64
Fads1 NM_053445 GTTTGTGTGGGTGACGCAGAT TTGAAGGCTGACTGGTGAACG 117 60
Gpam NM_017274 CCTGTGGGCATCTCGTATGAT TTCCGCAGCATTCTGATAAC 122 60
Dgat1 NM_053437 CAGATGGGGCTGCTGCTACAT GGCGGCACCACAGATTGACAT 175 60
GS2 NM_013089 GACACTGAGCAGGGCTTTTCC GAGGAGGGCCTGGGATACTT 90 60
GYG1 NM_031043.2 TCGCCAGCCCACAGGTT CACCACTGTCCAAGACATCTACCA 90 60
PEPCK NM_198780 GAAAGTTGAATGTGTGGGTGAT TTCTGGGTTGATGGCCCTTA 79 57
G6PC1 NM_013098 GTATGGATTCCGGTGCTT AATGCCTGACAAGACTCCA 132 55

Statistical analysis

Results were expressed as means ± SD with SPSS software (version 13.0). The data were analyzed statistically using one-way ANOVA, repeated measures ANOVA and Tukey test (multiple comparisons). A value of P < 0.05 was considered as statistically significant.

Acknowledgements

This work was financially supported by the China-European research collaboration program (SQ2013ZOA100001), the Nature Science Foundation of China (No. 31471701) and Tianjin Research Program of Application Foundation and Advanced Technology (15JCZDJC34300).

Additional file

Additional file 1: Table S1. (32.5KB, doc)

Effect of GLSP intervention on body mass of type 2 diabetic rats. Model control: STZ induced diabetic rats without intervention; Normal control: healthy rats without intervention; GLSP:STZ induced diabetic rats with GLSP intervention.

Footnotes

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

All authors contributed to designing the experiment, interpreting the data and preparing, revising and approving the final version of the manuscript. F. W. also processed and analyzed the data. All authors have read and approved the final manuscript.

Contributor Information

Fang Wang, Email: wangfang@tust.edu.cn.

Zhongkai Zhou, Email: zkzhou@tust.edu.cn.

Xiaochong Ren, Email: 837610698@qq.com.

Yuyang Wang, Email: wyy121@126.com.

Rui Yang, Email: ruiyang0111@163.com.

Jinhua Luo, Email: cqbio@126.com.

Padraig Strappe, Email: pstrappe@csu.edu.au.

References

  • 1.Centers for Disease Control and Prevention . National Diabetes Fact Sheet: National estimates and General Information on Diabetes and Prediabetes in the United States, 2011. Atlanta, GA: US Department of Health and Human Services, Centers for Disease Control and Prevention; 2011. [Google Scholar]
  • 2.Saydah SH, Fradkin J, Cowie CC. Poor control of risk factors for vascular disease among adults with previously diagnosed diabetes. JAMA. 2004;291:335–42. doi: 10.1001/jama.291.3.335. [DOI] [PubMed] [Google Scholar]
  • 3.Wachtel-Galor S, Tomlinson B, Benzie IF. Ganoderma lucidum (“Lingzhi”), a Chinese medicinal mushroom: biomarker responses in a controlled human supplementation study. Br J Nutr. 2004;2:263–9. doi: 10.1079/BJN20041039. [DOI] [PubMed] [Google Scholar]
  • 4.Russell R, Paterson M. Ganoderma-A therapeutic fungal biofactory. Phytochemistry. 2006;67:1985–2001. doi: 10.1016/j.phytochem.2006.07.004. [DOI] [PubMed] [Google Scholar]
  • 5.Sanodiya BS, Thakur GS, Baghel RK, Prasad GB, Bisen PS. Ganoderma lucidum: a potent pharmacological macrofungus. Curr Pharm Biotechnol. 2009;10:717–42. doi: 10.2174/138920109789978757. [DOI] [PubMed] [Google Scholar]
  • 6.Zhang W, Tang YJ. A novel three-stage light irradiation strategy in the submerged fermentation of medicinal mushroom Ganoderma lucidum for the efficient production of ganoderic acid and Ganoderma polysaccharides. Biotechnol Prog. 2008;24:1249–61. doi: 10.1002/btpr.36. [DOI] [PubMed] [Google Scholar]
  • 7.Liu J, Kurashiki K, Shimizu K, Kondo R. 5 alpha-reductase inhibitory effect of triterpenoids isolated from Ganoderma lucidum. Biol Pharm Bull. 2006;29:392–5. doi: 10.1248/bpb.29.392. [DOI] [PubMed] [Google Scholar]
  • 8.Liu J, Shiono J, Shimizu K, Kukita A, Kukita AT, Kondo R. Ganoderic acid DM: anti-androgenic osteoclastogenesis inhibitor. Bioorg Med Chem Lett. 2009;19:2154–7. doi: 10.1016/j.bmcl.2009.02.119. [DOI] [PubMed] [Google Scholar]
  • 9.Akihisa T, Nakamura Y, Tagata M, Tokuda H, Yasukawa K, Uchiyama E, et al. Anti-inflammatory and anti-tumor-promoting effects of triterpene acids and sterols from the fungus Ganoderma lucidum. Chem Biodivers. 2007;4:224–31. doi: 10.1002/cbdv.200790027. [DOI] [PubMed] [Google Scholar]
  • 10.Liu X, Yuan JP, Chung CK, Chen XJ. Antitumor activity of the sporoderm-broken germinating spores of Ganoderma lucidum. Cancer Lett. 2002;182:155–61. doi: 10.1016/S0304-3835(02)00080-0. [DOI] [PubMed] [Google Scholar]
  • 11.Min BS, Gao JJ, Nakamura N, Hattori M. Triterpenes from the spores of Ganoderma lucidum and their cytotoxicity against meth-A and LLC tumor cells. Chem Pharm Bull. 2000;48:1026–33. doi: 10.1248/cpb.48.1026. [DOI] [PubMed] [Google Scholar]
  • 12.Xie YZ, Li SZ, Yee A, La Pierre DP, Deng ZQ, Lee DY. Ganoderma lucidum inhibits tumour cell proliferation and induces tumour cell death. Enzyme Microb Technol. 2006;40:177–85. doi: 10.1016/j.enzmictec.2005.10.051. [DOI] [Google Scholar]
  • 13.Huie CW, Di X. Chromatographic and electrophoretic methods for Lingzhi pharmacologically active components. J Chromatogr B. 2004;812:241–57. doi: 10.1016/j.jchromb.2004.08.038. [DOI] [PubMed] [Google Scholar]
  • 14.Gao P, Hirano T, Chen Z, Yasuhara T, Nakata Y, Sugimoto A. Isolation and identification of C-19 fatty acids with anti-tumor activity from the spores of Ganoderma lucidum (reishi mushroom) Fitoterapia. 2012;83:490–9. doi: 10.1016/j.fitote.2011.12.014. [DOI] [PubMed] [Google Scholar]
  • 15.Zheng J, Yang B, Yu Y, Chen Q, Huang T, Li D. Ganoderma lucidum polysaccharides exert anti-hyperglycemic effect on streptozotocin-induced diabetic rats through affecting β-cells. Comb Chem High Throughput Screen. 2012;15:542–50. doi: 10.2174/138620712801619168. [DOI] [PubMed] [Google Scholar]
  • 16.Chevalier L, Bos C, Gryson C, Luengo C, Walrand S, Tomé D, et al. High-protein diets differentially modulate protein content and protein synthesis in visceral and peripheral tissues in rats. Nutrition. 2009;25:932–9. doi: 10.1016/j.nut.2009.01.013. [DOI] [PubMed] [Google Scholar]
  • 17.Seto SW, Lam TY, Tam HL, Au AL, Chan SW, Wu JH, et al. Novel hypoglycemic effects of Ganoderma lucidum water-extract in obese/diabetic (+db/+db) mice. Phytomedicine. 2009;16:426–36. doi: 10.1016/j.phymed.2008.10.004. [DOI] [PubMed] [Google Scholar]
  • 18.Teng BS, Wang CD, Zhang D, Wu JS, Pan D, Pan LF, et al. Hypoglycemic effect and mechanism of a proteoglycan from Ganoderma lucidum on streptozotocin-induced type 2 diabetic rats. Eur Rev Med Pharmacol Sci. 2012;16(2):166–75. [PubMed] [Google Scholar]
  • 19.Klupp NL, Chang D, Hawke F, Kiat H, Cao H, Grant SJ, et al. Ganoderma lucidum mushroom for the treatment of cardiovascular risk factors. Cochrane Database Syst Rev. 2015;2:CD007259. doi: 10.1002/14651858.CD007259.pub2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Winther K, Mehlsen J, Rein E, Hansen A, Goino T. A combination of Japanese ginseng, Ganoderma lucidum and trametes versicolor, referred to as the GOINO PROCEDURE, can lower blood glucose and LDL-cholesterol in patients with NIDDM. Atherosclerosis Suppl. 2003;4:339. doi: 10.1016/S1567-5688(03)91457-7. [DOI] [Google Scholar]
  • 21.Del Rio D, Stewart AJ, Pellegrini N. A review of recent studies on malondialdehyde as toxic molecule and biological marker of oxidative stress. Nutr Metab Cardiovasc Dis. 2005;15:316–28. doi: 10.1016/j.numecd.2005.05.003. [DOI] [PubMed] [Google Scholar]
  • 22.Victor VM. Mitochondrial Oxidative Stress in Diabetes. In: Preedy VR, editor. Diabetes: Oxidative Stress and Dietary Antioxidants. Chapter 5. London: Academic; 2014. pp. 41–9. [Google Scholar]
  • 23.Hafizur RM, Babiker R, Yagi S, Chishti S, Kabir N, Choudhary MI. The antidiabetic effect of Geigeria alata is mediated by enhanced insulin secretion, modulation of β-cell function and improvement of antioxidant activity in treptozotocin-induced diabetic rats. J Endocrinol. 2012;214:329–35. doi: 10.1530/JOE-12-0217. [DOI] [PubMed] [Google Scholar]
  • 24.Hikino H, Konno C, Mirin Y, Hayashi T. Isolation and hypoglycemic activity of Ganoderans A and B, glycans of Ganoderma lucidum fruit bodies. Planta Med. 1985;51:339–40. doi: 10.1055/s-2007-969507. [DOI] [PubMed] [Google Scholar]
  • 25.Hikino H, Ishiyama M, Suzuki Y, Konno C. Mechanisms of hypoglycemic activity of ganoderan B: a glycan of Ganoderma lucidum fruit bodies. Planta Med. 1989;55:423–8. doi: 10.1055/s-2006-962057. [DOI] [PubMed] [Google Scholar]
  • 26.Jung KH, Ha E, Kim MJ, Uhm YK, Kim HK, Hong SJ, et al. Ganoderma lucidum extract stimulates glucose uptake in L6 rat skeletal muscle cells. Acta Biochim Pol. 2006;53:597–601. [PubMed] [Google Scholar]
  • 27.Ni T, Hu Y, Sun L, Chen X, Zhong J, Ma H, et al. Oral route of mini-proinsulin-expressing Ganoderma lucidum decreases blood glucose level in streptozocin-induced diabetic rats. Int J Mol Med. 2007;20:45–51. [PubMed] [Google Scholar]
  • 28.Krapivner S, Chernogubova E, Ericsson M, Ahlbeck-Glader C, Hamsten A, van’t Hooft FM. Human evidence for the involvement of insulin-induced gene 1 in the regulation of plasma glucose concentration. Diabetologia. 2007;50:94–102. doi: 10.1007/s00125-006-0479-x. [DOI] [PubMed] [Google Scholar]
  • 29.Goldstein JL, DeBose-Boyd RA, Brown MS. Protein sensors for membrane sterols. Cell. 2006;124:35–46. doi: 10.1016/j.cell.2005.12.022. [DOI] [PubMed] [Google Scholar]
  • 30.Xie YH, Mo ZH, Chen K, Yang YB, Xing XW, Liao EY. Effect of different glucose concentrations on the expressions of insig-1 and insig-2 mRNA during the differentiation of 3T3-L1 cells. J Central South Uni [Article in Chinese] 2008;33:238–44. [PubMed] [Google Scholar]
  • 31.Chen K, Jin P, He HH, Xie YH, Xie XY, Mo ZH. Overexpression of Insig-1 protects β cell against glucolipotoxicity via SREBP-1c. J Biomed Sci. 2011;18:57. doi: 10.1186/1423-0127-18-57. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Espenshade PJ, Hughes AL. Regulation of sterol synthesis in eukaryotes. Annu Rev Genet. 2007;41:401–27. doi: 10.1146/annurev.genet.41.110306.130315. [DOI] [PubMed] [Google Scholar]
  • 33.Herbert A, Gerry NP, McQueen MB, Heid IM, Pfeufer A, Illig T, et al. A common genetic variant is associated with adult and childhood obesity. Science. 2006;312:279–83. doi: 10.1126/science.1124779. [DOI] [PubMed] [Google Scholar]
  • 34.Horton JD, Goldstein JL, Brown MS. SREBPs: activators of the complete program of cholesterol and fatty acid synthesis in the liver. J Clin Invest. 2002;109:1125–31. doi: 10.1172/JCI0215593. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Jain SK, Rains JL, Croad JL. Effect of chromium niacinate and chromium picolinate supplementation on lipid peroxidation, TNF-alpha, IL-6, CRP, glycated hemoglobin, triglycerides and cholesterol levels in blood of streptozotocin-treated diabetic rats. Free Radic Biol Med. 2007;43:1124–31. doi: 10.1016/j.freeradbiomed.2007.05.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Yang DW, Jia RH, Yang DP, Ding GH, Huang CX. Dietary hypercholesterolemia aggravates contrast media-induced nephropathy. Chin Med J (Engl) 2004;117:542–6. [PubMed] [Google Scholar]
  • 37.Lemhadri A, Hajji L, Michel JB, Eddouks M. Cholesterol and triglycerides lowering activities of caraway fruits in normal and streptozotocin diabetic rats. J Ethnopharmacol. 2006;106:321–6. doi: 10.1016/j.jep.2006.01.033. [DOI] [PubMed] [Google Scholar]
  • 38.Sharma SB, Nasir A, Prabhu KM, Murthy PS, DevG Hypoglycaemic and hypolipidemic effect of ethanolic extract of seeds of Eugenia jambolana in alloxan-induced diabetic rabbits. J Ethnopharmacol. 2003;85:201–6. doi: 10.1016/S0378-8741(02)00366-5. [DOI] [PubMed] [Google Scholar]
  • 39.Hiltunen JK, Qin Y. Beta-oxidation-strategies for the metabolism of a wide variety of acyl-CoA esters. Biochim Biophys Acta. 2000;1484:117–28. doi: 10.1016/S1388-1981(00)00013-5. [DOI] [PubMed] [Google Scholar]
  • 40.Kenneth J, Thomas D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-44CT method. Methods. 2001;25:402–8. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  • 41.Michael W. A new mathematical model for relative quantification in real-time RT-PCR. Nucl Acid Res. 2001;29:2002–7. doi: 10.1093/nar/29.9.e45. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Lipids in Health and Disease are provided here courtesy of BMC

RESOURCES