Abstract
Porcine reproductive and respiratory syndrome (PRRS) has tremendous impact on the pork industry in North America. The molecular diagnosis of infection with PRRS virus (PRRSV) is hampered by its considerable strain diversity. In this study, 43 previously published or newly developed primers for probe-free real-time reverse transcription polymerase chain reaction (RT-PCR) were evaluated on their sensitivity, specificity, reproducibility, and repeatability, using a diverse panel of 36 PRRSV strains as well as other arteriviruses and unrelated porcine viruses. Three primer pairs had excellent diagnostic and analytical sensitivity on par with a probe-based reference assay, absolute specificity to virus genotype and species, as well as over 95% reproducibility and repeatability across a wide dynamic range.
Résumé
Le syndrome dysgénésique et respiratoire du porc (SDRP) a un impact énorme sur l’industrie du porc en l’Amérique du Nord. Le diagnostic moléculaire de l’infection avec le virus du SDRP est entravée par sa diversité considérable. Dans cette étude, 43 amorces publiées antérieurement ou nouvellement développés pour RT-PCR en temps réel sans d’une sonde spécifique ont été évalués sur leur sensibilité, la spécificité, la reproductibilité et la répétabilité. Un groupe varié de 36 souches de virus du SDRP, d’autres virus appartenant au genre des arterivirus et les virus porcins indépendants a été utilisé. Trois paires d’amorces ont une excellente sensibilité de diagnostic and d’analyse qui équivaut à un test de référence basé sur des sondes. Ils avaient une spécificité absolue de génotype et des espèces du virus, et la reproductibilité et la répétabilité a été plus de 95 % sur une large plage dynamique.
(Traduit par les auteurs)
Introduction
Porcine reproductive and respiratory syndrome virus (PRRSV), a small, enveloped virus with a single-stranded positive-sense RNA genome (family Arteriviridae) (1), causes reproductive failure in sows as well as losses and decreased performance in growing pigs. The disease is extremely costly to pork producers, particularly in North America (2). No effective vaccine is available and producers rely on conventional management practices to create and maintain PRRSV-free herds (3). In areas like western Canada, where many farms are very remote, disease management would benefit greatly from diagnostic tests that can be completed by the veterinarian during a farm call. Rapid and reliable pen-side assays allow immediate segregation of infected animals and prevent the reintroduction of PRRSV into free herds by animal movement, which is an important consideration in regional eradication programs (3). They reduce the time from detection to intervention by providing results within 1 h of the sample being obtained from the animal and by completely eliminating the bottleneck of shipping, off-site sample handling and result communication (4).
Currently, the only available pen-side molecular tests for PRRSV are based on reverse transcription loop-mediated isothermal amplification (LAMP) (5,6). Unlike polymerase chain reaction (PCR), LAMP requires a complex array of primers that bind to 6 different sites in the nucleic acid template (7). One of the hallmarks of PRRSV, however, is its tremendous genetic variability between and within the 2 recognized genotypes (type 1/Europe and type 2/North America) (1), and it is difficult to design LAMP primer arrays that retain adequate diagnostic sensitivity in the face of strain diversity (7). A possible alternative are self-contained, disposable, and inexpensive gel capillary cassettes for nucleic acid amplification that can perform standard probe-free real-time quantitative PCR and melt curve analysis in a portable system (8). Many primer pairs for PRRSV detection have been described (Table I), but most have only been tested with a very small selection of PRRSV strains that are of little relevance to the epidemiological situation in North America (1). Accordingly, the focus of this study was to compare the published probe-free assays and select those most suitable for PRRSV screening in Canadian pig farms. Even though it has never been reported in Canada, type 1 PRRSV was included because it is present on the North American continent and could be introduced at any time (9).
Table I.
Porcine reproductive and respiratory syndrome virus (PRRSV) primer sets under consideration
| Forward primer name | Forward primer sequence 5′ — 3′ | Positive | Match | Reverse primer name | Reverse primer sequence 5′ — 3′ | Match | Product | Reference |
|---|---|---|---|---|---|---|---|---|
| Type 1 | ||||||||
| LV-3859F | AGCTTTTGGCTCTTGAGCAG | 3859 | 100% | LV-3967R | CGTGACCCACCGAGTAACTT | 100% | 108 bp | a |
| CTGTATGAACTTGCAGGATG | 8642 | 100% | CGACAATACCATGTGCTG | 100% | 185 bp | (25) | ||
| Wern:EU-M-14374F | CAGATGCAGAYTGTGTTGCCT | 14374 | 100% | EU-M-14451R | TGGAGDCCTGCAGCACTTTC | 100% | 77 bp | (12) |
| Wern:EU-2.1F | GCACCACCTCACCCRRAC | 14792 | 100% | EU-2.1R | CAGTTCCTGCRCCYTGAT | 100% | 76 bp | (11) |
| TTTATGCTGCCGGTTGCTCA | 14910 | 100% | CAATCGCGACCATTCACCTG | 100% | 103 bp | (26) | ||
| Type 2 | ||||||||
| GTCTGTCCCTAGCACCTTG | 129 | n/a | GCCCTCCGCCATAAACAC | n/a | 125 bp | (27) | ||
| GGCGCAGTGACTAAGAGA | 9014 | n/a | GTAACTGAACACCATATGCTG | n/a | 107 bp | (25) | ||
| TTGAATGTTCAAGTATG | 13776 | n/a | ATCATTGCAGAAGTCGT | 94% | 633 bp | (28) | ||
| TTGACGCTATGTGAGCTGAATG | 13922 | n/a | ACTTTCRACGTGGTGGGC | 94% | 808 bp | (29) | ||
| GAGTTTCAGCGGAACAATGG | 14361 | n/a | GCCGTTGACCGTAGTGGAG | 95% | 450 bp | (30) | ||
| CCCGGGTTGAAAAGCCTCGTGT | 14821 | 100% | GGCTTCTCCGGGTTTTTCTTCCTA | 96% | 227 bp | (31) | ||
| 100% | TGTAACTTATCCTCCCTGAATCTG | 92% | 370 bp | (31) | ||||
| ATAACAACGGCAAGCAG | 14898 | 100% | CAGTGTAACTTATCCTCCCA | 85% | 296 bp | (32) | ||
| ACAACGGCAAGCAGCAGAA | 14901 | 100% | TCTGGACTGGTTTTGCTGAGC | 95% | 100 bp | (33) | ||
| GGGGAATGGCCAGYCAGTCAA | 14929 | 90% | GCCAGRGGAAAATGKGGCTTCTC | 96% | 131 bp | (34) | ||
| GGGAATGGCCAGCCAGTCAATCAACTG | 14930 | 93% | TGTAGAAGTCACGCGAATCAGGCGCACT | 79% | 310 bp | (35) | ||
| ATGGCCAGCCAGTCAATCA | 14934 | 100% | Olek:ORF7R | TCGCCCTAATTGAATAGGTGACT | 100% | 432 bp | (24) | |
| ACGGCCAGCCAGTCAATC | 14936 | 94% | TCAGTCGCTAGAGGAAAATGG | 100% | 133 bp | (36) | ||
| CCAGCCAGTCAATCARCTGTG | 14938 | 100% | GCGAATCAGGCGCACWGTATG | 100% | 296 bp | (37) | ||
| Chai:F2 | GCAATTGTGTCTGTCGTC | 15106 | 100% | R2 | CTTATCCTCCCTGAATCTGAC | 90% | 80 bp | (21) |
| Inou:15188F | CACTGTGGAGTTTAGTTTGC | 15190 | 95% | 15349R | CACACGGTCGCCCTAATTGAATA | 96% | 183 bp | (23) |
| Wern:US-1dF | ATRATGRGCTGGCATTC | 15262 | 100% | ACACGGTCGCCCTAATTG | 94% | 110 bp | (12,38) | |
The tables list all PRRSV assays that were considered for the study. The position of the 5′ base relative to the genome of Lelystad virus (type 1) or NVSL 97-7895 (type 2) is given for the forward primer of each pair. For each primer, the percent similarity to the published Lelystad virus sequence (type 1) or the cloned IAF-Klop sequence (type 2) is also listed. Primer names are only included for the 12 sequences that were finally selected (shaded in grey). Other relevant primer sets have been published recently, but they were not available at the time of the study and have not been included (39,40).
This primer pair has been newly designed for use in this study.
n/a — not available.
Materials and methods
A diverse panel of current and historical PRRSV strains was used for the comparisons (Table II). All type 2 primer pairs and the two type 1 pairs that were taken from the published literature bind at the 3′ end of the viral genome, whose open reading frames (ORF) 6 and 7 are highly conserved within each genotype, but have considerable between-type variation (10). Figure 1 shows a phylogenetic tree (MEGA6, The Biodesign Institute, http://www.megasoftware.net/) of this region constructed from the nucleotide sequences of type 2 strains that were used in the study. In addition to the 2 previously published type 1 primer pairs (11,12), a third pair, which binds in ORF 1a, was designed based on an alignment of type 1 strains Lelystad virus, EuroPRRSV, NMEU09-1, and Lena (GenBank accession numbers AY588319, AY366525, GU047345, and JF802085, respectively). The primers were selected from a consensus sequence using an online service (Primer3, http://bioinfo.ut.ee/primer3/). All primers, as well as the probes for the reference assay, were synthesized by commercial suppliers (Alpha DNA, Montreal, Quebec; Metabion, Martinsried, Germany).
Table II.
Porcine reproductive and respiratory syndrome virus (PRRSV) strains used for assay validation
| Strain designation | Type | GenBank accession numbers | Reference |
|---|---|---|---|
| 2010011381 | 1 | n/a | (41) |
| Cobbelsdorf | 1 | JN651730, JN651711, JN651692 | (12) |
| Lelystad virus | 1 | AY588319 | (42) |
| Stendal V1904 | 1 | JN651732, JN651713, JN651694 | (12) |
| Stendal V1952/97 | 1 | JN651729, JN651710, JN651691 | (12) |
| Stendal V852 | 1 | JN651731, JN651712, JN651693 | (12) |
| Stendal V953 | 1 | JN651728, JN651709, JN651690 | (12) |
| G# 96-38295, 97-38724, 97-43525 | 2 | n/a | n/a |
| AHL 32598, 32598, 35794, V106-1, V741, V1130-3, V1211, V1310, V1321, V2315, V2402, V38101, V44764 | 2 | n/a | n/a |
| Alberta-C | 2 | KJ865546 | this study |
| Alberta-M | 2 | KJ865547 | this study |
| Alberta-R | 2 | KJ865548 | this study |
| China | 2 | JN651741, JN651722, JN651703 | (12) |
| IAF-Klop | 2 | U64928 | (14) |
| IngelVac MLV | 2 | AF066183 | n/a |
| JA142 | 2 | AY424271 | (41) |
| NVSL97-7895, FL12 | 2 | AY545985 | (41) |
| SDSU73 | 2 | JN654458 | (41) |
| Stendal V1445/99 | 2 | JN651742, JN651723, JN651704 | (12) |
| USA 2 | 2 | JN651744, JN651725, JN651706 | (12) |
| VD29949/17 | 2 | JN651743, JN651724, JN651705 | (12) |
| VR2385 | 2 | U03040 | (41) |
n/a — not available.
Figure 1.
Phylogenetic relationship of type 2 PRRSV strains used for assay validation. The tree is based on the 3′ end of the viral genome downstream of open reading frame (ORF) 5, corresponding to nucleotides 14 362 to 15 414 when aligned to NVSL 97-7895. Lelystad virus (type 1) was used as an out-group. The evolutionary history was inferred by using the Maximum Likelihood method based on the Tamura-Nei model. The tree with the highest log likelihood (−3080.3916) is shown. It is drawn to scale, with branch lengths measured in the number of substitutions per site.
With the exception of samples from a European inter-laboratory ring trial (12), total nucleic acid was extracted from virus preparations, field and experimental samples using magnetic beads (Mag-Bind® Viral DNA/RNA Kit; Omega Bio-Tek, Norcross, Georgia, USA) in an automated system (MagMAXTM Express-96 Deep Well Magnetic Particle Processor; Life Technologies, Burlington, Ontario). The ring trial samples were processed using spin columns (QIAamp Viral RNA Mini Kit; Qiagen, Hilden, Germany). Ultimately, the pen-side assay will use in-gel sample lysis (13), which will require additional validation.
In addition to the clinical sensitivity (14) (i.e., the percentage of known positive samples that an assay identifies as positive), the study compared the analytical sensitivity or limit of detection (14) using RNA standards with known copy numbers, which were prepared from 3 PRRSV type 2 field strains collected in Alberta (referred to as Alberta-C, -M, and -R) and a Canadian reference strain (IAF-Klop; originally isolated in Quebec) (15). The 3′ end of the viral genome downstream of ORF 5 was amplified by 1-step reverse transcription polymerase chain reaction (RT-PCR; 5 μL of template, 0.5 μL of 10 μM forward primer 5′-AGTTTCAGCGGAACAATGG-3′, 0.5 μL of 10 μM reverse primer 5μ-TTTTTTTAATTTCGGCCGCATGGT-3′, 12.5 μL of 2× reaction mix, 0.5 μL of enzyme mix, and nuclease-free water to a final volume of 25 μL; SuperScript® III One-Step RT-PCR System with Platinum® Taq DNA Polymerase; Life Technologies), cleaned up by agarose gel electrophoresis (GenEluteTM PCR Clean-Up kit; Sigma-Aldrich, Oakville, Ontario), and cloned into a plasmid vector (pJET1.2/blunt Cloning Vector; Fisher Scientific, Ottawa, Ontario). The prepared plasmids (E.Z.N.A.® Plasmid Mini Kit I, Omega Bio-Tek) were sequenced by a commercial service (Eurofins MWG Operon, Louisville, Kentucky, USA). RNA was transcribed from linearized plasmids (MEGAscript® T7 Transcription Kit; MEGAclearTM Kit, Life Technologies), quantified (NanoDrop 1000; Fisher Scientific), and serial 10-fold dilutions from 107 down to 100 copies per μL were made in RNA-safe buffer (16). Copy numbers were calculated based on the known sequence lengths. For further comparisons, PRRSV strains Ingelvac MLV (Ingelvac PRRS® MLV; Boehringer Ingelheim Vetmedica, Burlington, Ontario), NVSL 97-7895, and the reference strains IAF-Klop and Lelystad were grown in MARC-145 cells (17), RNA was extracted from cleared supernatants and serial 10-fold dilutions were prepared. Specificity was tested with PRRSV-negative field samples and preparations of relevant non-PRRSV viruses.
Four commercially available SYBR Green I-based 1-step RT-qPCR kits (qScriptTM One-Step SYBR® Green qRT-PCR Kit, Quanta BioSciences, Gaithersburg, Maryland, USA; iScriptTM One-Step RT-PCR Kit with SYBR® Green, Bio-Rad Laboratories, Hercules, California, USA; Verso 1-step RT-qPCR SYBR Green Low ROX Kit, Fisher Scientific; One-Step SYBR PrimeScript RT-PCR Kit II, Clontech Laboratories, Mountain View, California, USA) were considered for the study. Kit chemistry has decisive influence on PCR performance. In preliminary tests (data not shown), one product (iScriptTM OneStep RT-PCR Kit with SYBR® Green; Bio-Rad) was found to be the most suitable and was used for comparing the candidate primer sets. The reactions were set up as recommended by the manufacturer: 2.5 μL of template were added to 12.5 μL 2× reaction mix, 0.5 μL enzyme, 0.75 μL of each primer (from 10 μM working dilutions), and 8 μL of nuclease-free water. The amplification conditions were 10 min at 50°C, 5 min at 95°C, 40 cycles of 10 s at 95°C, and 30 s at 60°C, followed by melt curve analysis. All tests were run in duplicate on 96-well real-time PCR systems (CFX96TM and CFX96 TouchTM; Bio-Rad), and an established, externally validated real-time quantitative RT-PCR (RT-qPCR) based on TaqMan hydrolysis probes served as a benchmark for the probe-free candidate assays (7). This reference assay was performed as described previously (11).
Amplicon size is an important consideration for real-time PCR. While short amplicons can cause low fluorescence in SYBR Green-based assays (18), longer amplicons are generally amplified less efficiently (19). In order to keep the amplicon size within a range of 80 to 200 bp, this study examined new combinations of primers from different publications in addition to the originally published primer pairs.
Another common PCR problem is template-independent primer interaction that can give rise to non-specific products. This is particularly troublesome in probe-free real-time PCR, in which quantification is based solely on the sequence-independent detection of double-stranded DNA (20). Primer pairs that frequently showed non-specific amplification were eliminated from the study early on, as were primer pairs that did not amplify at least the 10−3 dilution of one of the reference strains (data not shown). The reverse primer of one assay (21) was modified to match the sequence of the Canadian reference strain IAF-Klop (Figure 2). After the initial round of elimination, 6 pairs remained (Table I, grey shading), for which non-specific amplification was rare and easily detected by large shifts in the melting temperature of the PCR product.
Figure 2.
Type 2 primer sequences aligned with selected virus strains. All primer sequences are given in 5′ to 3′ notation. All bases that are identical to the primer sequence are replaced by a period, whereas non-matching bases are printed in red. Base positions in the primers that have been modified from the published sequences are underlined; altered bases are shown.
The performance of the 6 selected primer pairs was examined in detail. Serial dilutions of 4 in vitro transcribed RNA standards and 4 RNA preparations from infected cell cultures were tested to estimate the analytical sensitivity. The clinical sensitivity and specificity were further tested using a panel of native field samples, samples from experimental infections, and diluted cell culture supernatants of viruses isolated from field samples. Finally, the reproducibility and repeatability of the three type 2 primer pairs was assessed as described previously (11).
Results
In general, the type 2 pairs showed good performance for all type 2 strains, with detection limits that were on par with the type 2 reference assay (Figures 3 and 4). The Chai:F2/R2_mod pair did particularly well for IAF-Klop, for which it had been optimized, but it had very low sensitivity for the Alberta-M strain (resulting in a 10 000-fold higher limit of detection, Figure 3) and reduced sensitivity for Ingelvac MLV and NVSL 97-7895 (by a 100-fold, Figure 4). With the exception of Chai:F2/R2_mod and Alberta-M, the calculated PCR efficiencies and coefficients of correlation were consistently between 90% and 110% and > 0.99, respectively. The type 1 assays, on the other hand, could detect several dilutions of Lelystad virus RNA, but their limit of detection was at least 100-fold higher than that of the type 1 reference assay (Figure 5). The type 2 assays did not amplify the type 1 RNA preparations, and vice versa (data not shown).
Figure 3.
Results for serial dilutions of in vitro transcribed PRRSV type 2 RNA. Errors bars show the standard deviation between the tested replicates. The dashed line represents the results of the reference assay. The calculated amplification efficiencies (%) and the observed melting temperature of the amplicon (°C) are shown next to each plot.
Figure 4.
Results for serial dilutions of RNA extracted from cells infected with type 2 PRRSV. Errors bars show the standard deviation between the tested replicates. The dashed line represents the results of the reference assay. The calculated amplification efficiencies (%) and the observed melting temperature of the amplicon (°C) are shown next to each plot.
Figure 5.
Results for a serial dilution of RNA extracted from cells infected with type 1 PRRSV. Error bars show the standard deviation between the tested replicates. The dashed line represents the results of the reference assay. The calculated amplification efficiencies (%) and the observed melting temperature of the amplicon (°C) are shown next to each plot.
With one exception, all PRRSV genotype 2 assays further detected all type 2 samples and none of the type 1 samples (Table III). For the test panel used in this study, the sensitivity of the Wern/Olek and Inou assays was 100% compared to the reference assay; the Chai assay had a sensitivity of 97% (31/32 positive samples identified correctly). The Chai:F2/R2_mod primer pair failed to pick up a field sample from farm M; this is in line with the results obtained with the RNA standard of that strain. The PRRSV genotype 1 assays identified all type 1 samples correctly and did not show any cross-reactivity with type 2 samples. All 6 PRRSV assays gave negative results for samples containing other arteriviruses or unrelated porcine viruses. Thirty field samples from 3 farms in Alberta that had been negative in the type 1 and type 2 reference assays were correctly identified by all 6 primer pairs (data not shown), resulting in 100% calculated specificity.
Table III.
Sample panel for clinical sensitivity and specificity
| Sample | Type | Chai:F2/R2_mod | Inou:15188F/15349R | Wern:US-1dF/Olek:ORF7R | LV-3859F/3967R | Wern:EU-2.1F/R | Wern:EU-M-14374F/14451R |
|---|---|---|---|---|---|---|---|
| Alberta-B #06 | 2 | 34.0 | 32.9 | 34.3 | no Cq | no Cq | no Cq |
| Alberta-B #20 | 2 | 34.9 | 32.4 | 33.1 | no Cq | no Cq | no Cq |
| Alberta-B #21 | 2 | 36.1 | 32.1 | 34.7 | no Cq | no Cq | no Cq |
| Alberta-M #247-2 | 2 | 35.1 | 32.6 | 32.6 | no Cq | no Cq | no Cq |
| Alberta-M #270-1 | 2 | no Cq | 32.6 | 35.2 | no Cq | no Cq | no Cq |
| P01/Stendal V953 | 1 | no Cq | no Cq | no Cq | 29.7 | 28.4 | 26.3 |
| P03/Stendal V1904 | 1 | no Cq | no Cq | no Cq | 30.0 | 26.6 | 25.3 |
| P11/USA 2 | 2 | 28.3 | 24.6 | 23.9 | no Cq | no Cq | no Cq |
| P14/Stendal V852 | 1 | no Cq | no Cq | no Cq | 26.8 | 26.7 | 24.2 |
| P19/VD29949/17 | 2 | 31.9 | 27.7 | 26.2 | no Cq | no Cq | no Cq |
| P22/Cobbelsdorf | 1 | no Cq | no Cq | no Cq | 27.9 | 26.2 | 25.3 |
| P24/China | 2 | 28.9 | 25.9 | 25.2 | no Cq | no Cq | no Cq |
| P26/Stendal V1445/99 | 2 | 30.4 | 25.5 | 24.5 | no Cq | no Cq | no Cq |
| P28/Stendal V1952/97 | 1 | no Cq | no Cq | no Cq | 28.5 | 30.8 | 23.2 |
| AHL 32598 | 2 | 29.5 | 26.9 | 33.1 | no Cq | no Cq | no Cq |
| AHL 32598 | 2 | 26.7 | 25.2 | 33.1 | no Cq | no Cq | no Cq |
| AHL 35794 | 2 | 24.2 | 22.7 | 24.8 | no Cq | no Cq | no Cq |
| AHL V106-1 | 2 | 23.4 | 21.6 | 23.8 | no Cq | no Cq | no Cq |
| AHL V1130-3 | 2 | 26.6 | 23.2 | 24.3 | no Cq | no Cq | no Cq |
| AHL V1211 | 2 | 31.3 | 29.9 | 34.7 | no Cq | no Cq | no Cq |
| AHL V1310 | 2 | 35.6 | 27.4 | 30.7 | no Cq | no Cq | no Cq |
| AHL V1321 | 2 | 22.7 | 22.7 | 25.4 | no Cq | no Cq | no Cq |
| AHL V2315 | 2 | 25.3 | 22.5 | 21.7 | no Cq | no Cq | no Cq |
| AHL V2402 | 2 | 27.2 | 23.2 | 23.5 | no Cq | no Cq | no Cq |
| AHL V44764 | 2 | 28.9 | 26.2 | 28.2 | no Cq | no Cq | no Cq |
| AHL V741 | 2 | 26.1 | 23.9 | 24.3 | no Cq | no Cq | no Cq |
| G# 96-38295 | 2 | 27.6 | 22.3 | 27.4 | no Cq | no Cq | no Cq |
| G# 97-38724 | 2 | 28.9 | 23.0 | 26.1 | no Cq | no Cq | no Cq |
| G# 97-43525 | 2 | 26.2 | 25.1 | 27.9 | no Cq | no Cq | no Cq |
| 8062/5/VR2385 | 2 | 33.4 | 32.6 | 30.0 | no Cq | no Cq | no Cq |
| 8062/7/VR2385 | 2 | 31.0 | 28.5 | 28.3 | no Cq | no Cq | no Cq |
| 874/5/SDSU73 | 2 | 31.0 | 26.3 | 26.3 | no Cq | no Cq | no Cq |
| 874/7/SDSU73 | 2 | 33.1 | 27.2 | 27.9 | no Cq | no Cq | no Cq |
| 875/5/JA142 | 2 | 32.8 | 28.2 | 28.0 | no Cq | no Cq | no Cq |
| 875/7/JA142 | 2 | 29.2 | 25.0 | 25.2 | no Cq | no Cq | no Cq |
| 8066/5/2010011381 | 1 | no Cq | no Cq | no Cq | 33.8 | 34.2 | 34.4 |
| 8066/7/2010011381 | 1 | no Cq | no Cq | no Cq | 33.0 | 36.0 | 34.6 |
| 856/3/FL12 | 2 | 30.7 | 29.0 | 29.1 | no Cq | no Cq | no Cq |
| 856/5/FL12 | 2 | 27.8 | 23.1 | 23.2 | no Cq | no Cq | no Cq |
| porcine adenovirus 1 | no Cq | no Cq | no Cq | no Cq | no Cq | no Cq | |
| porcine adenovirus 2 | no Cq | no Cq | no Cq | no Cq | no Cq | no Cq | |
| porcine adenovirus 3 | no Cq | no Cq | no Cq | no Cq | no Cq | no Cq | |
| equine arteritis virus | no Cq | no Cq | no Cq | no Cq | no Cq | no Cq | |
| PCV1 plasmid | no Cq | no Cq | no Cq | no Cq | no Cq | no Cq | |
| PCV2 piglet 1 | no Cq | no Cq | no Cq | no Cq | no Cq | no Cq | |
| PCV2 piglet 2 | no Cq | no Cq | no Cq | no Cq | no Cq | no Cq | |
| PCV2 piglet 3 | no Cq | no Cq | no Cq | no Cq | no Cq | no Cq | |
| PCV2 piglet 4 | no Cq | no Cq | no Cq | no Cq | no Cq | no Cq | |
| PCV2 piglet 5 | no Cq | no Cq | no Cq | no Cq | no Cq | no Cq | |
| PCV2 piglet 6 | no Cq | no Cq | no Cq | no Cq | no Cq | no Cq |
For samples containing porcine adenoviruses, equine arteritis virus and porcine circoviruses, the viral load was confirmed using appropriate real-time quantitative polymerase chain reaction (PCR) and reverse transcriptase (RT)-PCR assays (data not shown, 43–45).
For intra-assay reproducibility, 3 replicates each of a 10-fold dilution series of RNA extracted from MARC-145 cells infected with IAF-Klop were used. The inter-assay repeatability was determined for the same 10-fold dilution series on 3 separate days. All 3 primer pairs performed adequately across a dynamic range of at least 6 orders of magnitude (Figure 6; prepared with R, The R Project for Statistical Computing, http://www.r-project.org/).
Figure 6.
Reproducibility and repeatability for type 2 primer sets. For each of the 3 primer pairs, the quantification cycle (Cq) values of 9 replicates of the same serial 10-fold dilution of IAF-Klop viral RNA are shown as box plots. For each assay and dilution step, the coefficient of variation was calculated by dividing the standard deviation of quantification cycle values by their mean and multiplying by 100. This coefficient is indicated below each box plot.
Discussion
In general, SYBR Green-based detection methods are less expensive than probe-based assays (20), and they are particularly suitable for detecting nucleic acid targets characterized by sequence variability (22). The type 2 primer pairs selected in this study are capable of detecting PRRSV with a sensitivity and specificity that is on par with the reference assay. The primer pair previously published by Inoue et al (23), as well as a combination of primers from 2 other publications (12,24) are highly sensitive for strains circulating in Canada. The availability of independent assays with different target regions allows cross-confirmation of results and helps to prevent false positives caused by PCR product contamination. The selection of suitable primers is a crucial step in the development of a pen-side test (7), and efforts are now underway to adapt them to in-gel PCR amplification cassettes for multi-target, multi-sample detection of veterinary pathogens at the point of care (8). All performance metrics will be reconfirmed in the final pen-side format.
Acknowledgments
This study was funded by the Alberta Livestock and Meat Agency Ltd. as part of a pilot project assessing the pen-side molecular diagnosis of PCV2 and PRRSV (project number 2012R033R).
The authors thank all collaborators who generously provided cells, samples and virus strains for the study: Dr. Davor Ojkic, University of Guelph Laboratory Services, Guelph, Ontario (PRRSV strains 96-38295, 97-38724, 97-43525, 32598, 32598, 35794, V106-1, V741, V1130-3, V1211, V1310, V1321, V2315, V2402, V38101 and V44764), Professor Tanja Opriessnig, Iowa State University, Ames, Iowa, USA (PRRSV strains VR2385, SDSU73, JA142, 2010011381 and FL12), Professor Éva Nagy, University of Guelph, Guelph, Ontario (porcine adenoviruses), Professor Carl A. Gagnon, Université de Montréal, Montreal, Quebec (PRRSV strains IAF-Klop and LV), Professor Robin Yates, University of Calgary, Calgary, Alberta (MARC-145 cells and PRRSV strain NVSL 97-7895), and Dr. Zaheer Iqbal, Canadian Food Inspection Agency, Lethbridge Laboratory, Lethbridge, Alberta (RK13 cells and equine arteritis virus strain ARVAC®).
References
- 1.Shi M, Lemey P, Singh Brar M, et al. The spread of type 2 porcine reproductive and respiratory syndrome virus (PRRSV) in North America: A phylogeographic approach. Virology. 2013;447:146–154. doi: 10.1016/j.virol.2013.08.028. [DOI] [PubMed] [Google Scholar]
- 2.Holtkamp DJ, Kliebenstein JB, Neumann EJ, et al. Assessment of the economic impact of porcine reproductive and respiratory syndrome virus on United States pork producers. J Swine Health Prod. 2013;21:72–84. [Google Scholar]
- 3.Corzo CA, Mondaca E, Wayne S, et al. Control and elimination of porcine reproductive and respiratory syndrome virus. Virus Res. 2010;154(1–2):185–192. doi: 10.1016/j.virusres.2010.08.016. [DOI] [PubMed] [Google Scholar]
- 4.Madi M, Hamilton A, Squirrell D, et al. Rapid detection of foot-and-mouth disease virus using a field-portable nucleic acid extraction and real-time PCR amplification platform. Vet J. 2012;193:67–72. doi: 10.1016/j.tvjl.2011.10.017. [DOI] [PubMed] [Google Scholar]
- 5.Gao M, Cui J, Ren Y, et al. Development and evaluation of a novel reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay for detection of type II porcine reproductive and respiratory syndrome virus. J Virol Methods. 2012;185:18–23. doi: 10.1016/j.jviromet.2012.05.016. [DOI] [PubMed] [Google Scholar]
- 6.Rovira A, Abrahante J, Murtaugh M, Muñoz-Zanzi C. Reverse transcription loop-mediated isothermal amplification for the detection of Porcine reproductive and respiratory syndrome virus. J Vet Diagn Invest. 2009;21:350–354. doi: 10.1177/104063870902100308. [DOI] [PubMed] [Google Scholar]
- 7.Aebischer A, Wernike K, Hoffmann B, Beer M. Rapid genome detection of Schmallenberg virus and bovine viral diarrhea virus by use of isothermal amplification methods and high-speed real-time reverse transcriptase PCR. J Clin Microbiol. 2014;52:1883–92. doi: 10.1128/JCM.00167-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Manage DP, Lauzon J, Atrazev A, et al. An enclosed in-gel PCR amplification cassette with multi-target, multi-sample detection for platform molecular diagnostics. Lab Chip. 2013;13:2576–2584. doi: 10.1039/c3lc41419a. [DOI] [PubMed] [Google Scholar]
- 9.Fang Y, Schneider P, Zhang WP, Faaberg KS, Nelson EA, Rowland RR. Diversity and evolution of a newly emerged North American Type 1 porcine arterivirus: Analysis of isolates collected between 1999 and 2004. Arch Virol. 2007;152:1009–1017. doi: 10.1007/s00705-007-0936-y. [DOI] [PubMed] [Google Scholar]
- 10.Meng XJ, Paul PS, Halbur PG, Lum MA. Phylogenetic analyses of the putative M (ORF 6) and N (ORF 7) genes of porcine reproductive and respiratory syndrome virus (PRRSV): Implication for the existence of two genotypes of PRRSV in the U.S.A. and Europe. Arch Virol. 1995;140:745–755. doi: 10.1007/BF01309962. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Wernike K, Hoffmann B, Dauber M, Lange E, Schirrmeier H, Beer M. Detection and typing of highly pathogenic porcine reproductive and respiratory syndrome virus by multiplex real-time rt-PCR. PLoS One. 2012;7:e38251. doi: 10.1371/journal.pone.0038251. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Wernike K, Bonilauri P, Dauber M, et al. Porcine reproductive and respiratory syndrome virus: Interlaboratory ring trial to evaluate real-time reverse transcription polymerase chain reaction detection methods. J Vet Diagn Invest. 2012;24:855–866. doi: 10.1177/1040638712452724. [DOI] [PubMed] [Google Scholar]
- 13.Manage DP, Lauzon J, Atrazhev A, Pang X, Pilarski LM. A novel method for sample delivery and testing of whole blood: Gel strip PCR for point of care (POC) molecular diagnostics. Lab Chip. 2013;13:4011–4014. doi: 10.1039/c3lc50755f. [DOI] [PubMed] [Google Scholar]
- 14.Bustin SA, Benes V, Garson JA, et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin Chem. 2009;55:611–622. doi: 10.1373/clinchem.2008.112797. [DOI] [PubMed] [Google Scholar]
- 15.Mardassi H, Athanassious R, Mounir S, Dea S. Porcine reproductive and respiratory syndrome virus: Morphological, biochemical and serological characteristics of Quebec isolates associated with acute and chronic outbreaks of porcine reproductive and respiratory syndrome. Can J Vet Res. 1994;58:55–64. [PMC free article] [PubMed] [Google Scholar]
- 16.Hoffmann B, Eschbaumer M, Beer M. Real-time quantitative reverse transcription-PCR assays specifically detecting blue-tongue virus serotypes 1, 6, and 8. J Clin Microbiol. 2009;47:2992–2994. doi: 10.1128/JCM.00599-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Kim HS, Kwang J, Yoon IJ, Joo HS, Frey ML. Enhanced replication of porcine reproductive and respiratory syndrome (PRRS) virus in a homogeneous subpopulation of MA-104 cell line. Arch Virol. 1993;133:477–483. doi: 10.1007/BF01313785. [DOI] [PubMed] [Google Scholar]
- 18.Mouillesseaux KP, Klimpel KR, Dhar AK. Improvement in the specificity and sensitivity of detection for the Taura syndrome virus and yellow head virus of penaeid shrimp by increasing the amplicon size in SYBR Green real-time RT-PCR. J Virol Methods. 2003;111:121–127. doi: 10.1016/s0166-0934(03)00167-8. [DOI] [PubMed] [Google Scholar]
- 19.Hoffmann B, Depner K, Schirrmeier H, Beer M. A universal heterologous internal control system for duplex real-time RT-PCR assays used in a detection system for pestiviruses. J Virol Methods. 2006;136:200–209. doi: 10.1016/j.jviromet.2006.05.020. [DOI] [PubMed] [Google Scholar]
- 20.Mackay IM. Real-time PCR in the microbiology laboratory. Clin Microbiol Infect. 2004;10:190–212. doi: 10.1111/j.1198-743x.2004.00722.x. [DOI] [PubMed] [Google Scholar]
- 21.Chai Z, Ma W, Fu F, et al. A SYBR Green-based real-time RT-PCR assay for simple and rapid detection and differentiation of highly pathogenic and classical type 2 porcine reproductive and respiratory syndrome virus circulating in China. Arch Virol. 2013;158:407–415. doi: 10.1007/s00705-012-1504-7. [DOI] [PubMed] [Google Scholar]
- 22.Varga A, James D. Real-time RT-PCR and SYBR Green I melting curve analysis for the identification of Plum pox virus strains C, EA, and W: Effect of amplicon size, melt rate, and dye translocation. J Virol Methods. 2006;132(1–2):146–153. doi: 10.1016/j.jviromet.2005.10.004. [DOI] [PubMed] [Google Scholar]
- 23.Inoue R, Tsukahara T, Sunaba C, Itoh M, Ushida K. Simple and rapid detection of the porcine reproductive and respiratory syndrome virus from pig whole blood using filter paper. J Virol Methods. 2007;141:102–106. doi: 10.1016/j.jviromet.2006.11.030. [DOI] [PubMed] [Google Scholar]
- 24.Oleksiewicz MB, Bøtner A, Madsen KG, Storgaard T. Sensitive detection and typing of porcine reproductive and respiratory syndrome virus by RT-PCR amplification of whole viral genes. Vet Microbiol. 1998;64:7–22. doi: 10.1016/S0378-1135(98)00254-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Gilbert SA, Larochelle R, Magar R, Cho HJ, Deregt D. Typing of porcine reproductive and respiratory syndrome viruses by a multiplex PCR assay. J Clin Microbiol. 1997;35:264–267. doi: 10.1128/jcm.35.1.264-267.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Ait-Ali T, Wilson AD, Westcott DG, et al. Innate immune responses to replication of porcine reproductive and respiratory syndrome virus in isolated Swine alveolar macrophages. Viral Immunol. 2007;20:105–118. doi: 10.1089/vim.2006.0078. [DOI] [PubMed] [Google Scholar]
- 27.Zhang YJ, Stein DA, Fan SM, et al. Suppression of porcine reproductive and respiratory syndrome virus replication by morpholino antisense oligomers. Vet Microbiol. 2006;117:117–129. doi: 10.1016/j.vetmic.2006.06.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Xia B, Song H, Chen Y, Zhang X, Xia X, Sun H. Efficient inhibition of porcine reproductive and respiratory syndrome virus replication by artificial microRNAs targeting the untranslated regions. Arch Virol. 2013;158:55–61. doi: 10.1007/s00705-012-1455-z. [DOI] [PubMed] [Google Scholar]
- 29.Ogawa H, Taira O, Hirai T, et al. Multiplex PCR and multiplex RT-PCR for inclusive detection of major swine DNA and RNA viruses in pigs with multiple infections. J Virol Methods. 2009;160:210–214. doi: 10.1016/j.jviromet.2009.05.010. [DOI] [PubMed] [Google Scholar]
- 30.Xu XG, Chen GD, Huang Y, et al. Development of multiplex PCR for simultaneous detection of six swine DNA and RNA viruses. J Virol Methods. 2012;183:69–74. doi: 10.1016/j.jviromet.2012.03.034. [DOI] [PubMed] [Google Scholar]
- 31.Tian H, Wu J, Shang Y, Cheng Y, Liu X. The development of a rapid SYBR one step real-time RT-PCR for detection of Porcine Reproductive and Respiratory Syndrome Virus. Virol J. 2010;7:90. doi: 10.1186/1743-422X-7-90. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Chung WB, Chan WH, Chaung HC, Lien Y, Wu CC, Huang YL. Real-time PCR for quantitation of porcine reproductive and respiratory syndrome virus and porcine circovirus type 2 in naturally-infected and challenged pigs. J Virol Methods. 2005;124(1–2):11–19. doi: 10.1016/j.jviromet.2004.10.003. [DOI] [PubMed] [Google Scholar]
- 33.Miller LC, Laegreid WW, Bono JL, Chitko-McKown CG, Fox JM. Interferon type I response in porcine reproductive and respiratory syndrome virus-infected MARC-145 cells. Arch Virol. 2004;149:2453–2463. doi: 10.1007/s00705-004-0377-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Lurchachaiwong W, Payungporn S, Srisatidnarakul U, Mungkundar C, Theamboonlers A, Poovorawan Y. Rapid detection and strain identification of porcine reproductive and respiratory syndrome virus (PRRSV) by real-time RT-PCR. Lett Appl Microbiol. 2008;46:55–60. doi: 10.1111/j.1472-765X.2007.02259.x. [DOI] [PubMed] [Google Scholar]
- 35.Giammarioli M, Pellegrini C, Casciari C, De Mia GM. Development of a novel hot-start multiplex PCR for simultaneous detection of classical swine fever virus, African swine fever virus, porcine circovirus type 2, porcine reproductive and respiratory syndrome virus and porcine parvovirus. Vet Res Commun. 2008;32:255–262. doi: 10.1007/s11259-007-9026-6. [DOI] [PubMed] [Google Scholar]
- 36.Yang ZZ, Fang WH, Habib M. First results of detection of PRRSV and CSFV RNA by SYBR Green I-based quantitative PCR. J Vet Med B Infect Dis Vet Public Health. 2006;53:461–467. doi: 10.1111/j.1439-0450.2006.00994.x. [DOI] [PubMed] [Google Scholar]
- 37.Martínez E, Riera P, Sitjà M, Fang Y, Oliveira S, Maldonado J. Simultaneous detection and genotyping of porcine reproductive and respiratory syndrome virus (PRRSV) by real-time RT-PCR and amplicon melting curve analysis using SYBR Green. Res Vet Sci. 2008;85:184–193. doi: 10.1016/j.rvsc.2007.10.003. [DOI] [PubMed] [Google Scholar]
- 38.Kleiboeker SB, Schommer SK, Lee SM, Watkins S, Chittick W, Polson D. Simultaneous detection of North American and European porcine reproductive and respiratory syndrome virus using real-time quantitative reverse transcriptase-PCR. J Vet Diagn Invest. 2005;17:165–170. doi: 10.1177/104063870501700211. [DOI] [PubMed] [Google Scholar]
- 39.Drigo M, Franzo G, Belfanti I, Martini M, Mondin A, Ceglie L. Validation and comparison of different end point and real time RT-PCR assays for detection and genotyping of porcine reproductive and respiratory syndrome virus. J Virol Methods. 2014;201:79–85. doi: 10.1016/j.jviromet.2014.02.015. [DOI] [PubMed] [Google Scholar]
- 40.Iseki H, Takagi M, Kuroda Y, et al. Application of a SYBR®Green one step real-time RT-PCR assay to detect type 1 porcine reproductive and respiratory syndrome virus. J Vet Med Sci. 2014;76:1411–1413. doi: 10.1292/jvms.14-0010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Gerber PF, O’Neill K, Owolodun O, et al. Comparison of commercial real-time reverse transcription-PCR assays for reliable, early, and rapid detection of heterologous strains of porcine reproductive and respiratory syndrome virus in experimentally infected or noninfected boars by use of different sample types. J Clin Microbiol. 2013;51:547–556. doi: 10.1128/JCM.02685-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Wensvoort G, Terpstra C, Pol JM, et al. Mystery swine disease in The Netherlands: The isolation of Lelystad virus. Vet Q. 1991;13:121–130. doi: 10.1080/01652176.1991.9694296. [DOI] [PubMed] [Google Scholar]
- 43.Hundesa A, Maluquer de Motes C, Albinana-Gimenez N, et al. Development of a qPCR assay for the quantification of porcine adenoviruses as an MST tool for swine fecal contamination in the environment. J Virol Methods. 2009;158(1–2):130–135. doi: 10.1016/j.jviromet.2009.02.006. [DOI] [PubMed] [Google Scholar]
- 44.Wernike K, Hoffmann B, Beer M. Single-tube multiplexed molecular detection of endemic porcine viruses in combination with background screening for transboundary diseases. J Clin Microbiol. 2013;51:938–944. doi: 10.1128/JCM.02947-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Lu Z, Branscum AJ, Shuck KM, et al. Comparison of two real-time reverse transcription polymerase chain reaction assays for the detection of Equine arteritis virus nucleic acid in equine semen and tissue culture fluid. J Vet Diagn Invest. 2008;20:147–155. doi: 10.1177/104063870802000202. [DOI] [PubMed] [Google Scholar]






