Abstract
Ebola is an emerging infectious disease caused by a deadly virus belonging to the family Filoviridae, genus Ebolavirus. Based on their geographical distribution, Ebolavirus has been classified into total five species so far, mainly Zaire, Sudan, Taï Forest, Bundibugyo and Reston. It is important to be able to differentiate the Ebolavirus species as they significantly differ in pathogenicity and more than one species can be present in an area. We have developed a one-step step-down RT-PCR detecting all five Ebolavirus species with high sensitivity (1 copy of Ebolavirus DNA, 10 copies of RNA and 320 copies of RNA spiked in 1 ml whole blood). The primers and FRET-probes we designed enabled us to differentiate five Ebolavirus species by distinct T m (Zaire: flat peaks between 53.0°C and 56.9°C; Sudan: 51.6°C; Reston: flat peaks between 47.5°C and 54.9°C; Tai Forest: 52.8°C; Bundibugyo: dual peaks at 48.9°C and 53.5°C), and by different amplicon sizes (Zaire 255bp, Sudan 211bp, Reston 192bp, Taï Forest 166bp, Bundibugyo 146bp). This one-size-fit-all assay enables the rapid detection and discrimination of the five Ebolavirus species in a single reaction.
Introduction
Ebola Virus Disease (EVD), previously known as Ebola hemorrhagic fever, is an emerging infectious disease caused by a deadly virus of the family Filoviridae, genus Ebolavirus [1, 2]. Of the five identified Ebolavirus species, four of them (Zaire ebolavirus, Sudan ebolavirus, Taï Forest ebolavirus and Bundibugyo ebolavirus) are known to cause disease in humans, whereas the fifth (Reston ebolavirus) causes disease in non-human primates and swine only [3–6]. Since human infections were first reported in 1976 on the Ebola River in Democratic Republic of the Congo [7], outbreaks of EVD have occurred into twelve countries (South Sudan, Democratic Republic of Congo, Côte d’Ivoire, Gabon, Uganda, Republic of Congo, Guinea, Philippines, Nigeria, Senegal, Liberia, Mali). There have also been imported cases in Sierra Leone, Spain, and the United States of America [8–10, 3, 11, 12]. By January 25, 2015, a total of 22, 092 cases of Ebola infections have been confirmed, of which 8, 810 cases of EVD have been fatal [12].
While simple or multiplex PCRs have been successfully used to detect Ebolavirus, most of the published assays can only detect a single Ebolavirus species [13, 14] or, in the case of those that detect multiple Ebolavirus species, they show reduced sensitivity [15–17]. Whereas simple PCR tends to provide high sensitivity but lacks ability to differentiate multiple targets simultaneously [13, 14, 18], multiplex PCR has the capacity to detect and differentiate multiple targets but tends to have a reduced sensitivity [17, 19–21]. The TaqMan RT-PCR assay targeting the nucleoprotein gene of Zaire ebolavirus developed by Huang Y et al. [14] had a wide range in sensitivity, from 103 to 109 virus copies per reaction. The primers and fluorogenic probe of the one-step qRT-PCR described by Towner JS et al. [13] were specific for Sudan ebolavirus and showed a high sensitivity (103 genomic-sense Ebolavirus-RNA copies per ml; one genomic-sense RNA per reaction). Panning et al. [19] established a complicated system with 5 primers and 3 probes for Filoviridae with the detection limit from 487 to 4546 RNA copies/ml depending on the species of Ebolavirus. Trombley et al. [20] established a system to detect multiple hemorrhagic fever viruses including Ebolavirus by using 48 TaqMan-based PCR assays with the limit of detection for the assays ranging from 10 to 0.001 plaque-forming units / PCR.
While RT-PCR with high sensitivity and specificity have been widely used to quantify RNA viruses, RNA templates as positive controls were not always available and safe for highly infective pathogens such as SARS virus and highly pathogenic avian influenza viruses. In addition, RNA templates from killed viruses tend to degrade under the influence of RNase and metal ions. In comparison, the VLPs equipped with specific RNA fragments have been widely used as stable, reliable and safe positive controls for RT-PCR [22–24].
A generic PCR that can detect and differentiate all Ebolavirus species is needed as increased international movement of people increases the potential of transmission for multiple Ebolavirus species with varying pathogenicity [11, 17, 25–28]. Here we report a highly-sensitive one-step reverse-transcription FRET-PCR capable of rapidly identifying and differentiating all five Ebolavirus species.
Materials and Methods
Plasmids containing portion of Ebolavirus
Five plasmids, each compromised the first 600 bp (5’end) of five Ebolavirus species (Zaire ebolavirus, Sudan ebolavirus, Reston ebolavirus, Taï Forest ebolavirus and Bundibugyo ebolavirus), were created (GenScript, Nanjing, China) to serve as positive controls and quantitative standards in this study. The nucleotide fragments were synthesized and inserted into the pUC57 cloning vector, and the resulting plasmids were linearized with Sac I (Takara Biotechnology, Dalian, China) and quantified using the PicoGreen DNA fluorescence assay (Molecular Probes, Eugene, OR, USA) for preparation of quantitative standards (104, 103, 102, 101, 100 copies /10 μl).
Preparation of Ebolavirus RNA transcripts
Since it is not allowed to use viable Ebolavirus for research in China and none of five Ebolavirus species was available to us, transcripts made from the plasmids described above and virus-like-particles (VLPs) containing Ebolavirus RNA fragment were used as positive controls. The transcription reaction was run with MEGAscript Kit (Ambion by life technologies, Carlsbad, CA, USA) according to the manufacturer’s instructions. After incubation at 37°C for 4h, the transcribed products were treated with TURBO DNase (Ambion by life technologies, California, USA), followed by precipitation with lithium chloride. Finally, the yield of RNA transcripts was determined with the Quant-iT RiboGreen RNA Kit (Molecular Probes, Eugene, OR, USA) for preparation of the RNA standards (105, 104, 103, 102, 101, 100copies /10μl).
Construction and expression of virus-like particles (VLPs) containing Ebolavirus NP RNA
In addition to the positive controls of plasmids and transcripts described above, we prepared also the VLPs containing the Ebolavirus NP RNA fragment to further verify the specificity and reverse-transcription efficiency of the established PCR in this study. The MS2 VLPs containing the NP RNA fragments of each of these five Ebolavirus species were prepared as the method described by Drosten et al. [29]. The primers (forward primer: 5’-ATGAATTCTCCTGCTCAACTTCCTGTCG-3’; reverse primer: 5’-GCAAGCTTGTTAGTAGATGCCGGAGTTT-3’) of MS2 phage (ATCC 15591-B1) assembly protein gene, coat protein gene and the fragment of Eblolavirus RNA NP gene was synthesized according to their sequences from GenBank data (Gene Accession#: KC24280) and were used to amplify their cDNAs by RT-PCR. Expression vector pTrc99a (Pharmacia) and their cDNA fragments were ligated with T4 DNA ligase after digestion with restriction enzyme. The prokaryotic expression was obtained by transformation of recombinant plasmids into E. coli JM109.The obtained VLPs were purified and tested by quantitative analysis and RT-PCR.
Inoculation of transcribed Ebolavirus RNA and VLPs in human blood
Ten μl serially diluted transcribed RNAs and VLPs (106, 105, 104, 103, 102, 101 copies/10 μl) were thoroughly mixed with 50 μl human whole blood (collected in EDTA) and 150 μl 1× PBS for RNA extraction (High Pure RNA Isolation Kit, Roche, Mannheim, Germany). After vortexing for 15s with Lysis/-Binding Buffer and Red Cell Lysis Buffer (Roche Diagnostics GmbH, Mannheim, Germany), the blood samples were transferred to the High Pure filter tube and RNA eluted with 60 μl elution buffer which was stored at -80°C until thawed at room temperature for RT-PCR.
One-step FRET RT-PCR for Ebolavirus
Primers and probes
The full genome sequences of five Ebolavirus species (two representing GenBank Accession # for Zaire ebolavirus NC_002549, KC24280; Sudan ebolavirus NC_006432, KC54539; Reston ebolavirus NC_004161, JX477166; Taï Forest ebolavirus NC_014372, FJ217162; Bundibugyo ebolavirus NC_014373, KC545396), and those two monophyletic genus (Marburgvirus KC545388, NC_001608; Cuevavirus JF828358, NC_016144) were obtained from GenBank (Fig 1). Based on the conserved and variable regions determined by Clustal Multiple Alignment, we identified highly conserved regions in 1–146 bp of the genome which were common to all five Ebolavirus species and used for the forward primer, 6-FAM probe and LCRed 640 probe (Fig 1, Table 1). The regions between 146 bp and 255 bp were highly conserved for individual Ebolavirus species but were highly variable among the different species and were thus used to design five reverse primers to specifically amplify only a single Ebolavirus species (Fig 1, Table 1). The primers and probes demonstrated high level of mismatches with Cuevavirus (35–40 mismatches) and Marburgvirus (no corresponding fragment).
Table 1. Primers and probes used in this study.
Primer/probe | Sequence (5’→3’) | Location | Note |
---|---|---|---|
Forward primer | CGGACACACAAAAAGAAAGAAG-3’ | 1–22 | Common to all Ebolavirus species |
6-FAM probe | 6-FAM- TAGTTAYTCGCACACAAWARRK-phos | 33–54 | |
LCRed probe | GAGGAAAATTDTTAATCTTCCTC-LCRed640 | 56–78 | |
Reverse primer-1 | GCCAATTCTCAGTGTTGGTATT | 125–146 | Specific for Bundibugyo |
Reverse primer-2 | GGAATGGGGTACTTCTGAACA | 146–166 | Specific for Taï Forest |
Reverse primer-3 | CATGTTGATGGTAATTGGTAATAG | 169–192 | Specific for Reston |
Reverse primer-4 | AAAGGCAAAGCAATACGACC | 192–211 | Specific for Sudan |
Reverse primer-5 | GAACTTGTGATGTGATAAGACCTA | 232–255 | Specific for Zaire |
Thermal cycling
One-step RT-PCR was performed in a LightCycler 480 II real-time PCR platform. Each reaction was performed in a 20μl final volume containing 10μl of plasmid DNA, transcribed RNA or VLPs and 10μl master mix with a final concentration of 1μM forward primer, 0.2μM 6-FAM probe, 0.2μM LCRed 640 probe, 1μM Reston ebolavirus reverse primer and 0.5μM reverse primers for the four other Ebolavirus species (Table 1). For each sample in 20μl reaction, 0.14 U SuperScript III reverse transcriptase (Invitrogen) was added and other reaction components were used as described [30]. Thermal cycling consisted of one reverse transcription step, 18 high-stringency step-down cycles and 30 relaxed-stringency fluorescence acquisition cycles. The reverse transcription step was at 55°C for 15 min, followed by denaturation at 95°C for 2 min. The 18 high-stringency step-down thermal cycles were 6×1 sec @ 95°C, 12 sec @ 70°C, 8 sec @ 72°C; 9×1 sec @ 95°C, 12 sec @ 68°C, 8 sec @ 72°C; 3×1 sec @ 95°C, 12 sec @ 66°C, 8 sec @ 72°C. The relaxed-stringency fluorescence acquisition cycling consisted of 30×1 sec @ 95°C, 8 sec @ 52°C, 30 sec @ 67°C and 30 sec @ 72°C.
High-resolution melting genotyping analysis
After the FRET-PCR was completed, the melting curve analysis for probes annealing to the PCR products was determined by monitoring the fluorescence from 38°C to 85°C as described previously [30, 31]. Data were analyzed as 640 nm: 530 nm (F4/F1) fluorescence ratios, and the first derivative of F4/F1 (-d(F4/F1)/dt) was evaluated (Fig 2).
Specificity of the one-step RT FRET-PCR
The BLASTN with the organism options of including and excluding Ebolavirus (taxid: 186536) was performed on each of the primers and probes to verify the specificity of the designed oligonucleotides we designed. Specificity of the one-step RT FRET-PCR was also evaluated by amplifying each of five plasmids containing portions of each Ebolavirus species (Zaire ebolavirus, Sudan ebolavirus, Reston, ebolavirus Taï Forest ebolavirus and Bundibugyo ebolavirus), and a mixture of the five plasmids (Fig 3). In addition, the following oligonucleotide polymers were synthesized (GenScript, Nanjing, China) to further test the sensitivity of the established PCR: 1) the first 100 bp of the PCR amplicon for EVD Zaire (contains forward primer and two probes); 2) the complimentary sequences of the first 100 bp of the PCR amplicon for EVD Zaire; 3) the 33–250 bp of the the PCR amplicon for EVD Zaire (contains two probes and five downstream primers).
The specificity of the established PCR in this work was further tested on the nucleic acids of other pathogens causing hemorrhagic fever or similar clinical signs as Ebolavirus (Bunyavirus, Japanese encephalitis virus, Cuevavirus, Dengue virus, Yellow fever virus, Hanta virus, forest encephalitis virus, Lassa fever virus, Marburg virus,; Nucleic acids of these viruses were provided by the National Institute for Food and Drug Control, China Food and Drug Administration). The PCR products from the reactions with the plasmids of the individual Ebolavirus species and the mixture containing them all, were verified by electrophoresis through a 4% agarose gel (BIOWEST, Hong Kong, China) at 90 v for 90 min and stained with SYBR Safe DNA Gel Stain (Invitrogen, Carlsbad, USA) (Fig 4). A high concentration (4%) of BIOWEST Gel (gel strength≥750, gelling range around 36–39°C, and melting range around 87–89°C) ensures efficient differentiation of the small sizes of PCR fragments in this study.
Sensitivity of the one-step RT FRET-PCR
The sensitivity was determined using serially diluted plasmids (104, 103, 102, 101, 100 copies of DNA/ 10 μl), transcribed Ebolavirus RNAs (105, 104, 103, 102, 101, 100 copies of RNA/ 10 μl) and Ebolavirus RNA-containing VLPs (105, 104, 103, 102, 101, 100 copies of RNA/ 10 μl). Also, human whole blood spiked with transcribed RNAs (106, 105, 104, 103, 102, 101 copies of RNA/tube with 50 μl whole blood) was amplified to determine the detection limit of the established one-step RT-PCR that could be expected with clinical samples.
Results and Discussion
Our one-step RT FRET-PCR was capable of detecting a single DNA copy and 10 RNA copies of all five Ebolavirus species (Figs 3 and 5). When whole blood spiked with transcribed Ebolavirus RNA and VLPs were tested, the detection limit was 100 copies of RNA per PCR reaction (Fig 5), equivalent to 320 copies of Ebolavirus in 1 ml whole blood. Triplicates were performed for each assay. The BLASTN results for each of the 8 oligonucleotides we used in the one-step RT FRET-PCR showed they were specific for the Ebolavirus species and did not cross-react with partial amplicons or other viruses in the family Filoviridae. No PCR amplification was observed with nucleic acids of eight types of pathogens which induce hemorrhagic fever or similar clinical signs as Ebolavirus.
Due to the different levels of mismatches between the probes we designed and the PCR amplicons we generated from the different Ebolavirus species (Fig 1), melting curve analysis of the PCRs products showed unique and distinct T m for each of the five Ebolavirus species (Fig 2): Zaire: flat dual peaks between 53.0°C and 56.9°C; Sudan: 51.6°C; Reston: flat dual peaks between 47.5°C and 54.9°C; Taï Forest: 52.8°C; Bundibugyo: dual peaks at 48.9°C and 53.5°C. The temperatures and shapes of the melting curves were consistent even with changes in the concentrations of Ebolavirus used in the reaction (Fig 2). Furthermore, the specific reverse primers we designed gave amplicons of different sizes for each of the five Ebolavirus species (Zaire ebolavirus 255bp; Sudan ebolavirus 211bp; Reston ebolavirus 192bp; Taï Forest ebolavirus 166bp; Bundibugyo ebolavirus 146bp) (Fig 4). The detection sensitivity, melting temperatures and amplicon sizes of each of these five Ebolavirus species were confirmed when the established RT-PCR was applied on Ebolavirus NP RNA-containing VLPs (Fig 6).
In the one-step RT-PCR established in this study, the combination of a single set of forward primer and probes with five different reverse primers gave very high sensitivity and differential ability. While the system detects all five Ebolavirus with highly sensitivity (1 copy of DNA, 10 copies of RNA, or 320 copies of RNA / 1 ml whole blood), the unique T m distribution enables the convenient differentiation of the five Ebolavirus species (Fig 2). In laboratories that do not have real-time PCR machines and melting curve analysis, our primers can be used in standard PCRs and the five Ebolavirus species differentiated by the specific size of the amplicon identified for each species in gel electrophoresis (Fig 4).
While RNA templates as positive controls were not always available and safe for highly infective pathogens such as SARS virus and highly pathogenic avian influenza viruses, the VLPs equipped with specific RNA fragments have been widely used as stable, reliable and safe positive controls for RT-PCR [22–24]. The VLPs containing Ebolavirus NP RNA established in this work are adopted as standards to evaluate and certify Ebolavirus-related commercial diagnostic kits by National Institute for Food and Drug Control, Food and Drug Administration of China.
While simple PCR tends to provide high sensitivity but lacks ability to differentiate multiple targets simultaneously, multiplex PCR has the capacity to detect and differentiate multiple targets but tends to have a reduced sensitivity. Our study has established a novel highly-sensitive one-step RT FRET-PCR with one set of upstream primer /probes and five downstream primers that can rapidly identify and differentiate all five Ebolavirus species.
Data Availability
All relevant data are within the paper.
Funding Statement
This project was supported by grant from the National Natural Science Foundation of China (NO: 31472225; http://www.nsfc.gov.cn/publish/portal1/) and the Priority Academic Program Development of Jiangsu Higher Education Institutions, Yangzhou, Jiangsu, P. R. China (http://jsycw.ec.js.edu.cn/). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1. Ross AG, Olveda RM, Li YS. Are we ready for a global pandemic of Ebola virus? Int J Infect Dis. 2014;28: 217–218. 10.1016/j.ijid.2014.09.001 [DOI] [PubMed] [Google Scholar]
- 2. Kuhn JH, Bao Y, Bavari S, Becker S, Bradfute S, Brauburger K, et al. Virus nomenclature below the species level: a standardized nomenclature for filovirus strains and variantsrescued from cDNA. Arch Virol. 2014;159: 1229–1237. 10.1007/s00705-013-1877-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Barrette RW, Metwally SA, Rowland JM, Xu L, Zaki SR, Nichol ST, et al. Discovery of swine as a host for the Reston ebolavirus . Science. 2009;325: 204–206. 10.1126/science.1172705 [DOI] [PubMed] [Google Scholar]
- 4. Hartman AL, Towner JS, Nichol ST. Ebola and Marburg hemorrhagic fever. Clin Lab Med. 2010;30: 161–177. 10.1016/j.cll.2009.12.001 [DOI] [PubMed] [Google Scholar]
- 5. Feldmann H, Geisbert TW. Ebola haemorrhagic fever. Lancet. 2011;377: 849–862. 10.1016/S0140-6736(10)60667-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Carroll SA, Towner JS, Sealy TK, McMullan LK, Khristova ML, Burt FJ, et al. Molecular evolution of viruses of the family Filoviridae based on 97 whole-genome sequences. J Virol. 2013;87: 2608–2616. 10.1128/JVI.03118-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Johnson KM, Lange JV, Webb PA, Murphy FA. Isolation and partial characterisation of a new virus causing acute haemorrhagic fever in Zaire. Lancet. 1977;1: 569–571. [DOI] [PubMed] [Google Scholar]
- 8. Heymann DL, Weisfeld JS, Webb PA, Johnson KM, Cairns T, Berquist H. Ebola hemorrhagic fever: Tandala, Zaire, 1977–1978. J Infect Dis. 1980;142: 372–376. [DOI] [PubMed] [Google Scholar]
- 9. Le Guenno B, Formenty P, Wyers M, Gounon P, Walker F, Boesch C. Isolation and partial characterization of a new strain of Ebola virus. Lancet. 1995;345: 1271–1274. [DOI] [PubMed] [Google Scholar]
- 10. Towner JS, Sealy TK, Khristova ML, Albarino CG, Conlan S, Reeder SA, et al. Newly discovered ebola virus associated with hemorrhagic fever outbreak in Uganda. PLoS Pathog. 2008; 4:e1000212 10.1371/journal.ppat.1000212 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Pigott DM, Golding N, Mylne A, Huang Z, Henry AJ, Weiss DJ, et al. Mapping the zoonotic niche of Ebola virus disease in Africa. Elife. 2014; 3: e04395 10.7554/eLife.04395 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.World Health Organization. Ebola Current Situation, data up to 25 January 2015. Available: http://apps.who.int/ebola/en/current-situation.
- 13. Towner JS, Rollin PE, Bausch DG, Sanchez A, Crary SM, Vincent M, et al. Rapid diagnosis of Ebola hemorrhagic fever by reverse transcription-PCR in an outbreak setting and assessment of patient viral load as a predictor of outcome. J Virol. 2004;78: 4330–4341. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Huang Y, Wei H, Wang Y, Shi Z, Raoul H, Yuan Z. Rapid detection of filoviruses by real-time TaqMan polymerase chain reaction assays. Virol Sin. 2012;27: 273–277. 10.1007/s12250-012-3252-y [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Ogawa H, Miyamoto H, Ebihara H, Ito K, Morikawa S, Feldmann H, et al. Detection of all known filovirus species by reverse transcription-polymerase chain reaction using a primer set specific for the viral nucleoprotein gene. J Virol Methods. 2010;171: 310–313. 10.1016/j.jviromet.2010.11.010 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Liu Y, Shi ZX, Ma YK, Wang HT, Wang ZY, Shao DH, et al. Development of SYBR Green I real-time RT-PCR for the detection of Ebola virus. Bing Du Xue Bao. 2012;28: 567–571. [PubMed] [Google Scholar]
- 17. Fajfr M, Neubauerova V, Pajer P, Kubickova P, Ruzek D. Detection panel for identification of twelve hemorrhagic viruses using real-time RT-PCR. Epidemiol Mikrobiol Imunol. 2014;63: 238–244. [PubMed] [Google Scholar]
- 18. Gibb TR, Norwood DA Jr, Woollen N, Henchal EA. Development and evaluation of a fluorogenic 5' nuclease assay to detect and differentiate between Ebola virus subtypes Zaire and Sudan. J Clin Microbiol. 2001;39: 4125–4130. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Panning M, Laue T, Olschlager S, Eickmann M, Becker S, Raith S, et al. Diagnostic reverse-transcription polymerase chain reaction kit for filoviruses based on the strain collections of all European biosafety level 4 laboratories. J Infect Dis. 2007;196(Suppl 2): S199–204. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Trombley AR, Wachter L, Garrison J, Buckley-Beason VA, Jahrling J, Hensley LE, et al. Comprehensive panel of real-time TaqMan polymerase chain reaction assays for detection and absolute quantification of filoviruses, arenaviruses, and New World hantaviruses. Am J Trop Med Hyg. 2010;82: 954–960. 10.4269/ajtmh.2010.09-0636 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Yang Y, Bai L, Hu KX, Yang ZH, Hu JP, Wang J. Multiplex real-time PCR method for rapid detection of Marburg virus and Ebola virus. Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi. 2012;26: 313–315. [PubMed] [Google Scholar]
- 22. Chen XS, Garcea RL, Goldberg I, Casini G, Harrison SC. Structure of small virus-like particles assembled from the L1 protein of human papillomavirus 16. Mol Cell. 2000;5: 557–567. [DOI] [PubMed] [Google Scholar]
- 23. Joshi SM, Vogt VM. Role of the Rous sarcoma virus p10 domain in shape determination of gag virus-like particles assembled in vitro and within Escherichia coli . J Virol. 2000;74: 10260–10268. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Xiang J, Wünschmann S, George SL, Klinzman D, Schmidt WN, LaBrecque DR, et al. Recombinant hepatitis C virus-like particles expressed by Baculovirus: utility in cell-binding and antibody detection assays. J Med Virol. 2002;68: 537–543. [DOI] [PubMed] [Google Scholar]
- 25. Bhaumik S. Twin Ebola outbreaks in Africa: Uganda and Democratic Republic of Congo affected. Natl Med J India. 2012;25: 317 [PubMed] [Google Scholar]
- 26. Goeijenbier M, van Kampen JJ, Reusken CB, Koopmans MP, van Gorp EC. Ebola virus disease: a review on epidemiology, symptoms, treatment and pathogenesis. Neth J Med. 2014;72: 442–448. [PubMed] [Google Scholar]
- 27. Li YH, Chen SP. Evolutionary history of Ebola virus. Epidemiol Infect.http://www.ncbi.nlm.nih.gov/pubmed/24040779 2014;142: 1138–1145. 10.1017/S0950268813002215 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Burd EM. Ebola Virus: a Clear and Present Danger. J Clin Microbiol. 2015;53: 4–8. 10.1128/JCM.03115-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Drosten C, Seifried E, Roth WK. TaqMan 5'-nuclease human immunodeficiency virus type 1 PCR assay with phage-packaged competitive internalcontrol for high-throughput blood donor screening. J Clin Microbiol. 2001;39: 4302–4308. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Wang C, Ahluwalia SK, Li Y, Gao D, Poudel A, Chowdhury E, et al. Frequency and therapy monitoring of canine Babesia spp. infection by high-resolution melting curve quantitative FRET-PCR. Vet Parasitol. 2010;168: 11–18. 10.1016/j.vetpar.2009.10.015 [DOI] [PubMed] [Google Scholar]
- 31. Kelly PJ, Xu C, Lucas H, Loftis A, Abete J, Zeoli F, et al. Ehrlichiosis, babesiosis, anaplasmosis and hepatozoonosis in dogs from St Kitts, West Indies. PLoS One 2013;8: e53450 10.1371/journal.pone.0053450 [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
All relevant data are within the paper.