Abstract
Background
Epidermal hyperproliferation resulting in acanthosis is an important clinical observation in atopic dermatitis and its underlying mechanisms are not completely understood by now.
Objective
Since elevated levels of histamine are present in lesional skin, we investigated the effect of histamine, especially with regard to H4R activation, on the proliferation of human and murine keratinocytes.
Methods
The expression of H4R on human and murine keratinocytes was detected by real-time PCR. Keratinocyte proliferation was evaluated by different in vitro cell proliferation assays, scratch assays and measurement of epidermal thickness of murine skin.
Results
We detected H4R mRNA on foreskin keratinocytes and on outer root sheath keratinocytes; H4R mRNA was more abundant in keratinocytes from patients with atopic dermatitis as compared to non-atopic donors. Stimulation of foreskin keratinocytes, atopic dermatitis outer root sheath keratinocytes and H4R transfected HaCaT cells with histamine and H4R agonist resulted in an increase of proliferation, which was blocked with the H4R-specific antagonist JNJ7777120. Abdominal epidermis of H4R-deficient mice was significantly thinner and the in vitro proliferation of keratinocytes derived from H4R-deficient mice was lower compared to control mice. Interestingly, we only detected H4R expression on murine keratinocytes after stimulation with lipopolysaccharide and peptidoglycane.
Conclusion
The H4R is highly expressed on keratinocytes from atopic dermatitis patients and its stimulation induces keratinocyte proliferation. This might represent a mechanism that contributes to the epidermal hyperplasia observed in atopic dermatitis.
Keywords: Histamine, Keratinocyte, Proliferation, Histamine 4 receptor, Human, Mouse, Atopic dermatitis
INTRODUCTION
Atopic dermatitis affects up to 20% of the population and its incidence is steadily rising.1 Moreover, the therapeutic interventions for atopic dermatitis are limited, because the disease is not fully understood yet. Atopic dermatitis is a multifactorial disease whose development can be caused by numerous trigger factors and involves the interaction of different cell types, on one hand of the skin resident keratinocytes and on the other hand of immune cells present in the skin or infiltrating the skin upon inflammation.2 Keratinocytes have been shown to release a set of mediators, among them chemokines and cytokines, which are important for the attraction of immune cells to atopic dermatitis lesions.3 In turn the expression of cell surface receptors is upregulated on keratinocytes in response to signals from the surrounding immune cells.4 Apart from the involvement in the immunological response, keratinocytes contribute to the pathology of atopic dermatitis by a change in their growth characteristics. Thickening of the epidermis is evident in chronic lesions of eczema as indicated clinically by lichenification and histologically by acanthosis. It has been shown previously that this epidermal hyperproliferation might in part be due to the inflammatory mediators TGF-α and GM-CSF.5, 6 Histamine is another important inflammatory mediator that is present at high levels in the skin of atopic dermatitis patients7 and plays an important role in disease pathology.8 Keratinocytes were already shown to express the histamine 1 receptor (H1R) and H2R and histamine stimulation modulates the expression of inflammatory mediators, such as interleukin-6 (IL-6), IL-8 and CCL5 as well as cell surface molecules MHC-II and ICAM-1.4, 9 The previously performed work with regard to histamine and keratinocytes did not include the most recently described H4R.10, 11 The H4R was shown to be involved in the pathogenesis of atopic dermatitis by modulating the function of various immune cells present in the skin, i.e. T cells12 and dendritic cells13, however the expression and function of this receptor on keratinocytes was not identified yet.
Here we investigated the function of the H4R on human and murine keratinocytes with regard to proliferation. Importantly we found higher expression of the H4R on and higher proliferation in response to its stimulation in keratinocytes derived from patients with atopic dermatitis. Accordingly we found that the H4R in murine neonatal keratinocytes is expressed after the mimicry of inflammatory conditions by treatment with lipopolysaccharide (LPS) and peptidoglycane (PGN).
METHODS
Animals
Male and female wildtype and H4R knockout mice of age 20 – 22 weeks were used. All animals were healthy and were housed in groups of six mice per cage at 22 °C with a 12 h light/dark cycle. Water and a standard diet (Altromin, Lage/Lippe, Germany) were available ad libitum. H4R knockout mice were kindly provided by Johnson and Johnson Pharmaceutical Research and Development (New Brunswick, NJ, USA). The H4R knockout mice were generated by Lexicon Genetics (Woodlands, TX, USA), as described previously14 and were cross breed with BALB/c from Charles River (Sulzfeld, Germany) to obtain heterocygote mice for the H4R. These mice were used to obtain homocygote H4R knockout mice and their respective wildtype.
Reagents
Various histamine receptor ligands were used in this study: histamine (agonist for all histamine receptors, Alk-Scherax, Wedel, Germany), 4-methylhistamine (4-MH, H4R agonist), 2-pyridylethylamin (2-Pyr, H1R agonist), amthamine (Amtha, H2R agonist) (all agonists from Tocris Bioscience, Bristol, UK), JNJ777120 (JNJ, H4R antagonist, Tocris), levocetirizine (Levo, H1R antagonist, UCB, Anderlecht/Brüssel, Belgium) and ranitidine (Rani, H2R antagonist, Biomol, Hamburg, Germany).
For stimulation of mouse keratinocytes LPS (0111:B4) and PGN were used (both from Sigma-Aldrich, Munich, Germany).
Keratinocyte isolation and culture
Human primary neonatal keratinocyte (nKC) cultures were prepared from foreskin as described previously.15 The foreskin was cut into pieces and incubated over night at 4 °C in 2.4 U dispase II (Roche, Mannheim, Germany). The next day the epidermis was separated from the dermis and placed for 20 min at 37 °C in EDTA (0.02 %)-trypsin (0.05 %) solution (PAN-Biotech, Aidenbach, Germany). After stopping the trypsin reaction by addition of fetal calf serum (PromoCell, Heidelberg, Germany), the cell suspension was filtered through a sterile gauze (40 μm) and washed two times in PBS. The obtained single cell suspension of nKC was incubated in serum free growth medium, Keratinocyte Growth Medium 2 Kit (PromoCell, Heidelberg, Germany), at 37 °C in a humidified atmosphere containing 5 % CO2. Adult human keratinocytes were isolated from the outer root sheath from plucked hair (orsKC) as described previously.16 Briefly, the hairs were placed in dishes with a feeder layer of 3T3 fibroblasts that had been treated with mitomycin C (Roche, Mannheim, Germany), the medium was changed every 2-3 days and when sufficient orsKC had outgrown, they were selectively trypsinized and passaged further.
For experiments KC in passage 3-6 cultured in hydrocortisone (HC) and epidermal growth factor (EGF) free medium were used.
Murine primary neonatal keratinocyte cultures were prepared according to Caldelari and Müller.17 Skin samples of neonatal wildtype (BALB/c) and histamine H4R knockout mice were collected and incubated overnight in dispase II (5 mg/ml, Sigma-Aldrich, Munich, Germany) at 4 °C. Skins of two to five mice were pooled for one experiment. On the next day the epidermis was peeled off the dermis and incubated in trypsin/EDTA 0.125 %/0.05 % (Biochrom, Berlin, Germany) for 30 minutes at room temperature. The trypsin/EDTA was inactivated with CnT-07 (CELLnTEC, Bern, Switzerland) plus 10 % FCS (PAA, Pasching, Austria) and the epidermis was washed three times in CnT-07 medium. A single cell suspension was obtained by gentle rubbing and pipetting. Keratinocytes were seeded at a density of 1*106 cells in rat-tail collagen coated (Roche, Mannheim, Germany) 25 cm2 flasks (Nunclon, Thermo Fischere Scientific, Braunschweig, Germany) and cultured at 37 °C and 5 % CO2. Cell passages 1-3 were used for experiments.
Transfection of HaCaT keratinocyte cell line
To generate HaCaT cells18 stably expressing H4R we used a retroviral gene transfer and expression System (Clontech, Mountain View, CA, USA) based on retroviral transduction method described in Ory et al.19 In brief: The human H4R was amplified from pcDNA3-HR4 using the following primers: aaaaaaccggtgccaccatgccagatactaatagcacaa (sense primer) and aaaaaggatccttaagaagatactgaccgactg (antisense primer). The amplicon was digested with AgeI and BamHI and cloned into the retroviral pQCXIN transfer vector (Clontech) that allows bicistronic expression of the gene of interest in combination with a neomycin resistance gene. The generated pQCXIN-H4R construct was confirmed by sequencing of the open reading frame and used for transfection of the 293gpg retrovirus packaging cell line. Retrovirus containing supernatants of the transfected 293gpg cells were used to transduce HaCaT cells according to the manufacturer’s protocol (Clontech). H4R expressing, neomycin resistant cells were selected with 800 mg/l G-418 from Calbiochem (Merck4Biosciences, Darmstadt, Germany).
mRNA isolation, reverse transcription and qRT-PCR
Murine keratinocytes were stimulated for 24 h with 50 μg/ml LPS 0111:B4 and 50 μg/ml PGN when they reached confluence. Murine and human keratinocytes were washed in PBS and lysed for RNA isolation using Mini RNA Isolation II Kit (Zymo Research, Orange, USA) and reverse transcription was performed with the First Strand cDNA Synthesis Kit (MBI Fermentas, St. Leon-Rot, Germany). Real-time quantitative PCR was performed on a LightCycler (Roche Molecular Biochemicals, Mannheim, Germany) using SYBR Green with Quantitect primer assays for human glyceraldehyde-3-phosphate dehydrogenase GAPDH (QT01192646), human H1R (QT00199857), human H2R (QT00210378), human H3R (QT00210861) and human H4R (QT00032326) as well as murine GAPDH (QT00199388) and murine H4R (QT00135884) according to the manufacturer’s instructions (Qiagen, Hilden, Germany). The following PCR settings were used: an initial activation step of 15 minutes at 95 °C with ramp 20 °C/second was followed by three-step cycling (45 cycles): denaturation 15 seconds, 94 °C; annealing 20 seconds, 55 °C; extension 20 seconds, 72 °C (all three with ramp 2 °C/second). Melting curve analysis was performed from 60–90 °C with ramp 20 °C/second. The amount of target genes relative to the reference GAPDH was quantified using the Relative Quantification Software (Roche Molecular Biochemicals). To visualize the amplification products after completion of the PCR run, agrose gel electrophoresis was performed with 2 % agarose (Roth, Karlsruhe, Germany) in 1× Tris-Borat-EDTA buffer (Roth).
Cell proliferation assays
Human keratinocytes were seeded in 96-well plates at a density of 1.5*104 cells per well and treated with 10μM histamine or 10μM agonist (2-Pyr, Amtha or 4-MH). For blocking experiments the cells were incubated with 10μM specific antagonist (Levo, Rani or JNJ7777120) 30 min before the addition of the agonists. The proliferation of human keratinocytes was measured at different time points using CellTiter96 non-radioactive proliferation assay (MTT assay, Promega) according to the manufacturer’s recommendations or by thymidine incorporation test. After one day in culture, keratinocytes were pulsed with tritiated thymidine (0.5~Ci/well) for approx. 16 hours. The decay as a measure for the thymidine incorporation during cell division was counted in a liquid scintillation counter (Wallac System1409). The proliferation index was defined by the ratio of mean counts per minute of stimulated to unstimulated cultures.
Murine wildtype and H4R knockout keratinocytes were seeded in collagen coated 96-well plates (Greiner, Frickenhausen, Germany) at a density of 2*104 cells per well and cultured until 70 % confluency. Cells were grown for 12, 24 and 48 h and cell proliferation was measured by BrdU-incorporation (BrdU colorimetric assay, Roche, Mannheim, Germany) according to the manufacturer’s recommendations.
Scratch assay
Scratch assays are regularly used to investigate wound closure mediated by cell migration and proliferation and they have been used before to evaluate the proliferative capacity of keratinocytes.20 Keratinocytes or HaCaT cells were grown in 6-well plates until they reached a confluence of around 90-100 %. A scratch was set in the middle of the well with a standard 1000 μl pipette tip and a photograph was taken. After 24 h the cells were stained with CFSE, photographs were taken and the scratch thickness was evaluated by a group of blinded observers and ranked from 0 (no closure of the scratch) to 6 (complete closure of the scratch).
Evaluation of murine epidermal thickness
The abdominal hair of mice was removed using depilatory cream (Veet, Zurich, CH). Mice were sacrificed 24 h later and the abdominal skin of the mice was separated. Skin specimens were fixed in Bouin’s solution, and paraffin sections (6 μm) were prepared and stained with hematoxylin and eosin. The sections were examined histologically by a blinded investigator. Epidermal thickness (distance from the basal membrane to the stratum corneum) of ten randomly selected areas was measured using Axiovision 4.8 software (Carl Zeiss, Jena, Germany). The stratum corneum itself could not be measured, since it was partially or completely tom off during sectioning.
Statistical analysis
For statistical evaluation of normal distributed data the paired t-test (Figures 1, 2 and 4) and for not normal distributed data the Mann-Whitney test (unpaired, non-parametric, Figures 3A and 5) or Wilcoxon matched pairs signed rank test (paired, non-parametric, Figure 3B-C) was used; a p-value below 0.05 was regarded as significant. p<0.05 is depicted with * and p<0.005 with **. The program GraphPad Prism® version 3.02 (GraphPad Software, Inc, San Diego, USA) was used for statistical analysis.
Figure 1. Histamine induces proliferation in human foreskin keratinocytes.
Representative amplification products and melting peaks of three independent real-time PCR experiments are shown (A, B). Foreskin keratinocytes were treated with different histamine concentrations (C) and stimulated with histamine or H4R agonist (4-MH) for different time points (D). The H4R antagonist JNJ7777120 (JNJ) abolished the H4R agonist-induced effect (E). H1R and H2R agonists and antagonists had no influence on proliferation (F). Mean and SEM of 4-8 experiments are depicted.
Figure 2. Histamine induces proliferation in H4R-transfected HaCaT keratinocytes.
Representative amplification products and melting peaks of five independent real-time PCR experiments are shown (A, B). H4R-transfected HaCaT cells were treated with different histamine concentrations (C). 48 h stimulation with histamine and H4R agonist (4-MH) induced proliferation of H4R-transfected HaCaT keratinocytes as determined by MTT assay (D). The H4R antagonist JNJ7777120 abolished the H4R agonist-induced effect (E), whereas H1R and H2R agonists and antagonists had no influence (F). Mean and SEM of 6- 12 experiments are depicted.
Figure 4. Histamine induces fast scratch-wound healing in high-H4R expressing keratinocytes and H4R-transfected HaCaT cells.
In atopic dermatitis keratinocytes the scratch-wound was better closed after 24 h stimulation with histamine or the H4R agonist (4-MH) as compared to non-treated controls (A, B). In contrast, histamine did not modify wound healing in healthy keratinocytes (B). Histamine induced faster scratch-wound healing in H4R-transfected HaCaT keratinocytes, but not in non- or control-transfected cells (C). Individual values and median of 5-7 experiments are depicted.
Figure 3. Keratinocytes derived from atopic dermatitis express high levels of H4R and respond with proliferation.
Outer root sheath keratinocytes derived from atopic dermatitis showed higher H1R and H4R levels as healthy controls and psoriasis (A). 48 h stimulation with histamine and H4R agonist (4-MH) induced proliferation of atopic dermatitis keratinocytes (B). The H4R antagonist JNJ7777120 (JNJ) abolished the H4R agonist-induced effect in atopic dermatitis keratinocytes (C). Median and quartiles of 6-8 experiments are depicted.
Figure 5. H4R deficient mice show decreased epidermal thickness and keratinocytes derived from H4R deficient mice have lower in vitro proliferative capacity.
Biopsies were taken from abdominal skin of wildtype and H4R-deficient mice and epidermal thickness was measured (A). Neonatal keratinocytes from H4R knockout and wildtype mice were cultured for 12, 24 and 48 h and cell proliferation was determined by BRDU incorporation (B). Mean and SEM of 5 (12 h), 6 (24 h) and 7 (48 h) experiments are shown.
Ethics
The animal experiments have been approved by the LAVES, Oldenburg, Germany (AZ.G33.9-42502-04-10/0252).The investigation of the role of histamine receptors in human allergic skin inflammation was approved by the local ethics committee of the Hannover Medical School (Vote Nr. 4253) and was conducted according to the Declaration of Helsinki Principles.
RESULTS
Neonatal keratinocytes express the H4R and its stimulation induces proliferation
LightCycler real-time PCR experiments showed that human primary neonatal keratinocytes isolated from foreskin express the histamine H4R on mRNA level (see Figure 1A). We also detected expression of H1R mRNA but no H2R or H3R mRNA (see Figure 1B). Stimulation with histamine or the H4R agonist 4-MH induced proliferation of keratinocytes (1.5 to 2-fold increase) as shown with two different cell proliferation assays (MTT and thymidine incorporation). The induction of cell proliferation was most pronounced after 48h of treatment (see Figure 1D) and was induced by histamine at concentrations between 10−4 M and 10−8 M (see Figure 1C). Since 4-MH is known to bind not only H4R, but also H2R21, we performed experiments in the presence of the selective H4R antagonist JNJ7777120 to show that keratinocyte proliferation was induced by selective H4R stimulation (see Figure 1E). To investigate the role of H1R or H2R we incubated the keratinocytes with specific H1R and H2R agonists and antagonists and show no significant involvement of these receptors in induced proliferation (see Figure 1F).
H4R-transfected HaCaT keratinocytes respond to histamine stimulation with proliferation
The keratinocyte cell line HaCaT (spontaneously immortalized keratinocyte cell line (18)) does express low to undetectable levels of H4R mRNA and was therefore stably transfected with a plasmid expressing the H4R or a control vector, respectively. The H4R transfected HaCaT cells showed a marked increase of H4R expression (see Figure 2A). Futhermore HaCaT cells expressed the H1R mRNA but no H2R or H3R mRNA (see Figure 2B). H4R-transfected HaCaT cells responded to histamine treatment with proliferation while non-transfected and control-transfected HaCaT cells did not show induction of proliferation (see Figure 2D). Histamine dose-dependently induced the increase of proliferation at concentrations between 10−4 M and 10−6 M (see Figure 1C). The H4R antagonist JNJ7777120 blocked the 4-MH induced proliferation in H4R-transfected HaCaT cells (see Figure 2E). Incubation of H4R-transfected HaCaT cells with specific H1R and H2R agonists and antagonists showed no influence of these receptors on proliferation (see Figure 2F).
H4R is highly expressed on and triggers proliferation of keratinocytes derived from patients with atopic dermatitis
We investigated the expression level of H4R on keratinocytes derived from the outer root sheath (orsKC) from healthy individuals and patients with atopic dermatitis or psoriasis. The patients with atopic dermatitis showed higher H4R mRNA expression on orsKC as compared to healthy controls; for psoriasis no significant difference was detected (see Figure 3A). Keratinocytes from patients with atopic dermatitis but not from psoriasis also expressed significantly more H1R mRNA compared to healthy donors (see Figure 3A). In the proliferation assay orsKC derived from psoriasis patients showed higher basal proliferation, but their proliferative capacity was not changed by histamine. Atopic dermatitis orsKC responded to stimulation with histamine or a H4R agonist with approximately 1.5 fold higher proliferation as compared to non-stimulated controls (see Figure 3B). The H4R antagonist JNJ7777120 blocked histamine-induced proliferation in orsKC derived from atopic dermatitis (see Figure 3C).
Closure of scratching wounds is accelerated upon histamine stimulation in H4R-expressing keratinocytes
Stimulation of keratinocyte monolayer cultures of cells that express high H4R levels, i.e. H4R-transfected HaCaT cells and orsKC derived from atopic dermatitis patients, with histamine or the H4R agonist 4-MH resulted in faster closure of scratching wounds (see Figure 4A, 4B and 4C). In non- or eGFP-transfected HaCaT cells and orsKC from healthy individuals histamine did not influence the rate of wound closure (see Figure 4B and 4C). The H4R antagonist JNJ7777120 blocked the effect of histamine and 4-MH (see Figure 4A).
H4R knockout mice show reduced epidermal thickness and decreased in vitro proliferation of keratinocytes
Histological analyses revealed that the epidermis of healthy abdominal skin of H4R knockout mice is significantly thinner than the epidermis of wildtype mice. Wildtype epidermis was 21 ± 4.6 μm (mean ± SD) thick, while the epidermis of H4R knockout mice was only 15.9 ± 2 μm (mean ± SD) thick (see Figure 5A). Proliferation of neonatal murine keratinocytes was analysed by a colorimetric BrdU assay after 12, 24 and 48 h of culture. H4R knockout keratinocytes showed a trend towards a reduced basal proliferation compared to wildtype keratinocytes at each time point (see Figure 5B). Stimulation with histamine did not modulate the proliferation of wildtype and H4R knockout keratinocytes (data not shown.)
Murine keratinocytes express H4R under stimulation with LPS and PGN
Expression of the H4R mRNA could not be detected in untreated murine neonatal keratinocytes isolated from healthy wildtype mice. Stimulation of murine keratinocytes with the inflammatory molecules LPS and PGN for 24 h induced the expression of the H4R (see Figure 6). In contrast, in human keratinocytes the stimulation with PGN, PolyIC, LPS or a combination of PGN and LPS did not result in an increased expression of H4R (data not shown).
Figure 6. LPS and PGN induce expression of the H4R in murine neonatal keratinocytes.
Representative amplification products and melting peaks of three independent experiments are shown (A, B). As a control H4R was amplified from wildtype mice spleen and dendritic cell (DCs) mRNA samples, showing the same melting peak as the treated keratinocytes (C).
DISCUSSION
Changes in epidermal proliferation and differentiation are observed in inflammatory skin diseases such as atopic dermatitis and psoriasis and represent an important disease phenotype.22, 23 Jensen et al demonstrated that in lesional skin of atopic dermatitis patients the proliferation is 5-fold increased and even in non-lesional skin keratinocytes show a 2-fold increase of proliferation compared with healthy individuals.24 Accordingly, other studies report an enhanced expression of the proliferation-associated keratins 6 and 16 in skin of atopic dermatitis and psoriasis patients.25 The mechanisms underlying the keratinocyte hyperproliferation are not fully elucidated yet, although several local skin mediators have been shown to be involved. Especially growth factors and cytokines, such as TNF-α, IFN-γ and IL-1 are involved in the growth of keratinocytes.26 The cytokines IL-21 and IL-23 were recently shown to induce keratinocyte proliferation and epidermal hyperplasia associated with psoriasis.27, 28
In the present study we analysed the influence of histamine on keratinocyte proliferation, since this mediator is present at elevated levels in skin of patients with atopic dermatitis and psoriasis.7, 29 Moreover, previous studies showed histamine-induced proliferation of different cell types, among them hepatoma cells through H3R stimulation30, hematopoietic stem cells via H2R stimulation31 and airway smooth muscle cells.32 There is also evidence that histamine influences the proliferation of different cell types in the human skin: histamine inhibits the proliferation of skin fibroblasts through activation of H1R and protein kinase C.33
In the present study we show that histamine can increase the proliferation of human keratinocytes from atopic dermatitis patients via the H4R, which might be relevant in epidermal hyperplasia in atopic dermatitis. We found increased proliferation of neonatal keratinocytes and H4R-transfected HaCaT cells in response to histamine or a H4R agonist. Furthermore, we observed by histological analysis that H4R knockout mice have a thinner epidermis compared to the corresponding wildtype mice. Macroscopically, no skin abnormalities could be detected. The in vitro proliferation potential of keratinocytes derived from H4R deficient mice was lower compared with keratinocytes from wildtype controls, thus correlating with the epidermal phenotypes observed. Surprisingly, H4R expression on murine neonatal keratinocytes was only detectable after stimulation with LPS and PGN, and not on untreated cells. In contrast, we did not observe up-regulation of H4R mRNA in human keratinocytes after stimulation of toll-like receptors. The lack of H4R mRNA expression in normal murine neonatale keratinocytes complicates the interpretation of the differences that we observed in H4R knockout mice with regard to epidermal thickness and basal proliferative capacity. Moreover, in contrast to other studies, we did not observe proliferation of murine keratinocytes in response to histamine. Maurer et al. showed that histamine stimulates the proliferation of keratinocytes in epidermal sheets obtained from 6-8 weeks old C57BL/6 mice.34 Explanations for the differences could be the fact that Maurer et al. used telogen skin of adult mice, which displays the lowest rate of basal keratinocyte proliferation under organ culture conditions in the murine hair cycle and is therefore most sensitive for the detection of even discrete stimulatory effects.34 The proliferative activity of murine neonatal keratinocytes is high at birth35, and murine neonatal keratinocytes might be therefore not sensitive for the detection of stimulatory effects. Beside the cellular activation of the keratinocytes (i.e. anagen versus telogen skin), also the local microenvironment most likely influences the proliferation responses of epidermal cells 36. The influence of proliferation-modulatory extracellular signals like the local cytokine network can not be studied in isolated keratinocyte populations. This might explain the differences in findings by Maurer et al. (1997) as well as our ex vivo data (i.e. decreased thickness of epidermis in H4R knockout mice) and the fact that histamine stimulation did not modulate the proliferation of neonatal keratinocytes in vitro. Moreover, in the experimental protocol used in Maurer et al inflammatory conditions upregulating H4R expression might have been induced, for example as reaction to the hair removal. However, why H4R knockout keratinocytes showed a lower basal proliferation in the absence of any external stimulus compared to wildtype keratinocytes still needs to be investigated. Autocrine secretion of factors that modulate keratinocyte proliferations like TGF-α and GM-CSF might be decreased in H4R knockout keratinocytes.5, 6 In another study, Lin et al showed that also other histamine receptors are involved in murine keratinocyte proliferation; they observed that H1R and H2R antihistamines stimulate in vivo murine epidermal proliferation in adult albino hairless (Skh1) mice.37 This even further complicates the area, since both histamine as well as antihistamines can modulate epidermal proliferation, probably depending on the experimental system. From our studies we have the impression that the H4R knockout mouse does not represent a good model for further in vivo investigation of the findings from human keratinocytes and it is unclear if the H4R represents a functional receptor on murine KC.
An important observation that we made in in vitro experiments using human keratinocytes is that H4R stimulation induced proliferation in keratinocytes derived from atopic dermatitis patients, but not in cells from psoriasis patients or donors without skin disease. The reason for this difference in the response to histamine might be explained by the observation that keratinocytes from atopic dermatitis express higher levels of H4R, while the receptor is relatively low expressed on healthy control and psoriasis keratinocytes. A study describing differences in H4R expression in Chinese atopic dermatitis patients compared to healthy controls due to polymorphisms in the HRH4 gene38 provides a hint that regulation on the genetic level might be involved. However, the reason for the higher expression of the H4R on atopic dermatitis keratinocytes still needs to be elucidated and will be subject to future studies.
It was noted already previously, that the epidermal hyperplasia in atopic dermatitis and psoriasis might be triggered by different mechanisms. For example, IL-21 and IL-23 were shown to induce epidermal hyperplasia only in psoriasis.26, 27 Similarly, the inducer of keratinocyte proliferation PPAR-δ is upregulated in lesional psoriasis skin, but not in atopic dermatitis.39 Here we identified histamine as an inducer of orsKC proliferation selectively in atopic dermatitis, but not in psoriasis.
Interestingly, we found a difference in the response to histamine depending on the keratinocyte source. In contrast to healthy nKC, healthy orsKC derived from the hair root did not show increased proliferation upon stimulation with histamine. Since both cell types express the H4R, the variation should be in the response to histamine stimulation or in the proliferative capacity of the keratinocytes themselves. However, at the moment we can only speculate on an explanation for the difference in histamine response of nKC and orsKC, both of healthy origin.
Keratinocyte proliferation can be induced in a paracrine or autocrine manner by various mediators. For example fibroblast growth factor 7 (FGF-7) and insulin-like growth factor I (IGF-I) secreted by fibroblasts and melanocytes act as paracrine proliferation inducers.33, 40 On the other hand, TGF-α and GM-CSF are synthesized by keratinocytes themselves and promote their proliferation in an autocrine manner.5, 6 Since histamine is mainly secreted by mast cells, it regulates keratinocyte proliferation in a paracrine manner, if we assume that histamine directly affects keratinocyte proliferation. It can however not be excluded that it is an indirect effect via the upregulation of other mediators, such as GM-CSF, which is known to be upregulated in keratinocytes upon histamine stimulation41 and is by itself an inducer of keratinocyte proliferation.6 Therefore, further studies are required to investigate the level of endogenous histamine and other factors (like GM-CSF, TGF-α and endothelin) produced in human and murine keratinocytes.
Recent studies have investigated the effect of histamine on keratinocyte differentiation, a process closely linked to keratinocyte proliferation. In a murine model it was shown that H1R and H2R antihistamines enhance epidermal differentiation as well as epidermal proliferation; the involvement of the H4R was not investigated, since it was not detected in mouse keratinocytes. 37 In human in vitro keratinocyte cultures and skin equivalents it was described that histamine reduces keratinocyte differentiation dependent on H1R stimulation, while experiments with histamine receptor agonists and antagonists showed no effect of H4R on keratinocyte differentiation.42 This study together with our results indicates that histamine mediates keratinocyte growth by two different receptors: proliferation via the H4R and differentiation via the H1R. However, it might still be worth to investigate the differentiation capacity of keratinocytes derived from atopic dermatitis patients in response to histamine and H4R stimulation, since the previous data on differentiation was obtained from healthy keratinocytes.42
Summarizing, we demonstrate that the H4R is expressed on human keratinocytes. Interestingly the receptor expression is significantly increased in atopic dermatituis patients compared with healthy individuals or patients with psoriasis. Stimulation of the H4R resulted in induction of proliferation of human keratinocytes. The hyperproliferation of keratinocytes in response to histamine in patients with atopic dermatitis might play an important pathophysiological role and based on our results H4R antagonists could represent a new strategy for the therapy of atopic dermatitis.
Key Messages.
“The H4R is highly expressed on human keratinocytes isolated from atopic dermatitis patients and on murine keratinocytes cultured under inflammatory conditions.”
“Stimulation of the H4R induces proliferation of human keratinocytes isolated from atopic dermatitis patients.”
“H4R stimulation might play a role for epidermal acanthosis observed in chronic eczema”
“H4R-knockout mice have thinner abdominal epidermis compared with wildtype mice.”
ACKNOWLEDGEMENTS
We thank Robin Thurmond (Johnson & Johnson, La Jolla, CA, USA) for giving us the opportunity to work with the H4R-deficient mouse and for critical revision of the manuscript.
Declaration of all sources funding: This study was supported by grants from the DFG (Deutsche Forschungsgemeinschaft): Gu434/5-2 and BA 2071/2-2, from the Austrian Science Fund (FWF): T545-B19 and from the European Community COST Action BM0806 (Recent Advances in histamine H4 receptor research).
Abbreviations
- 2-Pyr
2-pyridylethylamine
- 4-MH
4-methylhistamine
- Amtha
amthamine
- CCL
chemokine (C-C motif) ligand
- CFSE
carboxyfluorescein succinimidyl ester
- DC
dendritic cell
- EDTA
ethylenediaminetetraacetic acid
- EGF
epidermal growth factor
- eGFP
enhanced green fluorescent protein
- FGF
fibroblast growth factor
- GAPDH
glyceraldehyde 3-phosphate dehydrogenase
- GM-CSF
granulocyte macrophage colony-stimulating factor
- Hist
histamine
- HC
hydrocortisone
- HxR
histamine receptor x
- ICAM
intercellular adhesion molecule
- IFN
Interferon
- IL
interleukin
- Levo
levocetirizine
- LPS
lipopolysaccharide
- MHC-II
major histocompatibility complex
- nKC
neonatale keratinocyte
- orsKC
outer root sheat keratinocyte
- PBMC
peripheral blood mononuclear cells
- PGN
peptidoglycane
- PPAR-δ
peroxisome proliferator-activated receptor
- Rani
ranitidine
- SD
standard deviation
- TGF
transforming growth factor
- TNF
tumor necrosis factor
Footnotes
Conflict of Interest
The authors declare no conflict of interest.
REFERENCES
- 1.Leung DY, Boguniewicz M, Howell MD, Nomura I, Hamid QA. New insights into atopic dermatitis. The Journal of clinical investigation. 2004;113:651–7. doi: 10.1172/JCI21060. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Werfel T. The role of leukocytes, keratinocytes, and allergen-specific IgE in the development of atopic dermatitis. The Journal of investigative dermatology. 2009;129:1878–91. doi: 10.1038/jid.2009.71. [DOI] [PubMed] [Google Scholar]
- 3.Carmi-Levy I, Homey B, Soumelis V. A modular view of cytokine networks in atopic dermatitis. Clinical reviews in allergy & immunology. 2011;41:245–53. doi: 10.1007/s12016-010-8239-6. [DOI] [PubMed] [Google Scholar]
- 4.Giustizieri ML, Albanesi C, Fluhr J, Gisondi P, Norgauer J, Girolomoni G. H1 histamine receptor mediates inflammatory responses in human keratinocytes. The Journal of allergy and clinical immunology. 2004;114:1176–82. doi: 10.1016/j.jaci.2004.07.054. [DOI] [PubMed] [Google Scholar]
- 5.Coffey RJ, Jr., Bascom CC, Sipes NJ, Graves-Deal R, Weissman BE, Moses HL. Selective inhibition of growth-related gene expression in murine keratinocytes by transforming growth factor beta. Molecular and cellular biology. 1988;8:3088–93. doi: 10.1128/mcb.8.8.3088-3093.1988. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Braunstein S, Kaplan G, Gottlieb AB, Schwartz M, Walsh G, Abalos RM, et al. GM-CSF activates regenerative epidermal growth and stimulates keratinocyte proliferation in human skin in vivo. The Journal of investigative dermatology. 1994;103:601–4. doi: 10.1111/1523-1747.ep12396936. [DOI] [PubMed] [Google Scholar]
- 7.Gutzmer R, Gschwandtner M, Rossbach K, Mommert S, Werfel T, Kietzmann M, et al. Pathogenetic and therapeutic implications of the histamine H4 receptor in inflammatory skin diseases and pruritus. Frontiers in bioscience. 2011;3:985–94. doi: 10.2741/203. [DOI] [PubMed] [Google Scholar]
- 8.Buddenkotte J, Maurer M, Steinhoff M. Histamine and Antihistamines in Atopic Dermatitis. Advances in experimental medicine and biology. 2010;709:73–80. doi: 10.1007/978-1-4419-8056-4_8. [DOI] [PubMed] [Google Scholar]
- 9.Kohda F, Koga T, Uchi H, Urabe K, Furue M. Histamine-induced IL-6 and IL-8 production are differentially modulated by IFN-gamma and IL-4 in human keratinocytes. Journal of dermatological science. 2002;28:34–41. doi: 10.1016/s0923-1811(01)00147-5. [DOI] [PubMed] [Google Scholar]
- 10.Nakamura T, Itadani H, Hidaka Y, Ohta M, Tanaka K. Molecular cloning and characterization of a new human histamine receptor, HH4R. Biochem Biophys Res Commun. 2000;279:615–20. doi: 10.1006/bbrc.2000.4008. [DOI] [PubMed] [Google Scholar]
- 11.Oda T, Morikawa N, Saito Y, Masuho Y, Matsumoto S. Molecular cloning and characterization of a novel type of histamine receptor preferentially expressed in leukocytes. The Journal of biological chemistry. 2000;275:36781–6. doi: 10.1074/jbc.M006480200. [DOI] [PubMed] [Google Scholar]
- 12.Gutzmer R, Mommert S, Gschwandtner M, Zwingmann K, Stark H, Werfel T. The histamine H4 receptor is functionally expressed on T(H)2 cells. The Journal of allergy and clinical immunology. 2009;123:619–25. doi: 10.1016/j.jaci.2008.12.1110. [DOI] [PubMed] [Google Scholar]
- 13.Dijkstra D, Stark H, Chazot PL, Shenton FC, Leurs R, Werfel T, et al. Human inflammatory dendritic epidermal cells express a functional histamine H4 receptor. The Journal of investigative dermatology. 2008;128:1696–703. doi: 10.1038/sj.jid.5701250. [DOI] [PubMed] [Google Scholar]
- 14.Hofstra CL, Desai PJ, Thurmond RL, Fung-Leung WP. Histamine H4 receptor mediates chemotaxis and calcium mobilization of mast cells. The Journal of pharmacology and experimental therapeutics. 2003;305:1212–21. doi: 10.1124/jpet.102.046581. [DOI] [PubMed] [Google Scholar]
- 15.Wittmann M, Purwar R, Hartmann C, Gutzmer R, Werfel T. Human keratinocytes respond to interleukin-18: implication for the course of chronic inflammatory skin diseases. The Journal of investigative dermatology. 2005;124:1225–33. doi: 10.1111/j.0022-202X.2005.23715.x. [DOI] [PubMed] [Google Scholar]
- 16.Wang D, Drenker M, Eiz-Vesper B, Werfel T, Wittmann M. Evidence for a pathogenetic role of interleukin-18 in cutaneous lupus erythematosus. Arthritis and rheumatism. 2008;58:3205–15. doi: 10.1002/art.23868. [DOI] [PubMed] [Google Scholar]
- 17.Caldelari R, Muller EJ. Short- and long-term cultivation of embryonic and neonatal murine keratinocytes. Methods in molecular biology. 2010;633:125–38. doi: 10.1007/978-1-59745-019-5_10. [DOI] [PubMed] [Google Scholar]
- 18.Boukamp P, Petrussevska RT, Breitkreutz D, Hornung J, Markham A, Fusenig NE. Normal keratinization in a spontaneously immortalized aneuploid human keratinocyte cell line. The Journal of cell biology. 1988;106:761–71. doi: 10.1083/jcb.106.3.761. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Ory DS, Neugeboren BA, Mulligan RC. A stable human-derived packaging cell line for production of high titer retrovirus/vesicular stomatitis virus G pseudotypes. Proceedings of the National Academy of Sciences of the United States of America. 1996;93:11400–6. doi: 10.1073/pnas.93.21.11400. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Bertero T, Gastaldi C, Bourget-Ponzio I, Imbert V, Loubat A, Selva E, et al. miR-483-3p controls proliferation in wounded epithelial cells. FASEB journal: official publication of the Federation of American Societies for Experimental Biology. 2011;25:3092–105. doi: 10.1096/fj.10-168401. [DOI] [PubMed] [Google Scholar]
- 21.Lim HD, van Rijn RM, Ling P, Bakker RA, Thurmond RL, Leurs R. Evaluation of histamine H1-, H2-, and H3-receptor ligands at the human histamine H4 receptor: identification of 4-methylhistamine as the first potent and selective H4 receptor agonist. The Journal of pharmacology and experimental therapeutics. 2005;314:1310–21. doi: 10.1124/jpet.105.087965. [DOI] [PubMed] [Google Scholar]
- 22.Hoffjan S, Stemmler S. On the role of the epidermal differentiation complex in ichthyosis vulgaris, atopic dermatitis and psoriasis. The British journal of dermatology. 2007;157:441–9. doi: 10.1111/j.1365-2133.2007.07999.x. [DOI] [PubMed] [Google Scholar]
- 23.Fuchs E, Raghavan S. Getting under the skin of epidermal morphogenesis. Nature reviews. Genetics. 2002;3:199–209. doi: 10.1038/nrg758. [DOI] [PubMed] [Google Scholar]
- 24.Jensen JM, Folster-Holst R, Baranowsky A, Schunck M, Winoto-Morbach S, Neumann C, et al. Impaired sphingomyelinase activity and epidermal differentiation in atopic dermatitis. The Journal of investigative dermatology. 2004;122:1423–31. doi: 10.1111/j.0022-202X.2004.22621.x. [DOI] [PubMed] [Google Scholar]
- 25.Guttman-Yassky E, Suarez-Farinas M, Chiricozzi A, Nograles KE, Shemer A, Fuentes-Duculan J, et al. Broad defects in epidermal cornification in atopic dermatitis identified through genomic analysis. The Journal of allergy and clinical immunology. 2009;124:1235–44. e58. doi: 10.1016/j.jaci.2009.09.031. [DOI] [PubMed] [Google Scholar]
- 26.Barrientos S, Stojadinovic O, Golinko MS, Brem H, Tomic-Canic M. Growth factors and cytokines in wound healing. Wound repair and regeneration: official publication of the Wound Healing Society [and] the European Tissue Repair Society. 2008;16:585–601. doi: 10.1111/j.1524-475X.2008.00410.x. [DOI] [PubMed] [Google Scholar]
- 27.Chan JR, Blumenschein W, Murphy E, Diveu C, Wiekowski M, Abbondanzo S, et al. IL-23 stimulates epidermal hyperplasia via TNF and IL-20R2-dependent mechanisms with implications for psoriasis pathogenesis. The Journal of experimental medicine. 2006;203:2577–87. doi: 10.1084/jem.20060244. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Caruso R, Botti E, Sarra M, Esposito M, Stolfi C, Diluvio L, et al. Involvement of interleukin-21 in the epidermal hyperplasia of psoriasis. Nature medicine. 2009;15:1013–5. doi: 10.1038/nm.1995. [DOI] [PubMed] [Google Scholar]
- 29.Krogstad AL, Lonnroth P, Larson G, Wallin BG. Increased interstitial histamine concentration in the psoriatic plaque. The Journal of investigative dermatology. 1997;109:632–5. doi: 10.1111/1523-1747.ep12337620. [DOI] [PubMed] [Google Scholar]
- 30.Davenas E, Rouleau A, Morisset S, Arrang JM. Autoregulation of McA-RH7777 hepatoma cell proliferation by histamine H3 receptors. The Journal of pharmacology and experimental therapeutics. 2008;326:406–13. doi: 10.1124/jpet.107.135368. [DOI] [PubMed] [Google Scholar]
- 31.Schneider E, Bertron AF, Dy M. Modulation of hematopoiesis through histamine receptor signaling. Frontiers in bioscience. 2011;3:467–73. doi: 10.2741/s165. [DOI] [PubMed] [Google Scholar]
- 32.Panettieri RA, Yadvish PA, Kelly AM, Rubinstein NA, Kotlikoff MI. Histamine stimulates proliferation of airway smooth muscle and induces c-fos expression. The American journal of physiology. 1990;259:L365–71. doi: 10.1152/ajplung.1990.259.6.L365. [DOI] [PubMed] [Google Scholar]
- 33.Johnson CL, Johnson CG. Inhibition of human skin fibroblast proliferation by histamine and phorbol esters is mediated by protein kinase C. Cellular signalling. 1990;2:105–13. doi: 10.1016/0898-6568(90)90014-2. [DOI] [PubMed] [Google Scholar]
- 34.Maurer M, Opitz M, Henz BM, Paus R. The mast cell products histamine and serotonin stimulate and TNF-alpha inhibits the proliferation of murine epidermal keratinocytes in situ. Journal of dermatological science. 1997;16:79–84. doi: 10.1016/s0923-1811(97)00043-1. [DOI] [PubMed] [Google Scholar]
- 35.Furstenberger G, Schweizer J, Marks F. Development of phorbol ester responsiveness in neonatal mouse epidermis: correlation between hyperplastic response and sensitivity to first-stage tumor promotion. Carcinogenesis. 1985;6:289–94. doi: 10.1093/carcin/6.2.289. [DOI] [PubMed] [Google Scholar]
- 36.Maurer M, Opitz M, Henz BM, Paus R. The mast cell products histamine and serotonin stimulate and TNF-alpha inhibits the proliferation of murine epidermal keratinocytes in situ. J Dermatol Sci. 1997;16:79–84. doi: 10.1016/s0923-1811(97)00043-1. [DOI] [PubMed] [Google Scholar]
- 37.Lin TK, Man MQ, Santiago JL, Park K, Roelandt T, Oda Y, et al. Topical antihistamines display potent anti-inflammatory activity linked in part to enhanced permeability barrier function. The Journal of investigative dermatology. 2013;133:469–78. doi: 10.1038/jid.2012.335. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Yu B, Shao Y, Zhang J, Dong XL, Liu WL, Yang H, et al. Polymorphisms in human histamine receptor H4 gene are associated with atopic dermatitis. The British journal of dermatology. 2010;162:1038–43. doi: 10.1111/j.1365-2133.2010.09675.x. [DOI] [PubMed] [Google Scholar]
- 39.Romanowska M, al Yacoub N, Seidel H, Donandt S, Gerken H, Phillip S, et al. PPARdelta enhances keratinocyte proliferation in psoriasis and induces heparin-binding EGF-like growth factor. The Journal of investigative dermatology. 2008;128:110–24. doi: 10.1038/sj.jid.5700943. [DOI] [PubMed] [Google Scholar]
- 40.Ikawa Y, Shiba K, Ohki E, Mutoh N, Suzuki M, Sato H, et al. Comparative study of histamine H4 receptor expression in human dermal fibroblasts. The Journal of toxicological sciences. 2008;33:503–8. doi: 10.2131/jts.33.503. [DOI] [PubMed] [Google Scholar]
- 41.Kanda N, Watanabe S. Histamine enhances the production of granulocyte-macrophage colony-stimulating factor via protein kinase Calpha and extracellular signal-regulated kinase in human keratinocytes. The Journal of investigative dermatology. 2004;122:863–72. doi: 10.1111/j.0022-202X.2004.22432.x. [DOI] [PubMed] [Google Scholar]
- 42.Gschwandtner M, Mildner M, Mlitz V, Gruber F, Eckhart L, Werfel T, et al. Histamine suppresses epidermal keratinocyte differentiation and impairs skin barrier function in a human skin model. Allergy. 2013;68:37–47. doi: 10.1111/all.12051. [DOI] [PMC free article] [PubMed] [Google Scholar]






