Abstract
The functions of 1, 25-dihydroxyvitamin D (1, 25-(OH)2D3) in regulating adipogenesis, adipocyte differentiation and key adipogenic gene expression were studied in 3T3-L1 preadipocytes. Five concentrations (0.01, 0.1, 1, 10, 100nM) of 1, 25-(OH)2D3 were studied and lipid accumulation measured by Oil Red O staining and expression of adipogenic genes quantified using quantitative real-time PCR. Adipogenic responses to 1, 25-(OH)2D3 were determined on 6, and 12 h, and days 1-10 after induction of adipogenesis by a hormonal cocktail with or without 1, 25-(OH)2D3. In response to 1, 25-(OH)2D3 (1, 10, and 100 nM), lipid accumulation and the expression of PPARγ, C/EBPα, FABP4 and SCD-1 were inhibited through day 10, and vitamin D receptor expression was inhibited in the early time points. The greatest inhibitory effect was upon expression of FABP4. Expression of SREBP-1c was only affected on day 2. The lowest concentrations of 1, 25-(OH)2D3 tested did not affect adipocyte differentiation or adipogenic gene expression. The C/EBPα promoter activity response to 1, 25-(OH)2D3 was also tested, with no effect detected. These results indicate that 1, 25-(OH)2D3 inhibited adipogenesis via suppressing adipogenic-specific genes, and is invoked either during PPARγ activation or immediately up-stream thereof. Gene expression down-stream of PPARγ especially FABP4 was strongly inhibited, and we suggest that the role of 1, 25-(OH)2D3 in regulating adipogenesis will be informed by further studies of adipogenic-specific gene promoter activity.
Introduction
Growth of adipose tissue mass involves two distinct processes: hypertrophy (because of lipid synthesis and the subsequent increase in the size of adipocytes) and hyperplasia (because of proliferation, when preadipocyte and adipocyte numbers increase) [1]. Adipogenesis is the process of preadipocyte differentiation to form mature adipocytes, and during this process lipid accumulation occurs. The transcriptional control of adipocyte differentiation requires a sequential series of gene expression events and activation of a number of key signaling pathways [2]. This cascade starts with the induction of CCAAT/enhancer—binding protein β and δ (C/EBPβ and C/EBPδ). These two proteins then induce the expression of nuclear receptor peroxisome proliferator—activated receptor γ (PPARγ), which in turn induces C/EBPα expression [3]. Once expressed, C/EBPα activity positively feeds back on PPARγ activity. These two factors enhance each other’s expression and maintain the differentiated state [4]. Sterol-regulatory element binding protein 1c (SREBP-1c) is another notable key adipogenic gene [5]. SREBP-1c was independently discovered by two different research groups, and was named as ADD1 and SREBP-1c [6] [7]. This gene is induced during adipogenesis and is further regulated by insulin in cultured adipocytes [8,9]. In addition, SREBP-1c can modulate a variety of genes linked to fatty acid and triglyceride metabolism, and can also regulate adipogenesis [3] via induction of PPARγ gene expression through E box motifs present in the PPARγ promoter [10]. Increased expression of SREBP-1c leads to activation of PPARγ by inducing its expression and by increasing the production of an endogenous PPARγ ligand. All these transcriptional factors are necessary for the terminally differentiated phenotype.
Moreover, in humans, obesity is characterized by an increase in lipid accumulation and is the leading risk-factor for the development of Type 2 diabetes[11]. Understanding the biological process of adipogenesis is important for the development of novel targets for obesity therapy. Increasing evidence suggests there is a potential link between obesity and vitamin D insufficiency[12]. The bioactive metabolite of vitamin D is 1, 25 - (OH)2D3, which acts as a steroid hormone and a high-affinity ligand for the vitamin D receptor (VDR). The 1, 25 - (OH)2D3 activated VDR can form a heterodimer with the retinoid X receptor (RXR), which can bind to vitamin D response elements in various genes[13]. This VDR-RXR heterodimer may be competitive, inhibiting [14] the expression of PPARγ, which is a key regulator of adipogenesis, and thus also inhibit adipocyte maturation[13]. Therefore, 1, 25 - (OH)2D3 and VDR may play important roles in regulating adipogenesis. The vitamin D receptor is expressed very early in adipogenesis in 3T3-L1 cells. The VDR expression levels reach a maximum during the first 6 h after induction of differentiation, then decline to background levels after 2 days[15]. This creates a short window of opportunity for 1, 25 - (OH)2D3 to influence the differentiation process in forming mature adipocytes. Previous work has indicated that 1, 25 - (OH)2D3 is an inhibitor of adipogenesis in the 3T3-L1 cells[16,17]. In 1998, work performed by Kelly and Gimble [18] has established that 1, 25 - (OH)2D3 inhibits adipocyte differentiation in murine bone marrow cells. However, the specific mechanisms of the inhibitory actions of 1, 25 - (OH)2D3 in adipogenesis have not been described.
In the present study, we have determined the inhibitory effect of different concentrations of 1, 25 - (OH)2D3 in 3T3-L1 preadipocyte differentiation. We also studied the inhibitory activity of different concentrations of 1, 25 - (OH)2D3 on expression levels of key adipogenic genes (C/EBPs and PPARγ). As an important transcriptional factor during adipocyte differentiation, C/EBPα was a focus of the present study. We sought to determine whether there is a relationship between the inhibitory effect of 1, 25 - (OH)2D3 and the promoter activity of C/EBPα. Our study provides an experimental basis to better understand the function of 1, 25 - (OH)2D3 in regulation of adipogenesis, and the interactions between 1, 25 - (OH)2D3 and key adipogenic genes.
Materials and Methods
Materials
Mouse embryonic fibroblast cells (3T3-L1) were obtained from the American Type Culture Collection (ATCC). Dulbecco’s Modified Eagle’s Medium (DMEM), fetal bovine serum (FBS) and penicillin/streptomycin were from Gibco, Life Technologies (Grand Island, NY). Trizol, DNase I kit, high capacity cDNA reverse transcription kit (Cat # 4368814), and Taqman Master Mix were obtained from Life Technologies (Grand Island, NY). The Dual Reporter Luciferase Assay System was purchased from Promega Corporation, (Madison, WI). Oil Red O (ORO) powder, dexamethasone (D8893), insulin from bovine pancreas (I6634), 3-isobutyl-1-methylxanthine (IBMX) (I7018), and 1α,25-Dihydroxyvitamin D3 (D1530) were purchased from Sigma-Aldrich (St. Louis, MO). Mouse-specific anti-PPARγ (sc-7196) rabbit polyclonal antibody was purchased from Santa Cruz Biotechnology (Dallas, Texas). Mouse-specific anti-C/EBPα (ab139731) rabbit polyclonal antibody, and anti-β-actin mouse-monoclonal (ab8226) were purchased from Abcam (Cambridge, MA). AlexaFluor 680 anti-rabbit IgG was from life Technologies (Grand Island, NY) and IRDye800 anti-mouse IgG was from Li-Cor (Lincoln, NE).
Cell culture
Mouse 3T3-L1 preadipocytes were cultured at 37°C with 5% CO2 enriched air in DMEM with 10% FBS, 100 I.U. /ml penicillin, 100 μg/ml streptomycin (basal growth medium). Cells were seeded in 6-well plates and 24-well plates with glass cover slips in basal growth medium and cultured until confluent. On day 0 (two days post confluence), 1, 25-dihydroxyvitamin D was added to the differentiation medium at the following final concentrations: 100, 10, 1, 0.1, and 0.01 nM, and cultures were incubated for 48 h. Cells grown in basal growth medium without 1, 25-dihydroxyvitamin D served, as a negative control. Cells grown in medium containing basal growth medium with dexamethasone (1 μM), IBMX (500 μM) and insulin (1.7 mM) (standard hormonal differentiation medium, DM) served, as a positive control. For the DMI treatment, insulin, dexamethasone and IBMX were provided for the first 48 h followed by only insulin in basal growth medium throughout the remaining time points. Media were changed every 2 days for all treatments. Cells were harvested on 0, 6, and 12 h, and days 1, 2, 4, 6, 8 and 10 for RNA extraction, or protein extraction. Parallel cultures were stained with ORO and representative images of ORO stained cells on day 10 were quantified using MetaMorph Image analysis software (Nashville, TN).
Cells and transfection
For each cell culture well, 3.5×105 3T3-L1 cells were plated and allowed to reach 80% confluence. Cells were then co-transfected with 2 μg [pGL4.10 (luc2/-500 C/EBPα)] and 0.2 μg of internal transfection control vector [pGL4.74 (hRluc/TK)], and transferred to growth medium. Cells were incubated 24 h, and allowed to reach 100% confluence. Two days post confluence cells (0 h) were treated with 100 nM of 1, 25(OH)2D3 plus differentiation medium, differentiation medium only, or growth medium only. Cells were harvested on 0, 12, 24, and 24 h, and assayed for firefly luciferase and renilla luciferase activities using the Dual Reporter Luciferase Assay System (Promega, Madison, WI) and a Wallac 1420 Multi Label Counter. Firefly luciferase activity units were normalized to units of renilla luciferase activity to correct for transfection efficiency.
Oil Red O (ORO) and Hematoxylin staining
Accumulation of lipids was observed using ORO staining[19]. Oil Red O in isopropanol stock solution (3.5 mg/ml) was prepared, stirred overnight and filtered. Cells grown on cover slips in 24-well plates were used for lipid staining. On the day of the time point, culture medium was removed and cells were gently rinsed once with phosphate buffer saline (PBS). Cells were fixed in 10% formaldehyde in PBS for 1 hr at RT. After fixation, cells were rinsed with PBS and then 60% isopropanol. Oil Red O solution (6:4 v/v of stock solution and water) was added and incubated for 10 min at RT. Finally, cells were washed with distilled water, three times. Hematoxylin counter staining was done according to the manufacturer’s instructions. Briefly, cells were incubated with filtered hematoxylin for two minutes and rinsed twice with tap water. Differentiation solution (0.25% HCl in 70% alcohol) was added and cells were rinsed again with tap water. The glass cover slips were then removed from the wells and inverted on to a glass slide with mounting medium (Vecta Shield, Vector Labs, Burlingame, CA).
RNA extraction and cDNA synthesis
Total RNA was extracted using Trizol according to the manufacturer’s instructions. The RNA pellet was resuspended in nuclease-free water and stored at -80°C until further use. RNA was quantified using a Nanodrop ND-1000 UV-Vis Spectrophotometer (Nanodrop Technologies, Wilmington, DE). The quality of RNA was verified on 1% agarose gels. Two μg of RNA from each treatment was DNase treated. Synthesis of cDNA was conducted using a high capacity cDNA reverse transcription kit and random hexamers as primers according to the manufacturer’s instructions. To ensure availability of cDNA sufficient to perform all real-time PCR reactions, cDNA synthesized from 2 μg of RNA was pooled for each sample. Pooled cDNA was diluted 1:10 using nuclease-free water for real-time PCR.
Real-time PCR
Quantitative real-time PCR was performed using Taqman MGB primer/probe sets with an ABI 7500 Fast Real Time PCR system (Applied Biosystems, Foster City, CA). Primers and probes for all genes were designed using Applied Biosystems Primer Express 3.0 software. Primers (Integrated DNA Technologies, Coralville, IA) and probes (Life Technologies, Grand Island, NY) were designed to have a Tm of 58–60°C and 69–70°C, respectively. Primer-probe sets that span exon-junctions (trans-intronic positions) were chosen for real-time PCR, to prevent binding to genomic DNA (Table 1). Eukaryotic translation elongation factor 2 (EEF2) was used as an endogenous control for gene expression. Probes were labeled with 6-FAM or VIC for all target genes or control (EEF2), respectively. Real-time PCR assays for each sample were conducted in duplicate wells with all genes including endogenous control on the same plate. Reactions contained Taqman Universal Fast PCR Master Mix, No AmpErase UNG (Applied Biosystems, Foster City, CA) (1X), forward primer (0.5 μM), reverse primer (0.5 μM), Taqman probe (0.125 μM) and cDNA template made up to a final volume of 15 μl in nuclease-free water. Real-time PCR cycle conditions included a holding time of 90°C for 20 sec, followed by 40 cycles of 90°C for 3 sec and 60°C for 30 sec of melting and extension temperatures, respectively.
Table 1. Primer-probe sets for real-time PCR.
Accession No. / Gene name | Sequences |
---|---|
NM_007907.1 / Eukaryotic translation elongation factor 2 (Eef2) | FP: CTGCCTGTCAATGAGTCCTTTG |
RP: GCCGCCGGTGTTGGAT | |
Probe: CTTCACCGCTGATCTG | |
NM_011146.2 / Peroxisome proliferator activated receptor gamma (PPARγ) | FP: GCTTCCACTATGGAGTTCATGCT |
RP: AATCGGATGGTTCTTCGGAAA | |
Probe: TGAAGGATGCAAGGGTT | |
NM_007678.3 / CCAAT/enhancer binding protein alpha (C/EBPα) | FP: CGCAAGAGCCGAGATAAAGC |
RP: GTCAACTCCAGCACCTTCTGTTG | |
Probe: AACGCAACGTGGAGAC | |
NM_009504.4 Vitamin D receptor (VDR) | FP: GGCTTCCACTTCAACGCTATG |
RP: TGCTCCGCCTGAAGAAACC | |
Probe: CCTGTGAAGGCTGCAA | |
NM_009883.3 / CCAAT/enhancer binding protein beta (C/EBPβ) | FP: GCGCACCGGGTTTCG |
RP: GCGCTCAGCCACGTTTG | |
Probe: ACTTGATGCAATCCGGA | |
NM_007679.4 / CCAAT/enhancer binding protein delta (C/EBPδ) | FP: CTGTGCCACGACGAACTCTTC |
RP: GCCGGCCGCTTTGTG | |
Probe: CGACCTCTTCAACAGC | |
NM_024406.1 / Fatty acid binding protein 4 (FABP4) | FP: CCGCAGACGACAGGAAGGT |
RP: AGGGCCCCGCCATCT | |
Probe: AAGAGCATCATAACCC | |
NM_010052.3 / Preadipocyte factor-1 (Pref-1) | FP: AATAGACGTTCGGGCTTGCA |
RP: GGTCCACGCAAGTTCCATTG | |
Probe: CTCAACCCCCTGCGC | |
NM_011480.3 / Sterol regulatory element binding transcription factor 1 (Srebf1) | FP: GCGGTTGGCACAGAGCTT |
RP: CTGTGGCCTCATGTAGGAATACC | |
Probe: CGGCCTGCTATGAGG | |
NM_009127.4 / Stearoyl-Coenzyme A desaturase 1 (Scd1) | FP: CAACACCATGGCGTTCCA |
RP: TGGGCGCGGTGATCTC | |
Probe: AATGACGTGTACGAATGG |
Primers and probe sequences used in real-time PCR listed 5’ to 3’: Forward primer (FP), reverse primer (RP) and Taqman probes for the following genes were designed from the corresponding GenBank accession numbers.
Data were analyzed using the relative CT (∆∆Ct) method[20]. Average Ct values of endogenous control (EEF2) were subtracted from target gene average Ct values of each gene, to obtain ∆Ct values of each gene for each sample. For each gene, ∆Ct values in the control treatment at each time point were used to normalize ∆Ct values of corresponding time points of each treatment to obtain ∆∆Ct and mRNA fold expression values [2(-∆∆Ct)].
Western Blot
Protein extraction from 3T3-L1 preadipocytes and adipocytes was performed using cell lysis buffer with addition of phosphatase and protease inhibitors (Cell Signaling Technologies, Danvers, MA). The supernatant was extracted by centrifugation and protein concentration was determined by BCA protein assay according to manufacturer’s protocol (Thermo Scientific, Rockfrod, IL). Ten μg of whole cell lysate was resolved on SDS-PAGE (4–10% precise gels) and then transferred to PVDF membrane. Membranes were blocked with 5% non-fat milk in 1X TBST for 1h at room temperature. Membranes were incubated with anti-PPARγ, anti-C/EBPα and anti-β-actin at 4°C overnight, then washed with 1X TBST and incubated with AlexaFluor 680 conjugated anti-rabbit IgG and IRDye 800 conjugated anti-mouse IgG for 1 h at room temperature. After thorough washing, blots were scanned and quantified using an Odyssey Dual Infrared Imaging System (Li-Cor).
Microscopy
Images were obtained using a Nikon 80i phase-contrast microscope, using a 20X objective lens. Image quantification was performed using MetaMorph Image analysis software (Nashville, TN). Area fractions were collected for each image. Images were collected in six to eight replicates from each culture well. Average area fractions of each of the six to eight replicates were used to calculate average area fraction of each treatment sample. Further, average area fraction values of each treatment were normalized to average area fraction values of corresponding controls.
Statistical analysis
Statistical analysis software (SAS) 9.3 was used to perform all data analysis. Data were analyzed using a one-way analysis of variance (ANOVA) for each time point. Tukey’s test was used to find the significant differences among the different means. Differences, when p < 0.05, were considered statistically significant. Gene expression data were analyzed by comparing log (base 2) transformed values of mRNA fold expression across treatments within each time-point. All data are reported as mean ± SE (n = 3).
Results
1, 25 - (OH)2D3 inhibits lipid accumulation
Cultures of 3T3-L1 cells were incubated in standard hormonal differentiation medium, in the presence or absence of 1, 25 - (OH)2D3. DMI medium served as a positive control treatment. Basal growth medium served as a negative control. Lipid accumulation was observed through ORO staining on days 0, 2, 4, 6, 8 (data not shown) and 10 (Fig 1A). Image quantification analysis shows that lipid accumulation at higher concentrations of 1, 25 - (OH)2D3 (100, 10, 1 nM) treated cells was similar to that in negative control cells, and significantly lower than the positive control (Fig 1B). The lowest concentration of 1, 25 - (OH)2D3 treated cells showed higher lipid accumulation than negative control and other 1, 25 - (OH)2D3 treated cells, however, lipid accumulation was still significantly lower when compared to the positive control (Fig 1B). This suggests that 1, 25 - (OH)2D3 treatment inhibited lipid accumulation and adipogenesis in a dose dependent manner.
High concentrations of 1, 25 - (OH)2D3 inhibit PPARγ expression
To better understand the expression pattern of PPARγ during the process of adipocyte differentiation, RNA extracts and protein extracts from 3T3-L1 cells treated with DM only were obtained for real-time PCR and Western blots tests. Gene expression levels of PPARγ began to increase after day 2, and reached a maximum on day 8 (Fig 2A). Protein levels of PPARγ were consistent with gene expression levels, increasing on day 2, and reaching the highest level on day 10 (Fig 2B). This suggests PPARγ expression level increased concurrent with adipocyte differentiation, and consistent with increasing lipid accumulation.
Gene expression levels of PPARγ in 3T3-L1 cells treated with high concentrations (100, 10, and 1 nM) of 1, 25 - (OH)2D3 were significantly inhibited compared to the positive control (Fig 3A–3E) at all time-points measured. In addition, for all time-points, 3T3-L1 cultures treated with low concentrations (0.1 and 0.01 nM) of 1, 25 - (OH)2D3 showed no significant differences in PPARγ gene expression levels as compared to positive control cultures (Fig 3A–3E). On days 2, 4 and 10, the highest concentration (100 nM) of 1, 25 - (OH)2D3 had the greatest inhibitory effect on PPARγ mRNA expression levels. This suggests that PPARγ gene expression levels were inhibited by 1, 25 - (OH)2D3, and 1, 25 - (OH)2D3 had greater efficacy in inhibiting PPARγ gene expression at higher concentrations.
To confirm the real-time PCR results, Western blots also were performed on whole cell lysates following treatment with 100 or 1 nM of 1, 25 - (OH)2D3 at all the time points. Basal growth medium (GM) and differentiation medium (DM) served as negative and positive controls, respectively. PPARγ protein levels were inhibited by 1, 25 - (OH)2D3 at 6 h (S1A Fig), but thereafter the PPARγ protein levels were high in the 100 nM 1, 25 - (OH)2D3 treated groups, but remained low in DM only groups from 12 h to day 4 (S1B–S1E Fig). On day 8, both the 1, 25 - (OH)2D3 treated groups and DM only group had high PPARγ protein level (S1G Fig), and on day 10, PPARγ protein levels in both 100 and 1 nM of 1, 25 - (OH)2D3 treatment groups decreased to levels similar to the GM only treatment. However, in the DM only group, PPARγ protein level still remained relatively high (S1H Fig). This suggests that 1, 25 - (OH)2D3 treatments inhibit PPARγ protein levels only at the early time point, 6 h, and again at the late time point, day 10. At the other time points, since the whole cell lysates were used for Western blots measurement, and the 1, 25 - (OH)2D3 treated group had higher PPARγ protein level than the DM only group, suggesting that the inhibitory efficacy of 1, 25 - (OH)2D3 on adipogenesis may function at the level of blocking PPARγ protein trafficking to nucleus.
Gene expression of C/EBPα is inhibited by high concentrations of 1, 25 - (OH)2D3
Both C/EBPα mRNA expression and protein level were measured in DM only treatments as a reference to help understand regulation of this gene in adipocyte differentiation (Fig 4). Gene expression of C/EBPα was increased from days 2 to 10, and reached the maximum at day 8 (Fig 4A), however, total cell protein levels of C/EBPα did not change significantly from 0 h to day 10 (Fig 4B), and appeared to remain at relatively high levels throughout the test period.
Similarly to PPARγ, no significant changes in C/EBPα gene expression levels were observed in the cells treated with low concentrations (0.01 and 0.1 nM) of 1, 25 - (OH)2D3 as compared to the positive control cells at all time-points measured. (Fig 5). Cells treated with high concentrations (100, 10, and 1 nM) of 1, 25 - (OH)2D3 showed significant inhibition of C/EBPα expression as compared to the positive control for days 2 and 4 (Fig 5A and 5B). Similarly to PPARγ expression, C/EBPα gene expression levels showed no significant difference between treatments groups on day 6 (Fig 5C). The inhibitory efficacy of 1, 25 - (OH)2D3 was significant on days 8 and 10 in 1, 25 - (OH)2D3 treatment groups compared to DM only group (Fig 5D and 5E). This suggests that similarly to regulation of PPARγ expression, that 1, 25 - (OH)2D3 treatments had significant inhibitory effects on C/EBPα gene transcription, and this efficacy lasted until day 10.
Total cell protein levels of C/EBPα were also determined (S2 Fig). In the early time points (6 and 12 h), C/EBPα protein levels were not changed in the 1, 25 - (OH)2D3 treatment groups and DM only group compared to negative control (S2A and S2B Fig). Furthermore, there were no significant differences in C/EBPα protein levels compared to DM only group to 1, 25 - (OH)2D3 treated groups at all the time points, suggesting that total cellular C/EBPα protein levels were not influenced by 1, 25 - (OH)2D3 treatment.
In the early time points, Vitamin D receptor gene expression is inhibited by high concentrations of 1, 25 - (OH)2D3
To better understand the expression pattern of vitamin D receptor, VDR mRNA expression levels were quantified from 0 h to day 10 in DM only treatments (Fig 6A). Gene expression of VDR increased from 6 h, reached a maximum at 12 h, and then decreased after 24 h. These results show that VDR was induced in the early time points of adipocyte differentiation, suggesting it may play an important role in inhibition of adipocyte differentiation by 1, 25 - (OH)2D3.
Vitamin D receptor gene expression was also determined in response to 1, 25 - (OH)2D3 treatments at 6 and 12 h, and on days 1, 2, 4, 6, 8, 10. At 6 and 12 h (Fig 6B and 6C), VDR gene expression was only inhibited in cells treated with the highest concentration (100 nM) of 1, 25 - (OH)2D3. Significant changes in VDR gene expression levels were observed in the cells treated with high concentrations (100, 10 and 1 nM) of 1, 25 - (OH)2D3 as compared to the positive control cells on days1, 2, and 4. (Fig 6D–6F). Cells treated with lower concentrations of 1, 25 - (OH)2D3 showed no significant inhibition of VDR expression as compared to DM only group at all the time points except day 10 (Fig 6B–6I). On day 10, VDR expression was inhibited by 1, 25 - (OH)2D3 treatments at all the concentrations (Fig 6I). This suggests that similarly to regulation of PPARγ and C/EBPα expression, 1, 25 - (OH)2D3 treatments had significant inhibitory effects on VDR gene transcription, especially early (days 1 and 2) in adipocyte differentiation. This provides robust evidence that 1, 25 - (OH)2D3 regulates VDR, and that the effect is consistent with a biological role for 1, 25 - (OH)2D3 in adipocyte differentiation.
There is no effect of 1, 25-Dihydroxyvitamin D treatment on C/EBPβ gene expression levels
Gene expression levels of C/EBPβ in the positive control (Fig 7A) were increased after 6 h, and reached the highest expression level at 12 h, then decreased after day 2. Gene expression of C/EBPβ was determined at 6, 12, 24 h and days 2, 4, 6, 8 10 by real-time PCR. Unlike PPARγ and C/EBPα, C/EBPβ gene expression level was not impacted by 1, 25 - (OH)2D3 compared to DM only group at any time points tested, up to day 10 (Fig 7B–7H), suggesting that 1, 25 - (OH)2D3 has no effect on C/EBPβ gene expression levels. However, at day 10, the high concentrations (100, 10, and 1 nM) of 1, 25 - (OH)2D3 showed inhibitory effects on C/EBPβ gene expression (Fig 7I). On day 10, the expression level of C/EBPβ was very low (Fig 7A). Despite its low expression level, 1, 25 - (OH)2D3 had a suppressive effect on C/EBPβ expression at this time point.
C/EBPδ gene expression was not changed in response to 1, 25 - (OH)2D3 treatments
This member of the C/EBP family of transcription factors is induced in the early process of adipogenesis. Thus we quantified its gene expression levels at 6, 12, and 24 h, and continued to monitor its expression through days 2, 4, 6, 8, and 10. Similarly to C/EBPβ, C/EBPδ gene expression levels of 1, 25 - (OH)2D3 treated cells were generally not inhibited compared to the DM only treated group (Fig 8B–8I), even at the highest concentration of 1, 25 - (OH)2D3. This suggests that the inhibitory efficacy of 1, 25 - (OH)2D3 in adipogenesis does not impact the expression of C/EBPδ. Analysis of C/EBPδ gene expression in the positive control during adipocyte differentiation indicated that it is increased after 6 h, reaching the highest point at 12 h, and then decreases after 24 h (Fig 8A). Interestingly, the expression level of C/EBPδ was again increased after day 8, and reached a similar high expression level compared to 12 h on day 10 (Fig 8A). This suggests that the C/EBPδ gene may not only be induced and have a role in the early process of adipogenesis, but may also have a role in the latter stages of adipogenesis.
Gene expression of FABP4 is highly responsive to 1, 25 - (OH)2D3 treatments
In the positive control treatments, the expression pattern of FABP4 was similar to that of PPARγ, increasing after day 2, and reaching the highest expression levels on day 8 but declining to similar levels to day 6 by day 10 (Fig 9F). Gene expression of FABP4 was strongly inhibited by high concentrations (100, 10, and 1 nM) of 1, 25 - (OH)2D3 treatments at all the time points (Fig 9). Moreover, unlike PPARγ and C/EBPα expression levels, FABP4 gene expression levels in response to 0.1 nM 1, 25 - (OH)2D3 were also significantly inhibited compared to the positive control at all time-points (Fig 9). The lowest concentration of 1, 25 - (OH)2D3 (0.01nM) treatments had no effect on FABP4 gene expression on days 2 and 4 compared to the DM only group (Fig 9B and 9C). However, on day 6, even the lowest concentration of 1, 25 - (OH)2D3 showed an inhibitory effect on FABP4 gene expression (Fig 9D). These effects were attenuated on days 8 and 10 (Fig 9E and 9F).
Patterns of SREBP-1c expression resembled those of C/EBPβ and C/EBPδ expression, but was fleetingly inhibited on day 2
The expression pattern of SREBP-1c in adipocyte differentiation showed that it was induced to the maximum expression level on day 2, and then decreased quickly from days 4 to 10 (Fig 10A). Interestingly, on day 2, cells treated with 1, 25 - (OH)2D3 (all concentrations tested, 100, 10, 1, 0.1 and 0.01 nM) showed significant inhibition of SREBP-1c gene expression as compared to the positive control (Fig 10B). However, this effect was rapidly attenuated. Similarly to C/EBPβ and C/EBPδ, SREBP-1c gene expression levels of 1, 25 - (OH)2D3 treated cells were generally not different from the positive control from days 4 to 10 (Fig 10C–10F). The inhibitory effect of 1, 25 - (OH)2D3 on day 2 coincides with the time point of maximum SREBP-1c expression (Fig 10A), suggesting that 1, 25 - (OH)2D3 only has an effect when SREBP-1c reached a high expression level. These results suggest that SREBP-1c may also play an important role in the 1, 25 - (OH)2D3 modulation pathway, and may have interaction with 1, 25 - (OH)2D3 during the early stages of adipogenesis.
The inhibitory effect of 1, 25 - (OH)2D3 on SCD-1 gene expression levels was more gradual compared to PPARγ, C/EBPα or FABP4 expression
For the positive control, the expression pattern of SCD-1 in adipocyte differentiation process was similar to that of PPARγ and C/EBPα. Expression of SCD-1 was increased on day 2, and reached a maximum expression level on day 8, remaining relatively high on day 10 (Fig 11A). The inhibition of SCD-1 gene expression was induced by all concentrations of 1, 25 - (OH)2D3 on day 2 (Fig 11B). However, its inhibitory effect at latter time points was more pronounced (Fig 11C–11F). Expression of SCD-1 was inhibited by high concentrations (100, 10 and 1 nM) of 1, 25 - (OH)2D3 on day 4 (Fig 11C), showing a 70% inhibition effect at this time point. This continued to day 6 (Fig 11D), and reached a inhibition effect greater than 90% of the positive control, in all of the three high concentrations of 1, 25 - (OH)2D3 treatments. The efficacy of 1, 25 - (OH)2D3 was stronger after day 6, and all the five concentrations of 1, 25 - (OH)2D3 showed significant inhibition on days 8 and 10 (Fig 11E and 11F). This suggests SCD-1 is strongly responsive to 1, 25 - (OH)2D3, and may play an important role in the pathway of 1, 25 - (OH)2D3 regulation of adipogenesis.
Gene expression of Pref-1 was altered in early time-points in response to high concentrations of 1, 25 - (OH)2D3
In the positive control, the expression pattern of Pref-1 as expected was decreased by day 2, and remained so through until day 10 (Fig 12A). Expression levels of Pref-1 were not altered in any of the 1, 25 - (OH)2D3 treated cells on day 2 (Fig 12B), values being similar to the positive control. Cells treated with high concentrations of 1, 25 - (OH)2D3 (100, 10, and 1 nM) showed a significant increase in Pref-1 gene expression levels from days 4 to 6 (Fig 12C and 12D), suggesting greater retention of the preadipocyte phenotype. By day 8, all effects from 1, 25 - (OH)2D3 treatments appeared to be attenuated, although the inhibitory effect was at least partially regenerated on day 10 (Fig 12E and 12F). This results suggest that Pref-1 expression responds to 1, 25 - (OH)2D3 in the latter stages of adipocyte differentiation, and may also plays a role in the pathways of 1, 25 - (OH)2D3 inhibited adipogenesis.
Relative luciferase activity of C/EBPα promoter activity was not affected by 1, 25 - (OH)2D3 treatment
This study was conducted to investigate C/EBPα promoter activity in response to transient exposure of cells for 0, 12, 24 and 48 h to 100 nM 1, 25 - (OH)2D3 plus differentiation medium, differentiation medium only, and growth medium only. The data obtained with 1, 25 - (OH)2D3 treatment indicated no change C/EBPα promoter activity at any time points, 12, 24 and 48 h, compared to differentiation medium, suggesting no effects of 1, 25 - (OH)2D3 on C/EBPα promoter activity (Fig 13). The promoter activities of C/EBPα from cells treated with both differentiation medium and differentiation medium plus 1, 25 - (OH)2D3 were significantly higher than growth medium alone (Fig 13), suggesting that the C/EBPα promoter is stimulated within the first 48 h of adipocyte differentiation.
Discussion
Although the inhibitory effect of 1, 25 - (OH)2D3 in adipogenesis has been reported for more than a decade, the molecular mechanisms underlying this inhibition remains unclear. To explore this important question, we have performed a systematic investigation aimed at studying the molecular events during the adipocyte differentiation response to 1, 25 - (OH)2D3. The 3T3-L1 cell line is a major model used in developing understanding of adipocyte differentiation and key adipogenic gene expression. Our strategy was to take advantage of this well-defined adipogenic model and identify the molecular changes at each stage that resulted from 1, 25 - (OH)2D3 treatments. We report here that lipid accumulation and expression levels of adipogenic specific genes were inhibited in vitro by high concentrations (1, 10 and 100 nM) of 1, 25 - (OH)2D3 but not by lower concentrations (0.1 and 0.01 nM). As discussed in greater detail below, lipid accumulation was inhibited by the high concentrations of 1, 25 - (OH)2D3, at levels comparable to the negative control, by day 10. The lower concentrations of 1, 25 - (OH)2D3 have slight inhibitory effects on lipid accumulation compared to the positive control. Gene expression levels of PPARγ, C/EBPα, VDR, FABP4 and SCD-1 were inhibited by the high concentrations of 1, 25 - (OH)2D3 throughout the experimental period to day 10. However, the lower concentrations of 1, 25 - (OH)2D3 had no inhibitory effect. Gene expression levels of C/EBPβ and C/EBPδ were not affected by 1, 25 - (OH)2D3 treatments, at any of the concentrations tested. We also studied the effects of 1, 25 - (OH)2D3 on C/EBPα promoter activity. There appeared to be no inhibitory effect of 1, 25 - (OH)2D3 on the activity of the C/EBPα promoter. The present study has also provided a detailed temporal analysis of key adipogenic gene expression across time points from days 0 to 10 during the adipocyte differentiation process. These data demonstrate at least three important observations: 1) high concentrations of 1, 25 - (OH)2D3 have strongly inhibitory effects on adipogenesis, and this effects persist through day10, 2) not all of the key adipogenic genes (e.g. C /EBPβ and C/EBPδ) interact with 1, 25 - (OH)2D3, and 3) the pathway of 1, 25 - (OH)2D3 mediated inhibition of adipogenesis does not appear to involve the C/EBPα promoter.
1, 25-Dihydroxyvitamin D3 is an endocrine hormone that plays multiple physiological roles[21]. This secosteroid hormone is known to be critical for immune system function [22] and calcium and phosphate homeostasis[23,24]. 1, 25-Dihydroxyvitamin D3 is also known to affect adipocyte differentiation and metabolism [25]. 1, 25-Dihydroxyvitamin D3 is also the ligand of VDR, hence, VDR may play an important part in the inhibitory pathway of 1, 25 - (OH)2D3 in adipogenesis. The VDR has previously been reported to play an important role in the vitamin D signaling pathway in health and disease[25]. Kong and Li [26] found that VDR protein expression was very low in mouse 3T3-L1 preadipocytes, however, VDR expression increased dramatically by 4 h following treatment with adipogenic differentiation medium, and returned to baseline levels by day 2. 1, 25-Dihydroxyvitamin D3 treatment was able to stabilize VDR expression for at least another day. The mechanism of VDR stabilization by 1, 25 - (OH)2D3 is currently not known. However, the observation of VDR expression in the early time points of adipogenesis may provide a short window for 1, 25 - (OH)2D3 to inhibit adipogenesis[13]. The role of the VDR in pre-adipocyte differentiation in 3T3-L1 cells was also studied by Blumberg et al[15]. Their studies reported that the mRNA levels of VDR increased to a maximum by 6 h following initiation of adipocyte differentiation, and the protein levels of VDR reached a maximum by 12 h in the nucleus, and then declined to baseline level by day 2. These similar reports suggest that the inhibition of adipogenesis by 1, 25 - (OH)2D3 binding VDR may occur in the early time points (before day 2) during adipogenesis, however, the specific mechanism still remains unknown. In our studies, VDR gene expression pattern in adipocyte differentiation was measured from 0 h to day 10. The expression of VDR was induced after adipocyte differentiation was initiated (6 h), and reached the maximum expression level at 12 h, then declined after 24 h, which is consistent with previous literature reports. In addition, VDR gene expression was inhibited by 1, 25 - (OH)2D3 treatments at early time points. We report the novel finding that the interaction between 1, 25 - (OH)2D3 and its receptor leads to inhibition of down-stream expression of adipogenic-specific genes. This suggests that VDR plays an important role in the inhibitory pathway of 1, 25 - (OH)2D3 regulating adipocyte differentiation.
The C/EBP family is a class of basic-leucine zipper transcription factors, and does not form homo-or hetero dimers. Furthermore, their tissue distribution is not limited to adipose tissue[27]. The gene expression of several C/EBP family members is known to be regulated during adipogenesis, and they have been shown to be regulators of adipocyte differentiation. Both C/EBPβ and C/EBPδ mRNA and protein levels were reported to rise early and transiently in preadipocytes which have been induced to differentiate [28–30]. In the present study, real-time PCR results confirmed that during adipogenesis, C/EBPβ mRNA expression levels began to rise by 6 h, and reached a maximum by 12 h following induction, then declined to baseline level after 24 h (Fig 7A). The mRNA expression levels of C/EBPδ also increased by 6 h, and reached the highest level at 12 h, then decreased after 24 h (Fig 8A). These results are consistent with previous reports, and the timing of expression of these two genes was similar to VDR, suggesting that there may be an interaction between 1, 25 - (OH)2D3 through VDR binding, inhibiting adipogenesis and C/EBPβ or C/EBPδ expression during early adipogenesis. Blumberg et al [15] reported that 1, 25 - (OH)2D3 treatment inhibited C/EBPβ mRNA expression level, however, C/EBPδ gene expression did not change in response to 1, 25 - (OH)2D3. Their studies indicate that after binding with VDR, 1, 25 - (OH)2D3 inhibits adipogenesis via inhibiting C/EBPβ gene expression but not C/EBPδ. In contrast, Kong and Li [26] reported that 1, 25 - (OH)2D3 treatments did not influence the gene expression of either C/EBPβ or C/EBPδ [27]. In the present study, we quantified gene expression levels of both C/EBPβ and C/EBPδ in response to 1, 25 - (OH)2D3 treatment, and our results are similar to those reported by Kong and Li[26]. From 6 h to 24 h, and days 2 to 10, gene expression levels of C/EBPβ and C/EBPδ were not changed by 1, 25 - (OH)2D3 treatments. These data demonstrate that even though the gene expression of these C/EBP family members is stimulated in early adipogenesis, corresponding to the maximum expression time of VDR, these two factors are not included in the pathway of 1, 25 - (OH)2D3 inhibited adipogenesis.
The PPAR family is a group of transcriptional factors belonging to the nuclear hormone receptor superfamily. These transcriptional factors heterodimerize with another nuclear hormone receptor, retinoid X receptor (RXR), bind to the response elements of target gene promoters and function as active transcriptional factors[31]. When PPARs are heterodimerized with RXR, the complex is activated and transported to the nucleus to bind to specific sequences in promoter regions (termed as PPAR response elements, PPREs) of downstream target genes, activating their transcription[6,32]. There are three major isoforms: PPARα, PPARδ, and PPARγ [28]. The three isoforms have specific roles in lipid metabolism. Importantly, PPARγ plays an important role in triglyceride synthesis and adipocyte differentiation[32]. Activation of PPARγ expression occurs downstream of C/EBPβ and C/EBPδ transcription during the cascade of adipogenesis, and upstream of C/EBPα. In the present study, gene expression of PPARγ was highly inhibited by 1, 25 - (OH)2D3, from day 2 until day 10 (Fig 3). Moreover, the cellular response of C/EBPα to 1, 25 - (OH)2D3 was similar to that of PPARγ. The inhibition of 1, 25 - (OH)2D3 was persistent until day 10 (Fig 5). These data indicate that the 1, 25 - (OH)2D3 induced inhibition of adipogenesis in 3T3-L1 cells was associated with an inhibition of PPARγ and C/EBPα gene expression.
To confirm these results, the protein levels of both PPARγ and C/EBPα were measured using Western blot. Interestingly, the whole cell lysate from 1, 25 - (OH)2D3 plus DM treated cells had the highest PPARγ protein level from 6 h to day 4, and the whole cell lysate from DM only treated cells had lower PPARγ levels than the 1, 25 - (OH)2D3 treated cells, but comparable to growth medium treated cells. By day 6, the 1, 25 - (OH)2D3 plus DM treated cells and DM only treated cells had similar levels of PPARγ protein, however, by day 10, DM only treated cells had the highest PPARγ protein level, and PPARγ protein level from 1, 25 - (OH)2D3 plus DM treated cells was decreased to the same level as growth medium only treated cells (S1 Fig). Protein levels of C/EBPα in the whole cell lysate were not changed in response to 1, 25 - (OH)2D3 treatments on any of the time points in comparison to DM only treated cells (S2 Fig), suggesting that C/EBPα protein was not influenced by 1, 25 - (OH)2D3 treatments. In previous studies by Blumberg et al[15], they reported the protein level of PPARγ and C/EBPα was inhibited by 1, 25 - (OH)2D3 treatments. However, these authors used the nuclear extracts to measure the protein level of these two transcriptional factors. In the present study, we used the whole cell lysate to measure the protein levels. These observations together suggest that regulation of PPARγ effects are not directly mediated at transcriptional or translational levels. Rather, mediation occurs via regulation of PPARγ activation and transport to the nucleus. Thus, we hypothesize that 1, 25 - (OH)2D3 treatments block the trafficking of PPARγ from the cytoplasm to the nucleus. Thus, PPARγ protein is not transferred into nucleus preventing activation of downstream target genes in adipogenesis. In contrast, without 1, 25 - (OH)2D3 treatment, the PPARγ protein in the DM only treated cells was readily transported into the nucleus, and functioned as transcriptional factor, inducing the downstream genes (e.g. C/EBPα, FABP4). Therefore, the protein level of PPARγ in DM only treated cells was lower compared to 1, 25 - (OH)2D3 treated cells. The protein levels of PPARγ and C/EBPα in DM only treated cells were measured from 0, 6, and 12 h to days 1, 2, 4, 6, 8, and 10. The protein levels of PPARγ were consistent with mRNA expression levels quantified by real-time PCR. Interestingly, unlike PPARγ, the protein levels of C/EBPα were only slightly changed throughout the experimental time points. We hypothesize that this may be because the C/EBPα protein has longer half-life than PPARγ or is accumulated in the cytoplasm before adipogenesis is initiated. The activity of the C/EBPα promoter was also measured using the Dual Reporter Luciferase Assay System (Promega, Madison, WI). Relative luciferase activity data showed that the activity of C/EBPα promoter appeared to be unchanged in response to 1, 25 - (OH)2D3 treatments. These intriguing data demonstrate that 1, 25 - (OH)2D3 treatments inhibit adipogenesis via inhibiting PPARγ and C/EBPα gene expression, and that PPARγ may play a more important role in this pathway in comparison to C/EBPα. Further studies are needed to explore the mechanism of PPARγ interaction with 1, 25 - (OH)2D3 in its inhibition of adipogenesis.
In the present study, SREBP-1c gene expression was only inhibited by 1, 25 - (OH)2D3 treatments on day 2, coinciding with its maximum expression level in the positive control treatment. Both the high (100, 10, and 1 nM) and low (0.1 and 0.01 nM) concentrations of 1, 25 - (OH)2D3 inhibited SREBP-1c gene expression on day 2 (Fig 10B). However, from days 4 to 10, the inhibitory effects were ameliorated, and the expression of SREBP-1c was not changed in response to 1, 25 - (OH)2D3 treatments, at any of the concentrations tested (Fig 10C–10F). These data indicate that the inhibition of SREBP-1c gene expression by 1, 25 - (OH)2D3 treatment was transient and corresponded with the d 2 time point, in which its expression rose, 10-fold in the positive control in comparison to the time-point at d 0. Thus, it is not clear whether SREBP-1c may be involved in the 1, 25 - (OH)2D3 signaling pathway that inhibits adipogenesis, showing a similar gene expression profile to C/EBPβ and also reflecting the profile observed for C/EBPδ at time-points up to d 6. These three genes are upstream of PPARγ in the transcriptional activation of adipogenesis, hence, the inhibition of adipogenesis caused by 1, 25 - (OH)2D3 may be unrelated to mechanisms involving the transcriptional factors that are expressed in the early stages of adipogenesis.
In additional to PPARγ and C/EBPα, gene expression levels of FABP4 and SCD-1 were strongly inhibited by 1, 25 - (OH)2D3 treatments. Gene expression of FABP4 was strongly inhibited by the high concentrations (100, 10 and 1 nM) of 1, 25 - (OH)2D3 treatments from days 2 to 4 (Fig 9B and 9C). Moreover, from days 6 to 10, all the concentrations of 1, 25 - (OH)2D3 had significant inhibitory effects on FABP4 gene expression (Fig 9D–9F). The inhibitory effects of 1, 25 - (OH)2D3 treatments on SCD-1 gene expression were gradual in comparison to effects on FABP4 expression. Inhibition by high concentrations of 1, 25 - (OH)2D3 began by day 4 (Fig 10C), and remained until day 8 (Fig 11D and 11E). However, by day 10, gene expression of SCD-1 was inhibited by all concentrations of 1, 25 - (OH)2D3 tested (Fig 11F), and comparable to effects on FABP4. In previous reports, FABP4 has been shown to have a PPARγ response element (PPRE) in its promoter region and PPARγ regulates gene expression of FABP4[32]. In 1, 25 - (OH)2D3 treated cells, PPARγ expression was significantly inhibited, and this effect also appeared to cause a negative action on gene expression of FABP4. Similarly to FABP4, SCD-1 also plays an important role in adipogenesis. Its functions include incorporation of double bonds in fatty acids and synthesis of long chain fatty acids in adipocytes[32]. In the present study, SCD-1 expression was gradually increased from days 2 to 10 with DM treatment, and significantly inhibited by 1, 25 - (OH)2D3 treatments, suggesting that SCD-1 may play a role in the pathway of 1, 25 - (OH)2D3 inhibited adipogenesis. Mechanisms of FABP4 and SCD-1 gene expression in response to 1, 25 - (OH)2D3 still need to be explored further.
Preadipocyte factor 1 is a marker protein of preadipocytes and is not expressed in mature adipocytes[33]. During initiation of adipogenesis, the gene expression of Pref-1 decreases and the expression of key adipogenic genes increases[34]. We hypothesized that gene expression of Pref-1 would decrease in treatments with differentiation medium, and would remain at higher levels in treatments with 1, 25 - (OH)2D3 when compared to in DM treated cells. In the present study, Pref-1 gene expression was significantly lower compared to that of day 4, DM only treated cells, and remained at low levels through day 10 (Fig 12A). In the cells treated with 1, 25 - (OH)2D3, Pref-1 gene expression was significantly higher than in DM only treated cells by day 6 (Fig 12B–12F), and declined to similar levels to the DM only group from days 8 to 10 (Fig 12E and 12F). These data support our hypothesis, and in the 1, 25 - (OH)2D3 treatments where PPARγ, C/EBPα, FABP4 and SCD-1 gene expression levels were inhibited, the expression of Pref-1 gene correspondingly remained significantly higher than in DM only treatments.
In conclusion, lipid accumulation and the expression of key adipogenic key genes, PPARγ, C/EBPα, FABP4, and SCD-1 were significantly inhibited by 1, 25 - (OH)2D3 treatments until day 10. Gene expression of SREBP-1c was transiently inhibited by 1, 25 - (OH)2D3 on day 2, and then rebounded back to levels similar to the low levels observed in DM treatment by days 4, 6, 8, and 10. In contrast, C/EBP β and C/EBP δ expression were not changed in response to 1, 25 - (OH)2D3 treatments. Our study has demonstrated that 1, 25 - (OH)2D3 represses adipogenesis via inhibition of the expression of PPARγ, but not C/EBP β or C/EBP δ, and hence, the adipogenic-specific genes (C/EBPα, FABP4, and SCD-1) downstream of PPARγ during the transcriptional cascade of adipogenesis, were also inhibited. In future, studies are needed to explore the mechanisms by which 1, 25 - (OH)2D3 interacts with PPARγ and regulates adipogenesis.
Supporting Information
Acknowledgments
We thank Ann Norton of the Optical Imaging Center at the University of Idaho for assistance with the ORO image capture and analysis.
Data Availability
All relevant data are within the paper and its Supporting Information files.
Funding Statement
The authors thank the Idaho Experiment Station for support of these studies. The authors also thank the China Scholarship Council for support of Ms. Shuhan Ji.
References
- 1. Hirsch J, Batchelor B (1976) Adipose tissue cellularity in human obesity. Clin Endocrinol Metab 5: 299–311. [DOI] [PubMed] [Google Scholar]
- 2. Cheguru P, Chapalamadugu KC, Doumit ME, Murdoch GK, Hill RA (2012) Adipocyte differentiation-specific gene transcriptional response to C18 unsaturated fatty acids plus insulin. Pflugers Archiv-European Journal of Physiology 463: 429–447. 10.1007/s00424-011-1066-7 [DOI] [PubMed] [Google Scholar]
- 3. Rosen ED, Spiegelman BM (2000) Molecular regulation of adipogenesis. Annu Rev Cell Dev Biol 16: 145–171. [DOI] [PubMed] [Google Scholar]
- 4. Rosen ED, Hsu CH, Wang X, Sakai S, Freeman MW, Gonzalez FJ, et al. (2002) C/EBPalpha induces adipogenesis through PPARgamma: a unified pathway. Genes Dev 16: 22–26. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Gregoire FM, Smas CM, Sul HS (1998) Understanding adipocyte differentiation. Physiol Rev 78: 783–809. [DOI] [PubMed] [Google Scholar]
- 6. Rosen ED, Walkey CJ, Puigserver P, Spiegelman BM (2000) Transcriptional regulation of adipogenesis. Genes Dev 14: 1293–1307. [PubMed] [Google Scholar]
- 7. Brown MS, Goldstein JL (1997) The SREBP pathway: regulation of cholesterol metabolism by proteolysis of a membrane-bound transcription factor. Cell 89: 331–340. [DOI] [PubMed] [Google Scholar]
- 8. Kim JB, Sarraf P, Wright M, Yao KM, Mueller E, Solanes G, et al. (1998) Nutritional and Insulin Regulation of Fatty Acid Synthetase and Leptin Gene Expression through ADD1/SREBP1. J Clin Invest 101: 1–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Kim JB, Spiegelman BM (1996) ADD1/SREBP1 promotes adipocyte differentiation and gene expression linked to fatty acid metabolism. Genes Dev 10: 1096–1107. [DOI] [PubMed] [Google Scholar]
- 10. Fajas L, Schoonjans K, Gelman L, Kim JB, Najib J, Martin G, et al. (1999) Regulation of peroxisome proliferator-activated receptor gamma expression by adipocyte differentiation and determination factor 1/sterol regulatory element binding protein 1: implications for adipocyte differentiation and metabolism. Mol Cell Biol 19: 5495–5503. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Matsuo T, Matsuo M, Kasai M, Takeuchi H (2001) Effects of a liquid diet supplement containing structured medium- and long-chain triacylglycerols on bodyfat accumulation in healthy young subjects. Asia Pac J Clin Nutr 10: 46–50. [DOI] [PubMed] [Google Scholar]
- 12. Martini LA, Wood RJ (2006) Vitamin D status and the metabolic syndrome. Nutr Rev 64: 479–486. [DOI] [PubMed] [Google Scholar]
- 13. Wood RJ (2008) Vitamin D and adipogenesis: new molecular insights. Nutr Rev 66: 40–46. 10.1111/j.1753-4887.2007.00004.x [DOI] [PubMed] [Google Scholar]
- 14. Hida Y, Kawada T, Kayahashi S, Ishihara T, Fushiki T (1998) Counteraction of retinoic acid and 1,25-dihydroxyvitamin D3 on up-regulation of adipocyte differentiation with PPARgamma ligand, an antidiabetic thiazolidinedione, in 3T3-L1 cells. Life Sci 62: PL205–211. [DOI] [PubMed] [Google Scholar]
- 15. Blumberg JM, Tzameli I, Astapova I, Lam FS, Flier JS, Hollenberg AN (2006) Complex role of the vitamin D receptor and its ligand in adipogenesis in 3T3-L1 cells. J Biol Chem 281: 11205–11213. [DOI] [PubMed] [Google Scholar]
- 16. Sato M, Hiragun A (1988) Demonstration of 1 alpha,25-dihydroxyvitamin D3 receptor-like molecule in ST 13 and 3T3 L1 preadipocytes and its inhibitory effects on preadipocyte differentiation. J Cell Physiol 135: 545–550. [DOI] [PubMed] [Google Scholar]
- 17. Kamei Y, Kawada T, Kazuki R, Ono T, Kato S, Sugimoto E, et al. (1993) Vitamin D receptor gene expression is up-regulated by 1, 25-dihydroxyvitamin D3 in 3T3-L1 preadipocytes. Biochem Biophys Res Commun 193: 948–955. [DOI] [PubMed] [Google Scholar]
- 18. Kelly KA, Gimble JM (1998) 1,25-Dihydroxy vitamin D3 inhibits adipocyte differentiation and gene expression in murine bone marrow stromal cell clones and primary cultures. Endocrinology 139: 2622–2628. [DOI] [PubMed] [Google Scholar]
- 19. Ramirezzacarias JL, Castromunozledo F, Kuriharcuch W (1992) Quantitation of Adipose Conversion and Triglycerides by Staining Intracytoplasmic Lipids with Oil Red-O. Histochemistry 97: 493–497. [DOI] [PubMed] [Google Scholar]
- 20. Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Research 29: e45 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Sutton AL, MacDonald PN (2003) Vitamin D: more than a "bone-a-fide" hormone. Mol Endocrinol 17: 777–791. [DOI] [PubMed] [Google Scholar]
- 22. Van Etten E, Decallonne B, Verlinden L, Verstuyf A, Bouillon R, Mathieu C, et al. (2003) Analogs of 1alpha,25-dihydroxyvitamin D3 as pluripotent immunomodulators. J Cell Biochem 88: 223–226. [DOI] [PubMed] [Google Scholar]
- 23. Li YC, Pirro AE, Amling M, Delling G, Baron R, Bronson R, et al. (1997) Targeted ablation of the vitamin D receptor: an animal model of vitamin D-dependent rickets type II with alopecia. Proc Natl Acad Sci U S A 94: 9831–9835. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Yoshizawa T, Handa Y, Uematsu Y, Takeda S, Sekine K, Yoshihara Y, et al. (1997) Mice lacking the vitamin D receptor exhibit impaired bone formation, uterine hypoplasia and growth retardation after weaning. Nat Genet 16: 391–396. [DOI] [PubMed] [Google Scholar]
- 25. Jones G, Strugnell SA, DeLuca HF (1998) Current understanding of the molecular actions of vitamin D. Physiol Rev 78: 1193–1231. [DOI] [PubMed] [Google Scholar]
- 26. Kong J, Li YC (2006) Molecular mechanism of 1,25-dihydroxyvitamin D3 inhibition of adipogenesis in 3T3-L1 cells. Am J Physiol Endocrinol Metab 290: E916–924. [DOI] [PubMed] [Google Scholar]
- 27. Lekstrom-Himes J, Xanthopoulos KG (1998) Biological role of the CCAAT/enhancer-binding protein family of transcription factors. J Biol Chem 273: 28545–28548. [DOI] [PubMed] [Google Scholar]
- 28. Cao Z, Umek RM, McKnight SL (1991) Regulated expression of three C/EBP isoforms during adipose conversion of 3T3-L1 cells. Genes Dev 5: 1538–1552. [DOI] [PubMed] [Google Scholar]
- 29. Darlington GJ, Ross SE, MacDougald OA (1998) The role of C/EBP genes in adipocyte differentiation. J Biol Chem 273: 30057–30060. [DOI] [PubMed] [Google Scholar]
- 30. Yeh WC, Cao Z, Classon M, McKnight SL (1995) Cascade regulation of terminal adipocyte differentiation by three members of the C/EBP family of leucine zipper proteins. Genes Dev 9: 168–181. [DOI] [PubMed] [Google Scholar]
- 31. Laudet V, Hanni C, Coll J, Catzeflis F, Stehelin D (1992) Evolution of the nuclear receptor gene superfamily. EMBO J 11: 1003–1013. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. Desvergne B, Michalik L, Wahli W (2006) Transcriptional Regulation of Metabolism. Physiol Rev 86: 465–514. [DOI] [PubMed] [Google Scholar]
- 33. Sul HS (2009) Minireview: Pref-1: role in adipogenesis and mesenchymal cell fate. Mol Endocrinol 23: 1717–1725. 10.1210/me.2009-0160 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Macdougald OA, Lane MD (1995) Transcriptional Regulation of Gene-Expression During Adipocyte Differentiation. Annual Review of Biochemistry 64: 345–373. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
All relevant data are within the paper and its Supporting Information files.