Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2015 Jun 2.
Published in final edited form as: Mol Oral Microbiol. 2011 Sep 8;26(6):388–395. doi: 10.1111/j.2041-1014.2011.00626.x

Differential expression and adherence of Porphyromonas gingivalis FimA genotypes

C Zheng 1, J Wu 1, H Xie 1
PMCID: PMC4451598  NIHMSID: NIHMS372585  PMID: 22053966

SUMMARY

Porphyromonas gingivalis is a primary pathogen involved in the initiation and progression of adult chronic periodontitis. Its colonization on oral surfaces is a necessary first step leading to infection. FimA, a subunit protein of major (long) fimbriae, is a well-known virulence factor. Based on its nucleotide sequence, FimA is classified into several genotypes. We compared here the transcriptional levels of the fimA gene in several P. gingivalis strains using real-time polymerase chain reaction analysis, fimbrial display on the P. gingivalis surface using transmission electronic microscopy, and the adherence competencies of P. gingivalis strains carrying different types of FimAs towards saliva and Streptococcus gordonii surfaces using mutagenesis analysis. We demonstrated differential expression of each fimA gene in these P. gingivalis strains. A correlation of the transcription level of fimA and binding activity of P. gingivalis was revealed. We show that P. gingivalis strains with genotype I and II of FimA are efficient in interaction with saliva or S. gordonii. This work highlights the important role of FimA type I and II in P. gingivalis attachment to oral surfaces.

Keywords: colonization, fimbriae, gene expression, gene knockouts

INTRODUCTION

Porphyromonas gingivalis has been shown to have a strong association with several forms of periodontitis (Socransky & Haffajee, 2005). The P. gingivalis strains were initially classified into four groups based on the nucleotide sequences of the fimA gene (type I and Ib to IV; Fujiwara et al., 1993). Nakagawa et al. (2002) later identified a distinctive genotype of fimA (type V) from clinical dental plaque samples retrieved from patients with periodontitis. Several clinical studies have been conducted to determine the distribution of P. gingivalis strains with different fimA genotypes and to establish an association between a specific fimA genotype and the occurrence of periodontitis or the severity of the disease. Although the majority of the studies from different countries suggested that P. gingivalis strains with type II and IV FimA are periodontitis-associated strains (Amano et al., 1999; van der Ploeg et al., 2004; Miura et al., 2005; Zhao et al., 2007; Nakano et al., 2008; Teixeira et al., 2009), a few studies using the same polymerase chain reaction (PCR) analysis reported that there was no difference in the association of the fimA genotypes with the incidence of periodontitis or the severity of the disease (Beikler et al., 2003; Perez-Chaparro et al., 2009). Interestingly, Fujise et al. (2005) found that FimA type I positive sites showed little improvement with periodontal treatment, therefore, this group suggested that the presence of P. gingivalis FimA type I may be useful as a predictor of poor treatment outcomes. Therefore, the earlier data are not conclusive with respect to association between particular FimA genotypes and strains of P. gingivalis.

The comparative functions of P. gingivalis FimA genotypes were investigated in independent laboratories. It appeared that all P. gingivalis strains with different fimA genotypes adhered to epithelial (KB, a cell line derived from a human carcinoma of the nasopharynx) cells, but with differential efficiencies (Umeda et al., 2006). Kato et al. (2007) demonstrated that type II fimbriae showed greater adhesive abilities for α5β1-integrin of epithelial cells than type I fimbriae. A recent study, using confocal microscopy, reported variations in the structures of biofilms formed by P. gingivalis strains with different genotypes for FimA (Kuboniwa et al., 2009). Differential host innate immune responses were also observed when mice were infected with either P. gingivalis 33277 (FimA I) or OMZ314 (FimA II; Kato et al., 2007; Wang et al., 2009). FimA type II was able to elicit a significantly higher serum interleukin-1β and interleukin-6 level compared with FimA type I. The reciprocal swap mutants’ behaviors were consistent with their heterogeneous fimbrial types, suggesting that FimA genotypes have a variable ability to provoke a host immune response. A comprehensive study by Wang et al. (2009) demonstrated different effects of FimA type on the bacterially induced bone loss and pro-inflammatory activities as well as intracellular entry. Porphyromonas gingivalis 33277 induces significantly more bone loss than OMZ314, but less pro-inflammatory activities compared with OMZ314. Moreover, P. gingivalis OMZ314 showed greater invasive ability into macrophages than type I strain 33277. These studies established differential function of FimA types, however, molecular mechanisms of different functional efficiencies have not been revealed. We hypothesize that differential expression of fimA in P. gingivalis strains carrying different genotypic FimA contributes, at least in part, to their function efficiency. To test this hypothesis, we examined the transcription levels of fimA in P. gingivalis strains with four different genotypes of FimA (type I, II, III and IV). Differential expression of fimA was found in these four strains. In parallel, adherence ability of these strains also varied. The results indicate that the elevated fimA expression and adherence ability in P. gingivalis strains with particular FimAs may be associated with their persistence and prevalence in the sites of periodontitis.

METHODS

Bacterial strains and growth conditions

Porphyromonas gingivalis strains, 33277 (type I), BH18/10, OMZ314, OMZ409 (type II), 49417 (type III), HG564 (type IV) and W83, were grown in Trypticase soy broth (TSB) or on TSB blood agar plates supplemented with yeast extract (1 mg ml−1), hemin (5 μg ml−1) and menadione (1 μg ml−1), at 37°C in an anaerobic chamber (85% N2, 10% H2, 5% CO2). Streptococcus gordonii DL1 was grown in trypticase peptone broth supplemented with 0.5% glucose at 37°C under aerobic conditions.

RNA isolation and quantitative PCR

The P. gingivalis strains were grown anaerobically and harvested by centrifugation at 8000 g and homogenized in Trizol reagent (Invitrogen, Carlsbad, CA). The RNA in the supernatant was then purified using an RNeasy mini spin column (Qiagen, Valencia, CA). Real-time reverse transcription (RT)-PCR analysis was performed by using the QuantiTect SYBR Green RT-PCR Kit (Qiagen) on the iCycler MyiQ™ Real-Time PCR detection system (Bio-Rad Laboratories Inc., Hercules, CA) according to the manufacturer’s instructions. Primers were designed using Primer3 software, and are listed in Table 1. The expression levels of the fimA genes for the test sample were determined by using the comparative cycle threshold (ΔCT) method. By loading the same amount of total RNA for comparable samples, the ΔCT represents the difference of gene expression between the samples.

Table 1.

Oligonucleotide primers used in this study

Primer name Primer sequences (5′–3′) Applications
fimA160F cagcaggaagccatcaaatc For RT-PCR of fimA (type I, II, III)
fimA160R cagtcagttcagttgtcaat
HG564-fimA151F ctaaaatcgcagcccttgtc For RT-PCR of fimA (type IV)
HG564-fimA151R gacgcctccaattcgtatgt
fimA1R-erm gatgttgcaaataccgatgagcaaccttagtcgcattttcgg For creating the fimA mutant of 33277 and OMZ409
fimA2F-erm cctctagagtcgacctgcagaatggaactggttggcaaga
49417-fimA(1)R-erm gatgttgcaaataccgatgagcaaccttagtcgcattttcgg For creating the fimA mutant of 49417
49417-fimA(2)F-erm cctctagagtcgacctgcagaatggaattggctggcaaga
HG564-fimA(1)R-erm gatgttgcaaataccgatgagccccttcttgaatttgacctg For creating the fimA mutant of HG564
HG564-fimA(2)F-erm cctctagagtcgacctgcaggccttgacgacttctttgac
16S rRNAF tgtagatgactgatggtgaaa For RT-PCR of Porphyromonas gingivalis
16S rRNAR actgttagcaactaccgatgt
Open in a new tab

The gene resistant to erythromycin (Emr) is underlined.

RT-PCR, reverse transcription polymerase chain reaction.

Construction of the fimA mutants

An insertional fimA mutant was generated by using ligation-independent cloning of PCR-mediated mutagenesis (LIC-PCR). A 2.1-kb ermF-ermAM cassette was introduced into the fimA gene by three steps of PCR to yield a fimA-erm-fimA DNA fragment as previously described (Wu et al., 2008). The fragment was then introduced into P. gingivalis strains by electroporation. The fimA-deficient mutant was generated via a double crossover event that replaced fimA with a fimA-erm-fimA DNA fragment in the chromosomes of the wild-type strains. The mutants were selected on TSB plates containing erythromycin (5 μg ml−1). The insertional mutation was confirmed by PCR analysis, and the mutants were designated P. gingivalis 33277_ΔfimA mutant (with 59-bp deletion), OMZ409_ΔfimA mutant (with 59-bp deletion), 49417_ΔfimA mutant (with 59-bp deletion), HG564_ΔfimA mutant (with 135-bp deletion).

Adherence assay

Attachment of P. gingivalis to saliva-coated surfaces was quantified by the method of O’Toole & Kolter (1998). Saliva collection was approved by the IRB of Meharry Medical College. Human whole saliva was collected from a periodontally healthy female donor. After centrifugation and filter sterilization (pore size 0.22 μm) to remove cell debris, saliva was incubated in a six-well polystyrene plate for 1 h. The plate was then washed with phosphate-buffered saline (PBS; 100 mm NaH2PO4, 150 mm NaCl). Bacterial strains were grown in TSB to mid log phase (optical density at 595 nm 1.0) and collected by centrifugation. The bacterial cells were resuspended in PBS. The P. gingivalis cells (6 × 108) were added to each well of a six-well polystyrene plate (Corning Incorporated, Corning, NY) that was pre-coated with human whole saliva, and were incubated at 37° C for 2 h.

Heterotypic biofilms of P. gingivalis–streptococci were also generated on a polystyrene six-well plate. The S. gordonii DL1 (6 × 108) were first incubated in saliva-coated wells at 37° C aerobically for 4 h, and unbound cells were removed by washing with PBS– Tween-20 (0.01%, volume/volume) twice. Porphyromonas gingivalis cells (6 × 108) in PBS–Tween-20 were added to the wells covered with streptococcal biofilms and incubated at 37° C anaerobically for 2 h.

The number of P. gingivalis cells bound on S. gordonii biofilms and saliva-coated surfaces was determined using quantitative PCR (Wu et al., 2008). The P. gingivalis cells were lysed with lysis solution (Solution A, Invitrogen). DNA was extracted using an Easy-DNA kit (Invitrogen) and eluted in 250 μl TE buffer (10 mm Tris–HCl, pH 7.5. 1 mM EDTA). The cells in biofilms were enumerated using a QuantiTect SYBR Green PCR Kit (Qiagen) with P. gingivalis species-specific 16S ribosomal RNA gene primers. Standards used to determine P. gingivalis cell numbers were prepared using genomic DNAs from wild-type strain 33277. A fresh culture of P. gingivalis 33277, grown in TSB, was serially diluted in PBS and plated onto TSB plates to obtain colony-forming units per milliliter at each dilution. DNA was also isolated from the dilutions and a quantitative PCR assay was run, as described above, to determine cell numbers. Three trials were performed on three separate cultures.

Transmission electron microscopy of P. gingivalis

Porphyromonas gingivalis cells were grown on TSB blood plates for 48 h. Bacterial cells were collected and resuspended in PBS. Twenty microliters of bacterial suspension was applied to a Formvar-coated copper grid (200-mesh, Electron Microscopy Sciences, Hatfield, PA) and air dried. The bacterial cells were then negatively stained with 0.5% ammonium molybdate for 30 s and observed with a transmission electron microscope (Philips CM-12, Portland, OR) operated at 80 kV.

Statistical analyses

A Student’s t-test and paired t-test were used to determine statistical significance of the differences in fimA expression profiles and the adherence competencies of P. gingivalis strains with different genotypes of the fimA gene. A P-value less than 0.05 was considered significant.

RESULTS

Differential expression of different genotype fimA genes in P. gingivalis

To test the differential expression of fimA, seven P. gingivalis strains representing fimA genotypes I to IV were selected from our laboratory collection and tested for their respective fimA expression levels using RT-PCR. The P. gingivalis strains were grown in TSB to reach an optical density of 0.6 at 595 nm. The same set of primers was designed for P. gingivalis 33277 (type I), BH18/10 (type I), OMZ314 (type II), OMZ409 (type II) and 49417 (type III) corresponding the conserved regions of the fimA genes. The fimA gene of P. gingivalis HG564 and W83 (type IV) was amplified using a different set of primers because of a variation in its nucleotide sequence in the conserved regions. RNA preparations and RT-PCR were conducted in parallel under the same conditions. As shown in Fig. 1, different expression levels of fimA were found in these strains, with the significantly higher expression in P. gingivalis strains expressing type I and II. To confirm the differential expression of fimA and to exclude the possibility that the very low expression level of fimA gene in P. gingivalis HG564 and W83 was the result of the low efficiency of the primers, the expression level of fimA relative to that of 16S ribosomal RNA in each tested P. gingivalis strain was examined. The results indicated a similar fimA expression order among these four strains (data not shown). Moreover, previous studies indicated that five genes (pg2130–pg2134) including fimA (pg2132) were under the control of a transcriptional activator, FimR, suggesting that these genes compose a fim locus (Nishikawa et al., 2004). Transcription profiles of the genes in this cluster were compared among four P. gingivalis strains (33277, OMZ409, 49417 and HG564) carrying different FimA genotypes. Consistent with expression level of fimA gene, the mRNA levels of the pg2130, pg2131, pg2133 and pg2134 genes were significantly higher in P. gingivalis 33277 (type I) and OMZ409 (type II) compared with those in 49417 (type III) and HG564 (type IV; Fig. 2).

Figure 1.

Figure 1

Open in a new tab

Differential expression of fimA gene (pg2132) in Porphyromonas gingivalis strains. Strains 33277 (type I), BH18/10 (type I), OMZ314 (type II), OMZ409 (type II), 49417 (type III) and HG564 (type IV) and W83 (type IV) express genotype I, II, III and IV fimA, respectively. Total RNAs were extracted from P. gingivalis grown in trypticase soy broth. Expression of fimA was determined using real time reverse transcription polymerase chain reaction analysis. The transcript level of fimA in an individual strain is indicated relative to the expression level of the gene in P. gingivalis 33277, set = 1.0. Standard errors are indicated (n = 3). Asterisk indicates the statistical significance between P. gingivalis 33277 and the tested strains (P < 0.05; t-test).

Figure 2.

Figure 2

Open in a new tab

Comparison of expression levels of other fim genes in four Porphyromonas gingivalis strains. The transcript levels of genes immediately upstream of fimA, pg2130 and pg2131, and of genes immediately downstream of fimA, pg2133 and pg2134, were determined using quantitative reverse transcription polymerase chain reaction. Expression of these genes in OMZ409, 49417 and HG564 is indicated relative to the expression level of the genes in P. gingivalis 33277, set = 1.0. Standard errors are indicated (n = 3). Asterisk indicates the statistical significance between P. gingivalis 33277 and the tested strains (P < 0.05; t-test).

Expression of major (long) fimbriae in P. gingivalis strains were further examined using a transmission electron microscopy. The P. gingivalis strains with different fimA genotypes showed the different morphological properties of fimbriae (Fig. 3). ATCC 33277 (type I fimA) expressed longer and curly fimbriae, whereas OMZ409 (type II fimA) possessed short and slightly curved sunflower-like fimbriae, which is consistent with the previous descriptions by Kato et al. (2007). The fimbriae of 49417 (type III fimA) and HG564 (type IV fimA) were also short but much sparser than those of 33277 and OMZ409. These observations confirm a differential expression of major fimbriae at both mRNA and protein levels in P. gingivalis strains.

Figure 3.

Figure 3

Open in a new tab

Transmission electron microscopic analysis of Porphyromonasgingivalis fimbriae. The P. gingivalis strains 33277, type I (A); OMZ409, type II (B); 49417, type III (C); and HG564, type IV (D) were prepared by negatively staining with ammonium molybdate. Fimbrial structures were visualized using transmission electron microscopy. Bars 0.1 μm.

Comparative analyses of adherence ability of P. gingivalis strains with different genotypes

To investigate the association of fimA expression and attachment activity of P. gingivalis, the binding abilities of these strains to the saliva-coated surfaces and to an earlier colonizer of dental plaque, S. gordonii DL1, were tested. As expected, the binding abilities of P. gingivalis strains with type I and II FimA were well above those of strains with type III and IV FimA (Fig. 4). Approximately 10% of P. gingivalis 33277 cells (type I) and 5% of OZ409 cells (type II) were able to attach and stay on the saliva-coated and S. gordonii-coated surfaces during a 2-h incubation. In contrast, only 0.01% and 0.002% of 49417 (type III) and HG564 (type IV) cells, respectively, bound to saliva-coated surfaces for this period of time (Fig. 4A). The number of HG564 cells bound to S. gordonii surfaces was only 0.002% (Fig. 4B). These overall results are in agreement with the expression levels of fimA in different P. gingivalis strains and also with previous reports (Hamada et al., 1994; Lin et al., 2006) supporting a critical role of FimA in promoting the attachment of P. gingivalis to various surfaces.

Figure 4.

Figure 4

Open in a new tab

The binding ability of Porphyromonas gingivalis strains to a saliva-coated or Streptococcus gordonii DL1-covered surface. The P. gingivalis cells (6 × 108) were added to polystyrene microtiter wells coated with saliva (A) or S. gordonii (B) for 2 h. After washing, the number of P. gingivalis cells bound on the bottom of the wells was determined using quantitative polymerase chain reaction. Error bars represent standard deviation (n = 3). Comparisons highlighted with an asterisk are significant (P < 0.05; Student’s t-test).

To confirm the different abilities of the various genotypes of FimA, four P. gingivalis mutants, each with a fimA deficiency, were constructed from the four parent strains. The attachment properties of these FimA mutants to saliva-coated and S. gordonii surfaces were examined and compared with those of the parent strains. Binding ability to the saliva surface was abolished in the 33277_ΔfimA mutant and OMZ409_ΔfimA mutant compared with their parent strains (Fig. 5A), whereas 50% of the ability of the HG564_ΔfimA mutant remained compared with its parent strain. Interestingly, a significant difference was not observed in the saliva binding ability when comparing the 49417_ΔfimA mutant and its parent strain, suggesting that type III FimA is not essential for the binding ability.

Figure 5.

Figure 5

Open in a new tab

Impact of fimA mutations on the binding ability of Porphyromonas gingivalis strains. The P. gingivalis cells (6 × 108) were introduced onto the saliva-coated (A) or Streptococcus gordonii (DL1)-covered (B) polystyrene microtiter dishes and incubated for 2 h. The unbound cells were removed by washing with phosphate-buffered saline. The number of P. gingivalis cells left bound on the bottom was determined using quantitative polymerase chain reaction. The ratio of the number of each fimA mutant-containing strain bound to the saliva-coated surface or to an S. gordonii-covered surface to the number of the parent strain bound is presented. An asterisk indicates the statistical significance of binding activity differences between the mutant and the parent strain (P < 0.05; t-test).

All mutant strains did have a significantly lower ability to bind to S. gordonii surfaces compared with their parent strains, suggesting that FimA plays a role in these interactions. However, the extent of that reduced ability varied among the mutants (Fig. 5B). The binding ability of the 49417_ΔfimA mutant to S. gordonii was reduced by only about 25% of that found in the wild-type strain. The reduced binding ability for other three types ranged from 60% to 90%; the 33277_ΔfimA mutant lost the greatest fraction of its binding activity compared with the other mutants. It is noteworthy that the OMZ409_ΔfimA mutant nearly lost its ability to bind to saliva, but maintained 40% of its binding with respect to S. gordonii. Based on the results, we conclude that type I, II, III and IV FimAs contribute, to different degrees, to the interaction between P. gingivalis and S. gordonii.

DISCUSSION

FimA has been recognized as one of the major adhesins displayed on the surface of P. gingivalis strains. The gene coding FimA has been identified in all P. gingivalis strains that were sequenced for this gene (Fujiwara et al., 1993). Although the fimA gene is classified into several genotypes based on their sequences of nucleotides, identical sequences were detected in the promoter region of all genotypes of fimA (Fujiwara et al., 1993). Kato et al. (2007) demonstrated that type II FimA possesses stronger epithelial cell adhesive efficiency than type I FimA. In the present study, we demonstrated differential expression of fimA gene in P. gingivalis strains with different fimA genotypes. Transcription of the fimA gene in P. gingivalis 33277 (type I) was the highest among these seven strains, followed by strains BH18/10 (type II), OMZ314 (type II) and OMZ409 (type II; Fig. 1). As much as a 20-fold decrease in the transcription of fimA was found in HG564 (type IV) in comparison with that of 33277, which is likely to be responsible for the differential ability of these strains to interact with human whole saliva and an earlier colonizer of dental plaque, S. gordonii.

Most of the studies examining the interactions between P. gingivalis and the surfaces of the oral cavity involve P. gingivalis strains with type I FimA, such as 33277 and 381. We compared here the abilities of P. gingivalis strains with different FimA genotypes to bind to saliva-coated and S. gordonii-coated surfaces. A correlation between the FimA expression level and binding activity was observed in most strains, but particularly for those expressing type I and type II FimA. Expression of fimA in P. gingivalis 33277 and OMZ409 was significantly higher than that of the other strains with type III and IV FimA. Accordingly strains with type I and II FimA showed much higher adherence activities, suggesting a critical role of these FimAs in the bacterial adherence to oral surfaces. It is important to note that not all binding activities of P. gingivalis strains were affected by its expression of FimA. Porphyromonas gingivalis 49417 with type III FimA produced significantly less fimA than 33277 and OMZ409, but produced more mRNA of fimA than HG564 (Fig. 1). There was, however, no significant difference in the ability of P. gingivalis 49417 and HG564 to bind to the saliva-coated surfaces (Fig. 3A). This result implies that type III FimA cannot efficiently interact with other salivary molecules in contrast to the other FimA genotypes. This assumption was confirmed by our mutagenesis analysis. In fact, the fimA mutation had no significant effect on the ability of P. gingivalis 49417 to interact with a saliva-coated surface, whereas a fimA deficiency in P. gingivalis 33277, OMZ409 and HG564 resulted in significantly decreased binding of these bacteria to saliva-coated surfaces. These results suggest that binding activity of P. gingivalis depends not only on the level of fimA gene expression, but is also likely to depend on a particular feature of the structure of the FimA protein.

A multimodal model has been proposed to describe P. gingivalis adherence to S. gordonii (Park et al., 2005). Both major (long) and minor (short) fimbriae of P. gingivalis appear to be involved in recognizing and interacting with different surface proteins of S. gordonii. FimA, the subunit protein of major fimbriae, interacts with glyceraldehyde-3-phosphate dehydrogenase, whereas Mfa1, the subunit protein of minor fimbriae, interacts with SspB protein, a member of the streptococcal antigen I/II family (Daep et al., 2008). Based on this model, it is anticipated that a genotype-specific fimA deficiency may only partially suppress the interaction between P. gingivalis and S. gordonii. We indeed found a different net effect of a particular fimA deficiency upon P. gingivalis and S. gordonii interactions, based on the type of FimA involved. Porphyromonas gingivalis 33277 lost 90% of its ability to interact with S. gordonii because of a mutation of its fimA gene (Fig. 5B). In P. gingivalis OMZ409, the mutation in the fimA gene led to complete suppression of the adherence to the saliva-coated surface but had only a 60% negative effect on its adherence to S. gordonii. In P. gingivalis 49417, the mutation had much less of an effect on its interaction with S. gordonii (only ~20% loss), further demonstrating the differential properties of these strains, including their adherence to saliva and S. gordonii. Differences in the regulation of fimA expression in P. gingivalis with different genotypes of FimA and in the adherent properties of these FimA-expressing bacteria may provide a molecular basis for the development of strategies against P. gingivalis colonization in the oral cavity.

Acknowledgments

This work was supported by grants from NIH NCRR 1U54RR026140 and NIH NCRR UL1RR024975.

References

  1. Amano A, Nakagawa I, Kataoka K, Morisaki I, Hamada S. Distribution of Porphyromonas gingivalis strains with fimA genotypes in periodontitis patients. J Clin Microbiol. 1999;37:1426–1430. doi: 10.1128/jcm.37.5.1426-1430.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Beikler T, Peters U, Prajaneh S, Prior K, Ehmke B, Flemmig TF. Prevalence of Porphyromonas gingivalis fimA genotypes in Caucasians. Eur J Oral Sci. 2003;111:390–394. doi: 10.1034/j.1600-0722.2003.00065.x. [DOI] [PubMed] [Google Scholar]
  3. Daep CA, Lamont RJ, Demuth DR. Interaction of Porphyromonas gingivalis with oral streptococci requires a motif that resembles the eukaryotic nuclear receptor box protein-protein interaction domain. Infect Immun. 2008;76:3273–3280. doi: 10.1128/IAI.00366-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Fujise O, Miura M, Hamachi T, Maeda K. Involvement of Porphyromonas gingivalis fimA genotype in treatment outcome following non-surgical periodontal therapy. J Periodontol. 2005;76:1661–1666. doi: 10.1902/jop.2005.76.10.1661. [DOI] [PubMed] [Google Scholar]
  5. Fujiwara T, Morishima S, Takahashi I, Hamada S. Molecular cloning and sequencing of the fimbrilin gene of Porphyromonas gingivalis strains and characterization of recombinant proteins. Biochem Biophys Res Commun. 1993;197:241–247. doi: 10.1006/bbrc.1993.2467. [DOI] [PubMed] [Google Scholar]
  6. Hamada N, Watanabe K, Sasakawa C, Yoshikawa M, Yoshimura F, Umemoto T. Construction and characterization of a fimA mutant of Porphyromonas gingivalis. Infect Immun. 1994;62:1696–1704. doi: 10.1128/iai.62.5.1696-1704.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Kato T, Kawai S, Nakano K, et al. Virulence of Porphyromonas gingivalis is altered by substitution of fimbria gene with different genotype. Cell Microbiol. 2007;9:753–765. doi: 10.1111/j.1462-5822.2006.00825.x. [DOI] [PubMed] [Google Scholar]
  8. Kuboniwa M, Amano A, Inaba H, Hashino E, Shizukuishi S. Homotypic biofilm structure of Porphyromonas gingivalis is affected by FimA type variations. Oral Microbiol Immunol. 2009;24:260–263. doi: 10.1111/j.1399-302X.2009.00511.x. [DOI] [PubMed] [Google Scholar]
  9. Lin X, Wu J, Xie H. Porphyromonas gingivalis minor fimbriae are required for cell-cell interactions. Infect Immun. 2006;74:6011–6015. doi: 10.1128/IAI.00797-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Miura M, Hamachi T, Fujise O, Maeda K. The prevalence and pathogenic differences of Porphyromonas gingivalis fimA genotypes in patients with aggressive periodontitis. J Periodontal Res. 2005;40:147–152. doi: 10.1111/j.1600-0765.2005.00779.x. [DOI] [PubMed] [Google Scholar]
  11. Nakagawa I, Amano A, Ohara-Nemoto Y, et al. Identification of a new variant of fimA gene of Porphyromonas gingivalis and its distribution in adults and disabled populations with periodontitis. J Periodontal Res. 2002;37:425–432. doi: 10.1034/j.1600-0765.2002.01637.x. [DOI] [PubMed] [Google Scholar]
  12. Nakano K, Inaba H, Nomura R, et al. Distribution of Porphyromonas gingivalis fimA genotypes in cardiovascular specimens from Japanese patients. Oral Microbiol Immunol. 2008;23:170–172. doi: 10.1111/j.1399-302X.2007.00406.x. [DOI] [PubMed] [Google Scholar]
  13. Nishikawa K, Yoshimura F, Duncan MJ. A regulation cascade controls expression of Porphyromonas gingivalis fimbriae via the FimR response regulator. Mol Microbiol. 2004;54:546–560. doi: 10.1111/j.1365-2958.2004.04291.x. [DOI] [PubMed] [Google Scholar]
  14. O’Toole GA, Kolter R. Initiation of biofilm formation in Pseudomonas fluorescens WCS365 proceeds via multiple, convergent signalling pathways: a genetic analysis. Mol Microbiol. 1998;28:449–461. doi: 10.1046/j.1365-2958.1998.00797.x. [DOI] [PubMed] [Google Scholar]
  15. Park Y, Simionato MR, Sekiya K, et al. Short fimbriae of Porphyromonas gingivalis and their role in coadhesion with Streptococcus gordonii. Infect Immun. 2005;73:3983–3989. doi: 10.1128/IAI.73.7.3983-3989.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Perez-Chaparro PJ, Rouillon A, Minet J, Lafaurie GI, Bonnaure-Mallet M. fimA genotypes and PFGE profile patterns in Porphyromonas gingivalis isolates from subjects with periodontitis. Oral Microbiol Immunol. 2009;24:423–426. doi: 10.1111/j.1399-302X.2009.00519.x. [DOI] [PubMed] [Google Scholar]
  17. van der Ploeg JR, Giertsen E, Ludin B, Morgeli C, Zinkernagel AS, Gmur R. Quantitative detection of Porphyromonas gingivalis fimA genotypes in dental plaque. FEMS Microbiol Lett. 2004;232:31–37. doi: 10.1016/S0378-1097(04)00064-3. [DOI] [PubMed] [Google Scholar]
  18. Socransky SS, Haffajee AD. Periodontal microbial ecology. Periodontol 2000. 2005;38:135–187. doi: 10.1111/j.1600-0757.2005.00107.x. [DOI] [PubMed] [Google Scholar]
  19. Teixeira SR, Mattarazo F, Feres M, et al. Quantification of Porphyromonas gingivalis and fimA genotypes in smoker chronic periodontitis. J Clin Periodontol. 2009;36:482–487. doi: 10.1111/j.1600-051X.2009.01411.x. [DOI] [PubMed] [Google Scholar]
  20. Umeda JE, Missailidis C, Longo PL, Anzai D, Wikstrom M, Mayer MP. Adhesion and invasion to epithelial cells by fimA genotypes of Porphyromonas gingivalis. Oral Microbiol Immunol. 2006;21:415–419. doi: 10.1111/j.1399-302X.2006.00312.x. [DOI] [PubMed] [Google Scholar]
  21. Wang M, Liang S, Hosur KB, et al. Differential virulence and innate immune interactions of type I and II fimbrial genotypes of Porphyromonas gingivalis. Oral Microbiol Immunol. 2009;24:478–484. doi: 10.1111/j.1399-302X.2009.00545.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Wu J, Lin X, Xie H. OxyR is involved in coordinate regulation of expression of fimA and sod genes in Porphyromonas gingivalis. FEMS Microbiol Lett. 2008;282:188–195. doi: 10.1111/j.1574-6968.2008.01116.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Zhao L, Wu YF, Meng S, Yang H, OuYang YL, Zhou XD. Prevalence of fimA genotypes of Porphyromonas gingivalis and periodontal health status in Chinese adults. J Periodontal Res. 2007;42:511–517. doi: 10.1111/j.1600-0765.2007.00975.x. [DOI] [PubMed] [Google Scholar]

RESOURCES