Abstract
The transcription factor c-Myc plays critical roles in cancer development and progression through regulating expression of targeted genes. Lactate dehydrogenase A (LDHA), which catalyzes the conversion of l-lactate to pyruvate in the final step of anaerobic glycolysis, is frequently upregulated in pancreatic cancer. However, little is known about the effects of c-Myc–LDHA axis in the progression of pancreatic cancer. In this study, we found that c-Myc and LDHA are concomitantly overexpressed in pancreatic cancer cell lines and clinical specimens. c-Myc overexpression and LDHA overexpression were correlated with TNM stage and tumor size and indicated poor prognosis in patients with pancreatic cancer. Knockdown of c-Myc reduced the protein expression of LDHA, lactate production and glucose consumption, and silencing of LDHA mimicked this effect. Meanwhile, reduced c-Myc–LDHA signaling resulted in decreased tumor growth and metastasis in pancreatic cancer. Treatment with 2-Deoxy-d-glucose, an inhibitor of anaerobic glycolysis, completely blocked the oncogenic roles of c-Myc–LDHA signaling. Taken together, dysregulated c-Myc–LDHA signaling plays important roles in aerobic glycolysis and facilitates tumor progression of pancreatic cancer.
Keywords: c-Myc, LDHA, Warburg effect, Tumor progression
Introduction
Pancreatic cancer is one of the most common malignancies worldwide, and its incidence is increasing annually, especially in industrialized countries [1]. Although great achievements have made in early diagnosis, surgical resection and systemic chemotherapy for pancreatic cancer, the overall 5-year survival rate in patients with pancreatic cancer remains at 6 % [2]. The disappointing survival rate and poor prognosis of pancreatic cancer indicate the aggressive nature of this disease. Therefore, it is of great importance to understand the molecular mechanisms that underlie the initiation and progression of pancreatic cancer [3, 4].
c-Myc is a crucial transcription factor involved in the regulation of multiple cellular functions including cell growth, apoptosis, differentiation, protein synthesis, and cell adhesion and energy metabolism [5]. The involvement of c-Myc in such a broad spectrum of cellular functions might be explained by the data that c-Myc binds 10–15 % of all promoter regions [6]. However, the protein encoded by this gene is frequently deregulated in several types of human tumors [7, 8]. Because c-Myc exerts its functions mainly through transcriptional regulation of target genes that associate with tumorigenesis and progression via different mechanisms, c-Myc is therefore an attractive target for cancer therapy [9].
An increase in aerobic glycolysis, which is the ability to switch from an oxidative metabolism to glycolysis and the production of lactate even when oxygen is plentiful (Warburg effect), is a key characteristic of solid tumors, including pancreatic cancer [10]. Because it is closely associated with tumor growth and progression, aerobic glycolysis is considered a metabolic signature for invasive cancer [11]. Lactate dehydrogenase A (LDHA), which catalyzes the last step of anaerobic glycolysis, is abnormally expressed in many human cancers including pancreatic cancer [12], hepatocellular carcinoma [13] and breast cancer [14]. c-Myc can regulate aerobic glycolysis through targeting the metabolic enzymes including HK2, PFKL LDHA, PDK1, etc. [15]. However, the precise role of c-Myc–LDHA axis in aerobic glycolysis and tumor cell phenotype of pancreatic cancer remains unclear.
In this study, we determined the expression pattern and clinical significance of c-Myc–LDHA axis in pancreatic cancer. We found that up-regulated c-Myc–LDHA axis is closely associated with tumor progression and indicates a poor prognosis in pancreatic cancer. Suppression of c-Myc–LDHA axis caused reduced aerobic glycolysis and further contributed to growth arrest and inability of invasion in pancreatic cancer cells.
Materials and methods
Cell culture and reagents
Human pancreatic cancer cells including AsPC-1, BxPC-3, Capan-2, CFPAC-1, HPAC, PANC-1, MiaPaca2 and SW1990 were cultured in specific media supplemented with 10 % (v/v) fetal bovine serum (FBS), 100 U/mL, penicillin and 100 μg/mL streptomycin at 37 °C in a humidified incubator with 5 % CO2. 2-DG (Sigma, USA) was diluted to preferable concentrations in culture medium before use.
Immunohistochemistry
Tissue microarray (TMA) that contained 90 cases of pancreatic cancer tissues used in current study was purchased from Shanghai Outdo Biotech Inc (HPan-Ade180Sur-01). The collection of human specimens was approved by the Medical Institutional Review Boards in Shanghai and in accordance with the highest ethical guidelines. The follow-up time was calculated from the date of surgery to the date of death, or the last known follow-up. The TMA of pancreatic cancer was deparaffinized with xylene and rehydrated using graded ethanol. After washing in phosphate-buffered saline (PBS) for three times, antigen retrieval and neutralization of endogenous peroxidase were performed, followed by incubation with 5 % bovine serum albumin for 1 h. After rinsing with PBS for three times, slides were incubated overnight at 4 °C with primary antibody (c-Myc, Abcam, #32072; LDHA, Proteintech, #19987-1-AP). After washing in PBS for three times, the sections were incubated with HRP-labeled anti-rabbit secondary antibody for 1 h at room temperature. Visualization was performed by 3, 3′-diaminobenzidine tetrahydrochloride (DAB) and counterstained by hematoxylin. Scoring was conducted according to the positive area and the intensity score as follows. The positive area: 0–10 % scored 0; 11–35 % scored 1; 36–70 % scored 2; more than 70 % scored 3 and intensity score: no staining scored 0, weakly staining scored 1, moderately staining scored 2 and strongly staining scored 3. The final score was designated as the score of positive area × intensity score: “−” for a score of 0–1, “+” for a score of 2–3, “++” for a score of 4–6 and “+++” for a score of >6; low expression was defined as a total score <4 and high expression with a total score ≥4. These scores were determined independently by two senior pathologists.
siRNA transfection
The sequence of two siRNAs targeting c-Myc or LDHA was denoted as follows: si-Myc-1 (TACGGAACTCTTGTGCGTAAGC), si-Myc-2 (GCTTCACCAACAGGAACTATGC); si-LDAH-1 (TTGTTGATGTCATCGAAG), si-LDHA-2 (GGGTCCTTGGGGAACATG). The negative control indicated as si-Ctrl was non-homologous to any human genome sequences. The AsPC-1 and SW1990 cells were transfected with 50 nM of siRNA and 5 μl of RNAi-Mate according to the manufacturer’s instructions (GenePharma, Shanghai, China). Cells were cultured for 48 h, and the interference efficiency was detected by western blotting.
Quantitative real-time PCR
Total RNA was isolated from pancreatic cancer cell lines by using the Trizol reagent (Invitrogen) and reverse transcription was performed using the PrimeScript RT-PCR kit (Takara, Japan). The mRNA levels of detected genes were quantified on an ABIPrism-7500 Sequence Detector System (ABI, Applied Biosystems, USA). β-Actin was used as an internal control. Relative expression of c-Myc or LDAH was normalized to the expression of β-actin, which yielded a 2−ΔCt value. The primer sequences were as follows: c-Myc sense 5′-GTCAAGAGGCGAACACACAAC-3′, c-Myc antisense 5′-TTGGACGGACAGGATGTATGC-3′; LDHA sense 5′-ATGGCAACTCTAAAGGATCAGC-3′, LDHA antisense 5′-CCAACCCCAACAACTGTAATCT-3′; β-actin sense 5′-GTTGTCGACGACGAGCG-3′, β-actin antisense 5′-GCACAGAGCCTCGCCTT-3′. All reactions were run in triplicate.
In vitro cell proliferation assay
Cell Counting Kit-8 (CCK8, Dojindo, Japan) assay was used to measure cell proliferation in AsPC-1 and SW1990 cells. Briefly, after transfection with si-Ctrl and targeted siRNAs for 48 h, AsPC-1 and SW1990 cells (3000 per well) were plated in 96-well plates with RPMI1640 containing 10 % FBS. Each sample had four replicates. At the indicated time points, cells were incubated in media containing 10 % CCK8 for 1 h at 37 °C. The absorbance of the solution was read at 490 nm using a Power Wave XS microplate reader (BIO-TEK).
Cell migration and invasion assays
The invasive potential of AsPC-1 and SW1990 cells was measured by transwell model (Corning, USA) according to the manufacturer’s instructions. Briefly, 2 × 104 cells in 100 μl medium were seeded into the upper compartment of the transwell inserts. Importantly, the invasion assay was performed with matrigel-coated filters (BD Bioscience, USA). The lower chambers were filled with 800 μl of RPMI-1640 medium containing 2 % FBS. After the cells were incubated for 16 h in cell migration assay and 40 h in cell invasion assay, the non-invading cells that remained on the upper surface were removed. The migrated and invaded cells were fixed with 4 % paraformaldehyde and stained with 0.1 % crystal violet. The number of invaded cells was counted under a light microscope in six random fields. Each experiment was performed in triplicate.
Measurement of glucose and lactate
Lactate Colorimetric Assay Kit (BioVision) and Glucose Colorimetric Assay Kit (Life technologies) were used according to the manufacturer’s protocols to estimate the intracellular glucose utilization and lactate concentration in pancreatic cancer cells. The glucose utilization or lactate production was estimated using a standard glucose calibration curve prepared under the same condition.
Statistical analysis
Data were presented as the mean ± SD. The SPSS software program (version 17.0; IBM Corporation) was used for statistical analysis, and graphical representations were performed with GraphPad Prism 5 (San Diego, CA) software. The Chi-square test was used to analyze the overall survival rate, and the difference in survival curves was evaluated by the log-rank test. Correlations between c-Myc and LDHA levels in pancreatic cancer were analyzed by Spearman’s rank correlation. All other data were analyzed using two-sided Student’s t test. P values <0.05 were considered statistically significant.
Results
Dysregulated c-Myc–LDHA axis is closely associated with tumor progression and indicates a poor prognosis in pancreatic cancer
To observe the expression pattern of c-Myc–LDHA axis in pancreatic cancer, we first used immunohistochemistry to investigate c-Myc and LDHA protein levels in 90 pancreatic cancer specimens and qRT-PCR to measure c-Myc and LDHA mRNA levels in seven pancreatic cancer cell lines. Immunohistochemical analysis showed that high c-Myc expression and LDHA expression were 65.56 and 70.00 % in tested specimens, respectively (Fig. 1a–d); elevated c-Myc expression and LDHA expression are closely associated with tumor size (P < 0.001) and TNM stage (P < 0.001) (Table 1). Besides, we found a significant positive correlation between mRNA levels of c-Myc and LDHA in pancreatic cancer cell lines (P < 0.001, Fig. 1e). Consistent with qRT-PCR results, there was also significant positive correlation between c-Myc and LDHA in pancreatic cancer specimens (P < 0.001, Fig. 1f). Moreover, we tested the clinical significance of c-Myc and LDHA in patients with pancreatic cancer. Ninety pancreatic cancer patients with clinical follow-ups were analyzed by Kaplan–Meier estimation. The result indicated that tumors with high expression of c-Myc (P = 0.002, Fig. 1g) or LDHA (P = 0.008, Fig. 1h) indeed significantly associated with poor overall survival of pancreatic cancer patients. These findings strongly indicate that c-Myc–LDHA axis plays a critical role in pancreatic cancer development and progression and is a potential valuable predictor for this disease.
Fig. 1.

Dysregulated c-Myc–LDHA axis is closely associated with tumor progression and indicates a poor prognosis in pancreatic cancer. Representative images of high c-Myc expression (a), low c-Myc expression (b), high LDHA expression (c) and low LDHA expression (d) in pancreatic cancer specimens, scale bar: 100 μm. e Correlation between c-Myc and LDHA mRNA expression in pancreatic cancer cell lines. f Immunohistochemical analysis of the correlation between c-Myc and LDHA expression; P value was calculated by the Spearman’s rank correlation test. g Kaplan–Meier survival curves of pancreatic cancer patients according to the status of c-Myc expression. h Kaplan–Meier survival curves of pancreatic cancer patients according to the status of LDHA expression
Table 1.
Correlations between c-Myc or LDHA expression and clinicopathologic features in patients with pancreatic cancer
| Variable | Expression of c-Myc | Expression of LDHA | ||||
|---|---|---|---|---|---|---|
| Low | High | P value | Low | High | P value | |
| Age | ||||||
| ≤60 years | 16 | 26 | 0.495 | 15 | 27 | 0.268 |
| >60 years | 15 | 33 | 12 | 36 | ||
| Gender | ||||||
| Female | 12 | 21 | 0.771 | 11 | 22 | 0.600 |
| Male | 19 | 38 | 16 | 41 | ||
| Tumor size | ||||||
| ≤4 cm | 23 | 29 | 0.013* | 23 | 29 | 0.001** |
| >4 cm | 7 | 30 | 4 | 33 | ||
| Tumor location | ||||||
| Head | 17 | 34 | 1.000 | 15 | 36 | 0.909 |
| Body/tail | 12 | 24 | 11 | 25 | ||
| TNM stage | ||||||
| I | 20 | 20 | 0.005** | 19 | 21 | 0.001** |
| II–III | 10 | 37 | 7 | 40 | ||
| Neuronal invasion | ||||||
| Yes | 11 | 26 | 0.432 | 12 | 25 | 0.674 |
| No | 20 | 33 | 15 | 38 | ||
| Histological grade | ||||||
| I–II | 21 | 36 | 0.357 | 17 | 40 | 0.738 |
| II–IV | 6 | 17 | 6 | 17 | ||
The asterisk represents the P values with significant differences
Effects of c-Myc–LDHA axis on aerobic glycolysis in pancreatic cancer cells in vitro
To demonstrate the effect of c-Myc–LDHA axis on aerobic glycolysis in pancreatic cancer cells, we firstly silenced c-Myc expression in AsPC-1 and SW1990 cells by siRNAs. As shown in Fig. 2a, knockdown of c-Myc resulted in reduced LDHA expression, further confirming the regulation of c-Myc in LDHA expression. And expectedly, suppression of c-Myc also markedly inhibited aerobic glycolysis as demonstrated by decreased glucose utilization (Fig. 2b) and lactate production (Fig. 2c). To determine the implications of c-Myc on aerobic glycolysis mediated by LDHA, glucose utilization and lactate production were further measured after treatment with LDHA siRNAs in AsPC-1 and SW1990 cells (Fig. 2d). Indeed, inhibition of LDHA also resulted in reduced aerobic glycolysis (Fig. 2f, g). Collectively, these results suggest that c-Myc–LDHA axis exhibits a critical role in regulation of aerobic glycolysis in pancreatic cancer.
Fig. 2.

Effects of c-Myc–LDHA axis on aerobic glycolysis in pancreatic cancer cells in vitro. a The protein level of c-Myc and LDHA was detected by western blotting in AsPC-1 and SW1990 cells after c-Myc-specific siRNA treatment. Glucose utilization (b) and lactate production (c) were measured after c-Myc was silenced (si-Ctrl vs. si–c-Myc-1 or si–c-Myc-2; *P < 0.05; **P < 0.01). d The interference efficiency of LDHA was detected by western blotting in AsPC-1 and SW1990 cells. Glucose utilization (e) and lactate production (f) were measured after LDHA was silenced (si-Ctrl vs. si-LDHA-1 or si-LDHA-2; *P < 0.05; **P < 0.01)
Suppression of aerobic glycolysis induced by c-Myc–LDHA axis inhibits tumor growth and progression in pancreatic cancer cells in vitro
Switching to the aerobic glycolysis, also known as Warburg effect, is a key characteristic of cancer metabolism and is not only critical factor for tumor growth but also essential for tumor metastasis [16]. Next, we determined the effects of c-Myc–LDHA axis on tumor growth and progression in AsPC-1 and SW1990 cells. As shown in Fig. 3a, b, knockdown of c-Myc resulted in pronounced decreased cell growth rate in both AsPC-1 and SW1990 cells. Using a Transwell model, we found the ability of cell migration and invasion was also reduced by suppression of c-Myc expression (Fig. 3c, d). Meanwhile, inhibition of LDHA also mimicked the effects of c-Myc on cell proliferation, migration and invasion (Fig. 3e–h). Given that the aerobic glycolysis was significantly reduced by inhibition of c-Myc–LDHA axis, we thereby hypothesized whether c-Myc–LDHA axis functions through regulating the aerobic glycolysis. To test this hypothesis, cellular functions in AsPC-1 and SW1990 cells were measured after treatment with 2-Deoxy-d-glucose (2-DG), a glycolysis inhibitor. The results showed that the disadvantage of tumor growth and progression conferred by inhibition of c-Myc–LDHA axis was completely abolished (Fig. 4a–h). Taken together, these data suggest that decreased aerobic glycolysis accounts for the tumor growth and progression induced by c-Myc–LDHA axis.
Fig. 3.

Suppression of c-Myc–LDHA axis inhibits tumor growth and progression in pancreatic cancer cells in vitro. Cell viability of AsPC-1 cells (a) and SW1990 cells (b) was measured after c-Myc was silenced. Cell migration (c) and invasion (d) abilities were measured after c-Myc was silenced (si-Ctrl vs. si–c-Myc-1 or si–c-Myc-2; *P < 0.05; **P < 0.01; ***P < 0.001). Cell viability of AsPC-1 cells (e) and SW1990 cells (f) were measured after LDHA was silenced. Cell migration (g) and invasion (h) abilities were measured after LDHA was silenced (si-Ctrl vs. si-LDHA-1 or si-LDHA-2; *P < 0.05; **P < 0.01; ***P < 0.001)
Fig. 4.

Treatment with 2-DG blocks the effects of c-Myc–LDHA axis on tumor growth and progression in pancreatic cancer cells in vitro. In the presence of 2-DG, cell viability of AsPC-1 cells (a) and SW1990 cells (b), cell migration (c) and invasion (d) abilities were measured after c-Myc was silenced. In the presence of 2-DG, cell viability of AsPC-1 cells (e) and SW1990 cells (f), cell migration (g) and invasion (h) abilities were measured after LDHA was silenced
Discussion
In the current study, we determined the critical roles of c-Myc–LDHA axis in aerobic glycolysis and its cellular functions in pancreatic cancer. First, we observed that c-Myc and LDHA are concomitantly up-regulated in pancreatic cancer specimens and cell lines, and up-regulated c-Myc expression and LDHA expression lead to poor prognosis in pancreatic cancer patient. Second, suppression of c-Myc resulted in decreased expression of LDHA, reduced aerobic glycolysis, growth arrest and inability of invasion; meanwhile, knockdown of LDHA mimicked this effect. Third, inhibition of aerobic glycolysis abolished the effects of c-Myc–LDHA axis on cell growth and metastasis in vitro. Therefore, our findings demonstrated that c-Myc–LDHA axis contributed to the Warburg effect, thus facilitating tumor development and progression in pancreatic cancer.
Metabolic alternations in cancers not only support energy requirements but also provide enormous biosynthetic needs [17]. c-Myc contributes to the glucose metabolic reprogramming of tumor cells through several different targets [6]. Briefly, through up-regulation of glucose transporters, c-Myc increases the uptake of glucose; by regulation of LDHA and the lactate transporter MCT1, c-Myc promotes the Warburg effect; c-Myc also prevents pyruvate to enter the TCA cycle by regulating pyruvate dehydrogenase (PDK) expression [15]. Consistent with this, c-Myc regulates LDHA expression in pancreatic cancer and suppression of c-Myc significantly inhibited the Warburg effect. In pancreatic cancer, it has been demonstrated that the expression level of LDHA is up-regulated in both clinical specimens and cell lines, and forced expression of LDHA promoted tumor growth and tumorigenicity of pancreatic cancer [18]. Overexpressed LDHA promotes the production of lactate and further contributes to the acidification of tumor microenvironment [19]. A low pH induced by extracellular acidification favors the activation of proteases, including MMPs [20] and urokinase-type plasminogen activator [21], which ultimately result in extracellular matrix degradation and facilitate cancer cells to metastasis [22]. In our study, we found both c-Myc expression and LDHA expression are closely associated with tumor size and TNM stage and indicate poor prognosis in patients with pancreatic cancer. Meanwhile, inhibition of c-Myc–LDHA axis inhibits glucose utilization, lactate production, cell proliferation, migration and invasion. All these can be explained by the favorable tumor microenvironment induced by c-Myc–LDHA axis facilitates tumor progression. However, because c-Myc regulates the expression of multiple targeted genes, it is hard to draw a conclusion that this cell phenotype was mediated by LDHA. And because LDHA expression is also regulated by many other transcription factors including HIF1a [23] and KLF4 [12] in pancreatic cancer, the oncogenic activity of LDHA in Warburg effect and tumor progression also remains to be further analyzed. Despite the presence of these limits, we at least confirmed the oncogenic roles of c-Myc–LDHA axis on tumor progression through enhancing Warburg effect.
In conclusion, our study provided both clinical and mechanistic evidences supporting that c-Myc modulates LDHA expression and that the c-Myc–LDHA axis exhibits a critical role in aerobic glycolysis and tumor progression in pancreatic cancer. Our research identified dysregulated c-Myc–LDHA axis as a promising new molecular target for the design of novel therapeutic to control development and progression of pancreatic cancer.
Conflict of interest
The authors declare that there is no conflict of interests.
Footnotes
Tian-Lin He and Yi-Jie Zhang have contributed equally to this work.
Change history
4/20/2026
This article has been retracted. Please see the Retraction Notice for more detail: 10.1007/s12032-026-03296-5
References
- 1.Siegel R, Naishadham D, Jemal A. Cancer statistics, 2012. CA Cancer J Clin. 2012;62(1):10–29. doi:10.3322/caac.20138. [DOI] [PubMed] [Google Scholar]
- 2.Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D. Global cancer statistics. CA Cancer J Clin. 2011;61(2):69–90. doi:10.3322/caac.20107. [DOI] [PubMed] [Google Scholar]
- 3.Stathis A, Moore MJ. Advanced pancreatic carcinoma: current treatment and future challenges. Nat Rev Clin Oncol. 2010;7(3):163–72. doi:10.1038/nrclinonc.2009.236. [DOI] [PubMed] [Google Scholar]
- 4.Pliarchopoulou K, Pectasides D. Pancreatic cancer: current and future treatment strategies. Cancer Treat Rev. 2009;35(5):431–6. doi:10.1016/j.ctrv.2009.02.005. [DOI] [PubMed] [Google Scholar]
- 5.Dang CV. MYC on the path to cancer. Cell. 2012;149(1):22–35. doi:10.1016/j.cell.2012.03.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Luscher B, Vervoorts J. Regulation of gene transcription by the oncoprotein MYC. Gene. 2012;494(2):145–60. doi:10.1016/j.gene.2011.12.027. [DOI] [PubMed] [Google Scholar]
- 7.Vita M, Henriksson M. The Myc oncoprotein as a therapeutic target for human cancer. Semin Cancer Biol. 2006;16(4):318–30. doi:10.1016/j.semcancer.2006.07.015. [DOI] [PubMed] [Google Scholar]
- 8.Meyer N, Penn LZ. Reflecting on 25 years with MYC. Nat Rev Cancer. 2008;8(12):976–90. doi:10.1038/nrc2231. [DOI] [PubMed] [Google Scholar]
- 9.Prochownik EV, Vogt PK. Therapeutic targeting of Myc. Genes Cancer. 2010;1(6):650–9. doi:10.1177/1947601910377494. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Gatenby RA, Gillies RJ. Why do cancers have high aerobic glycolysis? Nat Rev Cancer. 2004;4(11):891–9. doi:10.1038/nrc1478. [DOI] [PubMed] [Google Scholar]
- 11.Walenta S, Wetterling M, Lehrke M, Schwickert G, Sundfor K, Rofstad EK, et al. High lactate levels predict likelihood of metastases, tumor recurrence, and restricted patient survival in human cervical cancers. Cancer Res. 2000;60(4):916–21. [PubMed] [Google Scholar]
- 12.Shi M, Cui J, Du J, Wei D, Jia Z, Zhang J, et al. A novel KLF4/LDHA signaling pathway regulates aerobic glycolysis in and progression of pancreatic cancer. Clin Cancer Res. 2014;20(16):4370–80. doi:10.1158/1078-0432.CCR-14-0186. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Sheng SL, Liu JJ, Dai YH, Sun XG, Xiong XP, Huang G. Knockdown of lactate dehydrogenase A suppresses tumor growth and metastasis of human hepatocellular carcinoma. FEBS J. 2012;279(20):3898–910. doi:10.1111/j.1742-4658.2012.08748.x. [DOI] [PubMed] [Google Scholar]
- 14.Arseneault R, Chien A, Newington JT, Rappon T, Harris R, Cumming RC. Attenuation of LDHA expression in cancer cells leads to redox-dependent alterations in cytoskeletal structure and cell migration. Cancer Lett. 2013;338(2):255–66. doi:10.1016/j.canlet.2013.03.034. [DOI] [PubMed] [Google Scholar]
- 15.Wahlstrom T, Henriksson MA. Impact of MYC in regulation of tumor cell metabolism. Biochim Biophys Acta. 2015;1849(5):563–9. doi:10.1016/j.bbagrm.2014.07.004. [DOI] [PubMed] [Google Scholar]
- 16.Koppenol WH, Bounds PL, Dang CV. Otto Warburg’s contributions to current concepts of cancer metabolism. Nat Rev Cancer. 2011;11(5):325–37. doi:10.1038/nrc3038. [DOI] [PubMed] [Google Scholar]
- 17.Gillies RJ, Robey I, Gatenby RA. Causes and consequences of increased glucose metabolism of cancers. J Nucl Med. 2008;49(Suppl 2):24S–42S. doi:10.2967/jnumed.107.047258. [DOI] [PubMed] [Google Scholar]
- 18.Rong Y, Wu W, Ni X, Kuang T, Jin D, Wang D, et al. Lactate dehydrogenase A is overexpressed in pancreatic cancer and promotes the growth of pancreatic cancer cells. Tumour Biol. 2013;34(3):1523–30. doi:10.1007/s13277-013-0679-1. [DOI] [PubMed] [Google Scholar]
- 19.Porporato PE, Dhup S, Dadhich RK, Copetti T, Sonveaux P. Anticancer targets in the glycolytic metabolism of tumors: a comprehensive review. Front Pharmacol. 2011;2:49. doi:10.3389/fphar.2011.00049. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Kato Y, Ozawa S, Tsukuda M, Kubota E, Miyazaki K, St-Pierre Y, et al. Acidic extracellular pH increases calcium influx-triggered phospholipase D activity along with acidic sphingomyelinase activation to induce matrix metalloproteinase-9 expression in mouse metastatic melanoma. FEBS J. 2007;274(12):3171–83. doi:10.1111/j.1742-4658.2007.05848.x. [DOI] [PubMed] [Google Scholar]
- 21.Kindzelskii AL, Amhad I, Keller D, Zhou MJ, Haugland RP, Garni-Wagner BA, et al. Pericellular proteolysis by leukocytes and tumor cells on substrates: focal activation and the role of urokinase-type plasminogen activator. Histochem Cell Biol. 2004;121(4):299–310. doi:10.1007/s00418-004-0639-3. [DOI] [PubMed] [Google Scholar]
- 22.Han T, Kang D, Ji D, Wang X, Zhan W, Fu M, et al. How does cancer cell metabolism affect tumor migration and invasion? Cell Adh Migr. 2013;7(5):395–403. doi:10.4161/cam.26345. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Semenza GL. HIF-1: upstream and downstream of cancer metabolism. Curr Opin Genet Dev. 2010;20(1):51–6. doi:10.1016/j.gde.2009.10.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
