Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2015 Jun 3.
Published in final edited form as: Neuron. 2008 Dec 26;60(6):1082–1094. doi: 10.1016/j.neuron.2008.10.045

Role of Glutamate Autoreceptors at Hippocampal Mossy Fiber Synapses

Hyung-Bae Kwon 1,1, Pablo E Castillo 1,*
PMCID: PMC4454280  NIHMSID: NIHMS85021  PMID: 19109913

Abstract

Presynaptic autoreceptors modulate transmitter release at many synapses. At the mossy fiber to CA3 pyramidal cell (mf-CA3) synapse, two types of glutamatergic autoreceptors have been identified; transmitter release is reportedly suppressed by metabotropic glutamate receptors (mGluRs) and augmented by kainate receptors (KARs). However, the net effect of these autoreceptors when activated by endogenous glutamate is unknown. Here, we show that during low-frequency mossy fiber stimulation, glutamate acting through presynaptic mGluRs substantially suppresses transmitter release. However, using similar recording conditions, we find that presynaptic KARs are insufficient to facilitate transmitter release over a wide range of mossy fiber stimulus frequencies, indicating that the uniquely robust mf-CA3 short-term plasticity is KAR-independent. Furthermore, we report that actions generally attributed to presynaptic KARs are likely due to activation of recurrent CA3 network activity. Thus, negative feedback via presynaptic mGluRs is the dominant mode of glutamatergic autoregulation at the mf-CA3 synapse.

INTRODUCTION

At most central synapses, transmitter release can be modulated by various ionotropic and metabotropic presynaptic receptors (Engelman and MacDermott, 2004; Miller, 1998). When terminals express receptors to their own neurotransmitters, an autoregulatory loop is formed that may facilitate (positive feedback) or inhibit (negative feedback) transmitter release, and thereby contribute to activity-dependent forms of short-term plasticity (Zucker and Regehr, 2002). An interesting case is established when both facilitatory and inhibitory autoreceptors are present at the same presynaptic terminal. Can the opposing autoreceptors be differentially activated? How does the presynaptic terminal integrate these opposite signals? Ultimately, what is the net effect of these autoreceptors? A prominent example of the co-expression of opposing presynaptic receptors is the mossy fiber to CA3 pyramidal cell synapse (mf-CA3), a key hippocampal synapse modulated by both facilitatory and inhibitory glutamate autoreceptors (Engelman and MacDermott, 2004; Henze et al., 2000; Nicoll and Schmitz, 2005). The mf-CA3 synapse expresses several remarkable properties that have long attracted interest (Henze et al., 2000; Nicoll and Schmitz, 2005). Mossy fibers display a uniquely robust form of activation-frequency-dependent facilitation of transmitter release that is both massive in magnitude and very unusual in its sensitivity to minor increases in activation frequency above 0.1 Hz (Nicoll and Schmitz, 2005; Salin et al., 1996). The mf-CA3 synapse is also one of the most powerful in the brain, and consequently, mossy fiber input strongly drives CA3 network activity, particularly during short bursts of presynaptic activity (Henze et al., 2002). In addition to the robust low-frequency facilitation, the mf-CA3 synapse expresses presynaptic forms of long-term plasticity that are due to enduring changes in transmitter release (Nicoll and Schmitz, 2005). Glutamate autoreceptors may influence all of these phenomena.

Two types of glutamate autoreceptors have been identified at mossy fiber boutons in rodents: transmitter release is reportedly suppressed by group II/III metabotropic glutamate receptors (mGluRs) and augmented by kainate receptors (KARs). Several studies have shown that pharmacological activation of group II/III mGluRs strongly suppresses glutamate release at mossy fibers (Cotman et al., 1986; Kamiya and Ozawa, 1999; Kamiya et al., 1996; Manzoni et al., 1995; Pelkey et al., 2005; Yamamoto et al., 1983). Endogenous glutamate can also activate presynaptic mGluRs and transiently suppress synaptic transmission (Min et al., 1998; Scanziani et al., 1997; Toth et al., 2000; Vogt and Nicoll, 1999) by a mechanism that likely includes inhibition of presynaptic voltage-gated calcium channels (Kamiya and Ozawa, 1999; Pelkey et al., 2006). The effects of pharmacological activation of KARs depend on dose. Low doses (~50 nM) of kainate (KA) facilitate synaptic transmission (Breustedt and Schmitz, 2004; Contractor et al., 2003; Lauri et al., 2001; Rodriguez-Moreno and Sihra, 2004; Schmitz et al., 2001) (but see Pinheiro et al., 2007); higher doses (≥200 nM) depress synaptic transmission (Contractor et al., 2003; Contractor et al., 2000; Kamiya and Ozawa, 2000; Pinheiro et al., 2007; Schmitz et al., 2000). Like mGluRs, presynaptic KARs at mossy fibers are reportedly activated by endogenous glutamate (Schmitz et al., 2000), and thus contribute to the robust use-dependent facilitation of transmitter release observed during increased presynaptic activity (Contractor et al., 2003; Contractor et al., 2001; Lauri et al., 2001; Lauri et al., 2003; Pinheiro et al., 2007; Schmitz et al., 2003; Schmitz et al., 2001). Additionally, several studies have suggested that presynaptic KARs may facilitate the induction of mf-CA3 long-term potentiation (LTP) (Bortolotto et al., 1999; Contractor et al., 2001; Lauri et al., 2001; Pinheiro et al., 2007; Schmitz et al., 2003). How exactly kainate autoreceptors modulate glutamate release is more controversial and a wide variety of mechanisms have been postulated, including changes in presynaptic calcium influx and the involvement of intermediary biochemical signals (for a recent review see Engelman and MacDermott, 2004; Lerma, 2003; Nicoll and Schmitz, 2005; Pinheiro and Mulle, 2008).

Most studies of mossy fibers autoreceptor regulation have selectively concentrated on the role of either mGluRs or KARs, and were performed under diverse experimental conditions. For these reasons, the results are not easily compared and it is difficult to draw any conclusions about the relative contribution and potential interactions of these autoreceptors. In this study, we sought to determine the involvement of presynaptic mGluRs and KARs to the unique short-term plasticity observed at mf-CA3 synapses. We assessed the efficacy of these autoreceptors to modulate mossy fiber facilitation when activated both pharmacologically and by synaptically released glutamate using physiologically relevant patterns of stimulation. Our results show that negative feedback via presynaptic mGluRs is the dominant form of autoregulation at mf-CA3 synapses. We also provide evidence that several actions generally attributed to presynaptic KARs at mossy fibers are better explained by postsynaptic KAR-mediated activation of the CA3 network.

RESULTS

Relative contribution of mGluRs and KARs in short-term plasticity

A major problem when studying mf-CA3 synaptic transmission is the polysynaptic contamination commonly associated with extracellular stimulation of mossy fibers (Claiborne et al., 1993; Henze et al., 2000; Nicoll and Schmitz, 2005). Repetitive stimulation aggravates this problem as mf-CA3 synapses are potentiated several-fold by immense frequency facilitation (Regehr et al., 1994; Salin et al., 1996), easily triggering action potentials in CA3 pyramidal cells (Henze et al., 2002). Because of the abundant recurrent connections established by these cells (Wittner et al., 2007), synaptic responses mediated by associative-commissural inputs (ac-CA3 synapses) can be easily mistaken as mossy fiber inputs (mf-CA3 synapses) (Claiborne et al., 1993; Henze et al., 2000; Nicoll and Schmitz, 2005). To monitor mf-CA3 monosynaptic responses with minimal polysynaptic contamination (Schmitz et al., 2001; Weisskopf and Nicoll, 1995), we decreased CA3 network excitability by blocking AMPA [α-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid] receptors with the selective antagonist GYKI 53655 [1-(4-aminophenyl)-3-methylcarbamyl-4-methyl-7,8-methylenedioxy-3,4-dihydro-5H-2,3-benzodiazepine] (30 μM) in the recording solution, and monitored the NMDA [N-methyl-D-aspartate] receptor-mediated component of the mossy fiber synaptic response (NMDAR-EPSC) (Vholding = +30 to +40 mV). In some experiments, to reduce excitability even further (Schmitz et al., 2001), we also increased extracellular divalent concentration (4 mM [Ca2+]e, 4 mM [Mg2+]e)(Wigstrom and Gustafsson, 1983). To prevent NMDAR desensitization that might occur during repetitive mossy fiber activation, CA3 pyramidal cells were loaded with 20 mM BAPTA [1,2-bis(o-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid] (Tong et al., 1995).

Initially, we assessed the contribution of presynaptic KARs and mGluRs to low-frequency facilitation (LFF) by inducing facilitation before and after selective pharmacological blockade of each type of receptor. NMDAR-EPSCs were elicited by stimulating mossy fibers at 0.1 Hz in the presence of 30 μM GYKI 53655, 100 μM picrotoxin and 3 μM CGP55845, to block AMPA, GABAA and GABAB receptors, respectively. Stepping stimulation frequency to 0.5 Hz for 2 minutes or 2.0 Hz for 30 seconds induced robust and fully reversible facilitation (Fig. 1). Following KARs blockade with 50 μM NBQX (bath application for at least 10 min, see also Fig. S1A), we reassessed frequency facilitation in the same CA3 pyramidal cell. Unexpectedly, we found that the magnitude of facilitation was identical before and after NBQX application (Fig. 1B; control and NBQX: 0.5 Hz: 258 ± 27% and 265 ± 29%, n = 8, p>0.5; 2 Hz: 620 ± 73% and 636 ± 96%, n = 7, p>0.5). In all recordings, bath application of 1 μM DCG-IV [2S,2'R,3'R-2-(2',3'-dicarboxycyclopropyl)glycine] at the end of experiment reduced synaptic transmission by more than 95%, thereby confirming that NMDAR-EPSCs were mf-CA3 EPSCs with minimal ac-CA3 contamination.

Figure 1.

Figure 1

Open in a new tab

Comparison of KAR and mGluR2/3 contribution to low-frequency facilitation (LFF) at hippocampal mossy fiber synapses. (A) Representative experiment in which frequency facilitation of mf-CA3 NMDAR-EPSCs was elicited by stepping the rate of stimulation from 0.1 to 0.5 Hz for 2 minutes and from 0.1 to 2.0 Hz for 30 seconds before and after bath application of 50 μM NBQX. DCG-IV (1 μM) was added at the end of all experiments. Averaged sample traces taken at times indicated by numbers are shown above. (B) Summary graph of several experiments as in (A) showing that LFF remains unchanged following KAR blockade by 50 μM NBQX. (C) Similar to the experiment shown in (A), LFF was elicited before and after bath application of 3 μM LY341495 in the same cell. (D) Summary graph showing that mGluR2/3 blockade significantly increased facilitation at both 0.5 and 2 Hz stimulation frequency.

We next assessed the role of presynaptic group II mGluRs (mGluR2/3) in LFF. Previous studies have addressed this question by using non-selective mGluR antagonists such as MCPG [(+)α-methyl-4-carboxyphenylglycine] (Min et al., 1998; Scanziani et al., 1997; Toth et al., 2000; Vogt and Nicoll, 1999), or the weak mGluR2/3 selective antagonist/partial agonist MCCG [(2S,3S,4S)-2-methyl-2-(carboxycyclopropyl)glycine] (Scanziani et al., 1997; Vogt and Nicoll, 1999). Instead, we used the mGluR antagonist LY341495 [2S-2-amino-2-(1S,2S-2-carboxycycloprop-1-yl)-3-(xanth-9-yl) propanoic acid] at a dose (3 μM) that is highly selective for mGluR2/3 (Kingston et al., 1998). Using a similar experimental approach as shown in Fig. 1A, we tested LFF before and after LY341495 bath application (Fig. 1C). These experiments were performed in 100 μM picrotoxin, 3 μM CGP55845, and with 50 μM NBQX replacing GYKI 53655 (to reduce any potential influence of KARs). Bath application of LY341495 did not affect basal synaptic transmission (105 ± 3% of baseline, n = 7, p>0.2, data not shown) but significantly increased LFF (Fig. 1D; 0.5 Hz step, control: 225 ± 21%; LY341495: 283 ± 24%, n = 7, p<0.005; 2 Hz step, control: 564 ± 44%; LY341495: 928 ± 68%, n = 7, p<0.001). Consistent with previous reports (Kobayashi et al., 1996; Scanziani et al., 1997; Toth et al., 2000; Vogt and Nicoll, 1999), these observations indicate that when mossy fiber activity is low, glutamate release is probably below threshold for presynaptic mGluR2/3 activation, but as activity increases, endogenous glutamate inhibits its own release via presynaptic mGluR2/3s. To uncover a potential role of presynaptic KARs without presynaptic mGluR2/3s, we performed similar experiments as shown in Fig. 1A,B but in the presence of LY341495 and found that LFF at mf-CA3 synapses remain unchanged following KAR blockade with NBQX (0.5 Hz step, control: 273 ± 29%; NBQX: 264 ± 30%, n = 5, p>0.5; 2 Hz step, control: 898 ± 86%; NBQX: 914 ± 99%, n = 5, p>0.5; data not shown).

We also looked for a potential role of KARs and mGluR2/3s in modulating release when mossy fibers are stimulated with higher frequency pairs of bursts. Previous studies have reported that presynaptic KARs significantly contribute to the robust mf-CA3 paired-pulse facilitation (PPF) of AMPAR-mediated responses in particular at ~40 ms inter-stimulus intervals (ISI) (Contractor et al., 2001; but see Mulle et al., 1998). We then examined mf-CA3 PPF at a 40 ms ISI in the same CA3 pyramidal cell before and after KARs blockade. Surprisingly, 50 μM NBQX did not affect the magnitude of mf-CA3 PPF (Fig. 2A; control: 244 ± 10%; NBQX: 248 ± 10%, n = 7, p>0.5). In a separate group of cells, we found that 3 μM LY341495 did not affect mf-CA3 PPF either (Fig. 2A, control: 245 ± 17%; LY341495: 248 ± 16%, n = 7, p>0.5). The paired-pulse protocol assumes that glutamate released by the first stimulation is sufficient to bind to autoreceptors and modulate transmitter release by the second stimulation. However, the glutamate released by the first stimulation may be insufficient to effectively engage presynaptic autoreceptors, either because not enough glutamate is released, or the released glutamate is rapidly cleared from the synapse. Longer trains of stimuli may be required to promote extracellular accumulation of glutamate, so we increased the number of stimuli and activated mossy fibers with bursts of 5 pulses at 25 Hz, a stimulating protocol previously used to effectively engage presynaptic KARs and mGluR2/3s at mf-CA3 synapses (Lauri et al., 2001; Schmitz et al., 2001; Vogt and Nicoll, 1999). We compared the magnitude of facilitation, as measured by the ratio of the 5th to the 1st NMDAR-EPSC (P5/P1) in the same CA3 pyramidal cell before and after 50 μM NBQX or 3 μM LY341495. Although the magnitude of NMDAR-EPSCs was greatly enhanced during a brief burst, the P5/P1 ratio remained unchanged following blockade of KARs (Fig. 2B; control: 795 ± 80%; NBQX: 709 ± 87%, n=7, p>0.1), or mGluR2/3s (Fig. 2B; control 729 ± 153%; LY341495: 698 ± 129%, n = 9, p>0.5). It is worth noting that although blocking KARs with NBQX did not affect the ratio P5/P1, it did reduce the charge transfer of the burst by 12 ± 4% (p=0.011). This effect likely reflects the contribution of postsynaptic KARs, which are typically activated by repetitive stimulation of mossy fibers (Castillo et al., 1997; Vignes and Collingridge, 1997) (see below). Finally, we verified that in our experiments NBQX and LY341495 were indeed blocking KARs and mGluR2/3s, respectively. We found that 50 μM NBQX abolished KAR-EPSCs recorded in CA3 pyramidal cells by stimulating mossy fibers (Castillo et al., 1997; Vignes and Collingridge, 1997) (Fig. S1A; maximal peak amplitude, 4 ± 1% of baseline, n = 14), and 3 μM LY341495 completely rescued mossy fiber synaptic transmission in DCG-IV (1 μM) treated slices (Fig. S1B; n = 4).

Figure 2.

Figure 2

Open in a new tab

Assessing the role of KARs and mGluRs in mf-CA3 paired-pulse facilitation (PPF) and the facilitation induced bursts of mossy fiber stimulation. (A) Left, superimposed NMDAR-EPSCs recorded from the same CA3 pyramidal cell at 40 ms inter-stimulus interval before and after NBQX or LY 341495 bath application. PPF responses are shown after subtraction of the first NMDAR-EPSC. Right, summary bar graphs showing no change in PPF after KAR- and mGluR2/3 blockade. (B) Blockade of KAR- or mGluR2/3 does not affect mf-CA3 synaptic facilitation induced by a 25 Hz burst of 5 stimuli. Left, sample traces before and after NBQX or LY 341495. Right, summary graph of facilitation ratio (P5/P1). (C) Superimposed representative responses (averaged traces) at 5 Hz, and 10 Hz, before and after co-application of LY341495 and MSOP. (D) Summary plot showing the amount of change in facilitation following mGluR blockade at various mossy fiber stimulation frequencies. The number of experiments for each stimulation frequency is shown between brackets. (**) indicates p<0.01, (***) indicates p<0.001.

Group III mGluRs are also expressed at mossy fiber terminals (Shigemoto et al., 1997), and their activation reduces synaptic transmission by a presynaptic mechanism (Pelkey et al., 2005; Pelkey et al., 2006). It is therefore possible that these receptors may also contribute to mossy fiber short-term plasticity. To test this possibility we first confirmed that bath application of the group III mGluR agonist L-AP4 (L-(+)-2-Amino-4-phosphonobutyric acid) (20 μM) depressed mf-CA3 NMDAR-EPSCs (71.0 ± 8.2% of baseline, n=4, P<0.05), and that this effect was fully reversed by the group III mGluR antagonist MSOP ((RS)-α-Methylserine-O-phosphate) (200 μM) (Fig. S1C). We then assessed the magnitude of mf-CA3 facilitation before and after applying both 3 μM LY341495 and 200 μM MSOP. We found that co-application of LY341495 and MSOP increased LFF (0.5 Hz step, control: 258 ± 15%; LY+MSOP: 291 ± 25%, n = 8, p<0.001; 2 Hz step, control 577 ± 51%; LY+MSOP:843 ± 62%, n = 8, p<0.001, data not shown) to a level similar than LY341495 alone (see Fig. 1), whereas PPF and facilitation with a short burst of activity (5 stimuli, 25 Hz) remained unchanged (PPF, Control: 250 ± 12%; LY+MSOP: 254 ± 17%, n = 9, p>0.5; P5/P1 ratio, control: 739 ± 58%; LY+MSOP: 749 ± 68%, n = 6, p>0.5, data not shown). These results suggest that group II mGluRs are the main autoreceptors inhibiting glutamate release at mf-CA3 synapses. Finally, to determine the dynamic range of the mGluR-mediated negative feedback, we examined various stimulation frequencies (see methods). As shown in Fig. 2C,D, this negative feedback occurs at a relatively narrow frequency band (i.e. 0.5–5 Hz), and peaks at ~2 Hz.

Taken together, our results show two main points regarding the relative contribution of presynaptic KARs and mGluR2/3s at mf-CA3 synapses. First, commonly used forms of short-term plasticity (PPF, LFF and facilitation with short bursts of activity) are unaffected following pharmacological blockade of KARs. This observation suggests that presynaptic KARs at mossy fibers may play a minor role in increasing glutamate release, at least when using physiologically relevant protocols of stimulation. Second, endogenous glutamate suppresses its own release mainly by activating presynaptic mGluR2/3s (Min et al., 1998; Scanziani et al., 1997; Toth et al., 2000; Vogt and Nicoll, 1999), but this action seems to be relevant at a narrow low-frequency window of presynaptic activity (0.5 ~ 5 Hz).

All abovementioned experiments were performed at 25 °C. Because presynaptic KARs and mGluRs could contribute differently at a physiological temperature, we reexamined mf-CA3 short-term plasticity (PPF, LFF, and facilitation with short bursts of activity), before and after KAR and mGluR pharmacological blockade, while recording at 35°C. At this recording temperature, we found that short-term plasticity remained unchanged after KAR blockade (Fig. S2A). Blocking mGluRs also increased LFF (0.5 and 2.0 Hz) (Fig. S2B), but the magnitude of this change was slightly reduced, presumably reflecting an increase in the efficacy of glutamate transporters at a more physiological temperature (Bergles and Jahr, 1998).

Exogenous activation of KARs by kainate

Given our inability to demonstrate any evidence of presynaptic KAR activation by endogenous glutamate (Figs. 1,2), we next examined whether exogenous activation of these receptors by kainate (KA) could modulate mf-CA3 synaptic transmission. We found that bath application of 50 nM KA, a dose that reportedly enhances mf-CA3 synaptic responses (Breustedt and Schmitz, 2004; Contractor et al., 2003; Lauri et al., 2001; Rodriguez-Moreno and Sihra, 2004; Schmitz et al., 2001), had no effect on the amplitude of NMDAR-EPSCs recorded in 30 μM GYKI 53655 and 100 μM picrotoxin (Fig. 3A; 102 ± 4% of baseline, n = 7, p>0.5). KA bath application drastically increases spontaneous firing of inhibitory interneurons (Bureau et al., 1999; Cossart et al., 1998; Frerking et al., 1998). It is therefore possible that activation of presynaptic GABABRs by endogenous GABA might have prevented the facilitation of mf-CA3 glutamate release mediated by presynaptic KARs. Likewise, KA bath application might have indirectly increased glutamate tone, which, by activating presynaptic mGluR2/3s on mossy fiber terminals, may have counterbalanced the facilitatory effects of presynaptic KARs. To exclude these possibilities, in a separate set of experiments we included 3 μM CGP55845 and 3 μM LY341495 in the bath to block GABABR and mGluR2/3, respectively. Even under these recording conditions, 50 nM KA bath application did not affect NMDAR-EPSCs (Fig. 3B; 109 ± 6% of baseline, n = 6, p>0.1). As previously reported by others (Contractor et al., 2003; Contractor et al., 2000; Kamiya and Ozawa, 2000; Schmitz et al., 2000), increasing the dose of KA to 500 nM, suppressed synaptic transmission (Fig. 3B; 36 ± 5% of baseline, n = 5, p<0.0001), while an intermediate dose of 200 nM produced a smaller effect (Fig. 3B; 75 ± 6% of baseline, n = 4, p<0.01). In conclusion, unlike previous studies (Breustedt and Schmitz, 2004; Contractor et al., 2003; Lauri et al., 2001; Rodriguez-Moreno and Sihra, 2004; Schmitz et al., 2001) (but see Pinheiro et al., 2007), our results suggest that exogenous activation of KARs also does not facilitate mf-CA3 synaptic transmission.

Figure 3.

Figure 3

Open in a new tab

Effects of exogenous application of kainate (KA) on mf-CA3 synaptic transmission. (A) Summary graph showing that bath application of a low concentration of KA (50 nM) has no effect on mf-CA3 synaptic transmission. Insets: averaged sample traces taken at times indicated by numbers. DCG-IV blocked synaptic transmission indicating that the responses were elicited by mossy fiber stimulation. (B) Left, summary plot showing the time course of the KA-mediated effects on mf-CA3 transmission; center, representative traces before (thin line) and during (thick line) KA bath application; right, bar graph showing that KA depresses mf-CA3 synaptic transmission in a dose-dependent manner.

Mossy fiber frequency facilitation in 2 mM extracellular Ca2+

It has been suggested that KAR-mediated enhancement of glutamate release is only observed at relatively low extracellular Ca2+ concentration (e.g. 2 mM but not 4 mM [Ca2+]e) (Lauri et al., 2003), though this observation is not fully supported by several others studies (Contractor et al., 2000; Schmitz et al., 2000; Schmitz et al., 2001). Because our initial experiments were performed in 4 mM [Ca2+]e, we repeated them in lower [Ca2+]e. In 2 mM [Ca2+]e/2 mM [Mg2+]e, we found that the magnitude of LFF was unaffected following blockade of KARs with 50 μM NBQX (Fig. 4A; control: 270 ± 27%; NBQX: 282 ± 30%, n = 5, p>0.1). In addition, we tested brief bursts (5 pulses, 25 Hz) in 2 mM [Ca2+]e/2 mM [Mg2+]e. Because lowering the concentration of divalent cations increases CA3 network excitability (Castillo et al., 2002; Schmitz et al., 2001) and recruits polysynaptic activity particularly during the burst itself (see below), we also examined the effects of NBQX on test pulses delivered 1.5 s after the last pulse in the burst. Even after 1.5 s, we expect extracellular glutamate to remain elevated since bursts such as these have been reported to activate presynaptic KARs for few seconds (Lauri et al., 2001; Schmitz et al., 2001). We found that while the magnitude of facilitation was slightly increased in 2 mM [Ca2+]e/2 mM [Mg2+]e (for comparison, see Fig. 2B), both P5/P1 and Ptest/P1 ratios remained unchanged by NBQX (Fig. 4B; P5/P1 control: 1215 ± 81%, P5/P1; NBQX: 1088 ± 99%, n = 5, p>0.1; Ptest/P1 control: 390 ± 33%, Ptest/P1 NBQX: 375 ± 43%, n = 5, p>0.5). These results show that blockade of KARs does not affect mossy fiber facilitation even in 2 mM [Ca2+]e.

Figure 4.

Figure 4

Open in a new tab

KAR contribution to mossy fiber short-term plasticity is independent of extracellular Ca2+ concentration and the GluR5 subunit. (A, B) Similar experiments as shown in Fig. 1A and 2B were performed in 2 mM [Ca2+]e/2 mM [Mg2+]e. DCG-IV (1 μM) was applied at the end of each experiment. (A) LFF (0.1→0.5 Hz) was tested before and after application of NBQX. Sample traces and summary bar graphs are shown on the right and left side, respectively. (B) In these experiments, a brief burst of mossy fiber stimulation (5 stimuli, 25 Hz) was followed by a test stimulation 1.5 s after the last stimulus in the train. Representative traces are shown above and summary graphs of facilitation ratio (P5/P1 and Ptest/P1) are shown below. (C, D) Similar experiments as shown in (a) and (b) but using the GluR5-selective antagonist UBP302 (10 μM). (E) Sample records showing that ATPA (1 μM) induced massive increase of sIPSC frequency and this ATPA-induced effect was abolished by 10 μM UBP302. sIPSCs were recorded from a CA1 pyramidal cell in the presence of 30 μM GYKI 53655, 25 μM D-APV. (F) Summary graph of sIPSC frequency change. UBP302 completely inhibited ATPA-induced effect.

Mossy fiber short-term plasticity is independent of GluR5/6/7-containing KARs

It could be argued that while NBQX is a good antagonist for postsynaptic KARs (Fig. 3C), it may not be as effective for presynaptic KARs. Although the subunit composition of presynaptic KARs is rather controversial (Lerma, 2003), some studies have suggested an important role for the GluR5 subunit (Bortolotto et al., 1999; Bortolotto et al., 2003; Lauri et al., 2001; Lauri et al., 2003). To examine the contribution of GluR5-containing KARs, we used the potent antagonist UBP302 (More et al., 2004) and monitored mossy fiber NMDAR-EPSCs in 2 mM [Ca2+]e. We found that bath application of 10 μM UBP302 for ~15 min did not affect the magnitude of LFF (Fig. 4C; control: 274 ± 40%; UBP302: 270 ± 41%, n = 3, p>0.5) or the facilitation produced by brief bursts of mossy fiber activity (Fig. 4D; P5/P1 control: 1004 ± 122%; P5/P1 UBP302: 1055 ± 146%, n = 5, p>0.5; Ptest/P1 control: 338% ± 52 %; Ptest/P1 UBP302: 337 ± 72%, n = 5, p>0.5). Since UBP302 had no effect, we verified that it penetrates our slices and has antagonistic activity by testing its ability to block the selective GluR5-containing KAR agonist ATPA. As previously reported (Cossart et al., 1998), bath application of ATPA (1 μM) produced a robust enhancement of spontaneous inhibitory postsynaptic currents (sIPSCs) in CA1 pyramidal cells (Fig. 4E) that was fully reversible upon washout. A second ATPA application in the continuous presence of 10 μM UBP302 (bath applied 10 min before ATPA) had no effect on sIPSC activity (Fig. 4F; ATPA, 633 ± 148%; UBP302, 118 ± 7%; n = 3). Together, these results support the notion that GluR5-containing KARs do not facilitate glutamate release from mossy fibers.

Previous reports have also suggested that GluR6-containing presynaptic KARs play a critical role in mossy fiber short-term plasticity (Breustedt and Schmitz, 2004; Contractor et al., 2001; Schmitz et al., 2003) and more recently, GluR7-containing receptors have also been implicated (Pinheiro et al., 2007). We reassessed the contribution of GluR6-and GluR7-containing presynaptic KARs to mf-CA3 short-term plasticity by using knockout mice for each one of these subunits. PPF of mossy fiber AMPAR-EPSCs, in particular at ~40 ms ISI, has been reported to be reduced in GluR6 (Contractor et al., 2001; but see Mulle et al., 1998) and GluR7 (Pinheiro et al., 2007) knockout mice. In contrast, when we monitored mossy fiber NMDAR-EPSCs at a similar ISI, PPF in GluR6 and GluR7 knockout mice was no smaller than in littermate wildtype animals (Fig. 5A; GluR6+/+: 278 ± 13%, 10 cells, 6 animals; GluR6−/−: 301 ± 28%, 8 cells, 5 animals, p>0.2; Fig. 5D; GluR7+/+: 277 ± 15%, 8 cells, 3 animals; GluR7−/−: 278 ± 19%, 10 cells, 3 animals, p>0.5). In addition, LFF was identical in wildtype and knockout mice (Fig. 5B; GluR6+/+: 419 ± 26%, n = 9 cells, 5 animals; GluR6−/−: 412 ± 26%, n = 10 cells, 5 animals, p>0.5; Fig. 5E; GluR7+/+: 445 ± 34%, 7 cells, 3 animals; GluR7−/−: 414 ± 45%, 7 cells, 3 animals, p>0.5). We also tested mossy fiber bursts of 5 pulses at 25 Hz and found no significant difference in the P5/P1 ratio between wildtype and knockout animals (Fig. 5C; GluR6+/+: 856 ± 65%, n = 7 cells, 5 animals; GluR6−/−: 807 ± 49%, 8 cells, 5 animals, p>0.1; Fig. 5F; GluR7+/+: 857 ± 64%, 9 cells, 3 animals; GluR7−/−: 842 ± 62%, 7 cells, 3 animals, p>0.5). Finally, the contribution of presynaptic GluR7-containing KARs in regulating glutamate release at mf-CA3 synapses was recently analyzed by monitoring AMPAR-EPSCs while delivering mossy fiber minimal stimulation (Pinheiro et al., 2007). Using this experimental approach (Fig. S3), we confirmed that both mf-CA3 failure rate and short-term plasticity are unchanged in these mice (Fig. S3B; GluR7+/+: 0.1 Hz: 0.53 ± 0.04, 0.5 Hz: 0.20 ± 0.04, 7 cells, 3 animals, P<0.0001; GluR7−/−: 0.1 Hz: 0.52 ± 0.08, 0.5 Hz: 0.20 ± 0.05, 4 cells, 2 animals, P<0.005; Fig. S3C; LFF: GluR7+/+: 572 ± 69%, n = 8 cells, 4 animals; GluR7−/−: 575 ± 51%, 9 cells, 3 animals, p>0.5; PPF: GluR7+/+: 579 ± 74%, n = 6 cells, 4 animals; GluR7−/−: 574 ± 38%, 9 cells, 3 animals, p>0.5). In addition, a recent study has reported that GluR7-containing KARs are highly sensitive to GYKI 53655 (Perrais et al., 2008), raising the possibility that the contribution of these receptors to mossy fiber short-term plasticity could have gone undetected in our experiments because these receptors under basal conditions were already blocked by 30 μM GYKI 53655. To test this possibility, we monitored LFF in 3 μM GYKI 53655, a concentration that should only inhibit AMPARs but not GluR7-containing receptors (Perrais et al., 2008). We first confirm that such a low dose of GYKI 53655 strongly suppress AMPAR-mediated transmission in our hippocampal slices as indicated by a reduction in the amplitude of extracellular excitatory field potentials monitored in the CA1 area (22.6 ± 2.0% of baseline, n = 4 slices, data not shown). Importantly, increasing the concentration of GYKI 53655 from 3 to 60 μM, or adding 50 μM NBQX did not reveal any change in the magnitude of LFF (Fig. S4; LFF before and after 60 μM GYKI: 439 ± 50% and 487 ± 64%, n = 5 cells, p>0.1; LFF before and after 50 μM NBQX: 451 ± 54% and 499 ± 71%, n = 5 cells, p>0.5). Taken together, our findings strongly argue against presynaptic GluR6- or GluR7-containing KARs playing a significant role in mossy fiber short-term plasticity.

Figure 5.

Figure 5

Open in a new tab

Normal short-term plasticity in GluR6−/− and GluR7−/− mice. (A,D) (Left) Representative PPF of NMDAR-EPSCs from GluR6−/−, GluR7−/− and their littermate wildtype control mice. The second NMDAR-EPSC is shown after subtraction of the first response. Mossy fibers were stimulated at 40 ms inter-stimulus interval. (Right) Summary plot of PPF in GluR6+/+/GluR6−/− (A) and GluR7+/+/GluR7−/− mice (D). (B,E) (Left) Superimposed traces from representative experiments in which stimulation frequency was increased from 0.1 Hz to 0.5 Hz. (Right) Summary plot of LFF in GluR6+/+ and GluR6−/− (B) and GluR7+/+ and GluR7−/− mice (E). (C,F) (Left) Sample traces from representative experiments in which 5 stimuli were given repetitively at 25 Hz every 30 s. (Right) Summary graph of the facilitation ratio (P5 / P1). DCG-IV (1 μM) was applied at the end of all these experiments.

Overestimation of mf-CA3 short-term plasticity by activation of the CA3 network

We sought to identify why, in contrast to several other studies (Bortolotto et al., 1999; Bortolotto et al., 2003; Breustedt and Schmitz, 2004; Contractor et al., 2001; Lauri et al., 2001; Lauri et al., 2003; More et al., 2004; Pinheiro et al., 2007; Schmitz et al., 2001), we could not find any evidence for a facilitatory role presynaptic KARs. Most of these earlier studies monitored AMPAR-mediated synaptic transmission while blocking inhibition. Given that these experimental conditions leave recurrent collateral inputs intact, and render the CA3 network hyperexcitable, we hypothesized that polysynaptic contamination could explain, at least in part, this apparent discrepancy with our results. If so, manipulations suppressing CA3 network excitability should also reduce the magnitude of synaptic facilitation observed when monitoring AMPAR-EPSCs. When we pharmacologically isolated AMPAR-EPSCs with 50 μM D-APV, 100 μM picrotoxin and 3 μM CGP55845 (Vholding = −70 mV), consistent with previous work (Langdon et al., 1993), mf-CA3 AMPAR-EPSCs typically displayed a slow 20–80% rise-time and multiple asynchronous peaks (Fig. 6A,B), suggesting polysynaptic contamination as previously reported by some studies (Claiborne et al., 1993; Henze et al., 2000). We then decreased global excitability either by reducing voltage-gated sodium channel function with a low concentration of TTX (30–100 nM) or by partially blocking AMPARs with a low concentration of GYKI 53655 (3 μM). Both TTX and GYKI 53655 not only reduced synaptic transmission by ~75% (data not shown), but also abolished the asynchronous peaks and reduced the AMPAR-EPSCs rise-time (Fig. 6A; control: 4.08 ± 0.73 ms; TTX: 1.32 ± 0.74 ms, n = 5, p<0.05; Fig. 6B, control: 3.84 ± 0.99 ms; GYKI 53655: 1.28 ± 0.10 ms, n = 5, p<0.05). Under control conditions (i.e. without TTX or GYKI 53655), mf-CA3 PPF, LFF, and facilitation with short burst of presynaptic activity (5 stimuli, 25 Hz) were significantly more robust when monitoring AMPAR-EPSCs (Fig. 6C–H, control) than NMDAR-EPSCs (cf. Figs. 1,2). Notably, decreasing CA3 network excitability with low doses of TTX or GYKI 53655 markedly decreased the magnitude of facilitation of AMPAR-EPSCs, bringing it to a level similar to that observed while monitoring NMDAR-EPSCs in high concentration (30 μM) GYKI 53655 (PPF, Fig. 6C; control: 516 ± 37%; TTX: 254 ± 26%, n = 5, p<0.001; Fig. 6D; control: 520 ± 49%; GYKI 53655: 250 ± 38%, n = 5, p<0.01; LFF, Fig. 6E; control: 423 ± 43%; TTX: 241 ± 18%, n = 5, p<0.02; Fig. 6F; control: 418 ± 31%; GYKI 53655: 240 ± 15%, n = 5, p<0.02; facilitation with a short burst of activity, Fig. 6G; control: 1511 ± 154%; TTX: 895 ± 51%, n = 6, p<0.01; Fig. 6H; control: 1330 ± 140%, GYKI 53655: 773 ± 49%, n = 5, p<0.005). In contrast, low doses of TTX (30–100 nM) did not affect PPF or LFF of mf-CA3 NMDAR-EPSCs monitored in 30 μM GYKI 53655, a recording condition that strongly reduces CA3 network excitability (PPF control: 239 ± 19%; TTX: 245 ± 18%, n = 5, p>0.5; LFF control: 242 ± 12%; TTX: 273 ± 22%, n = 6, p>0.1; facilitation with a short burst of activity control: 722 ± 76%; TTX: 781 ± 82%, n = 6, p>0.5 data not shown). This observation suggests that a low concentration of TTX does not reduce mossy fiber short-term plasticity per se, but rather reduces the polysynaptic activity that otherwise artificially increases these values. Finally, we assessed mf-CA3 short-term plasticity by monitoring KAR-EPSCs (in 30 μM GYKI 53655, 100 μM picrotoxin, 50 μM D-APV) and found that PPF and LFF were not significantly different from what we reported earlier in recordings of NMDAR-EPSCs (KAR-EPSCs: PPF at 40 ms inter-stimulus interval: 240 ± 11%, n = 11; LFF 0.1 to 0.5 Hz: 270 ± 15%, n = 13, data not shown). Taken together, our results suggest that mossy fiber AMPAR-mediated synaptic responses, especially under recording conditions that increase CA3 network excitability (e.g. blocking inhibition), may overestimate the actual magnitude of mf-CA3 short-term facilitation.

Figure 6.

Figure 6

Open in a new tab

Activation of the CA3 network may result in an overestimation of mossy fiber facilitation. (A,B) Superimposed AMPAR-EPSCs (single traces) before (control) and after bath application of 30 nM TTX (A) or 3 μM GYKI 53655 (B). Multiple peaks were observed in individual traces under control conditions. These peaks virtually disappeared after 30–40 min TTX or GYKI 53655 applications. Right, summary graphs showing a robust reduction in the AMPAR-EPSC rise time in low concentrations of TTX and GYKI 53655. Note that the rise time became faster after reducing excitability. (C–H) Effect of low doses of TTX and GYKI 53655 on the magnitude of mossy fiber PPF (C,D) and low-frequency facilitation (E,F), and facilitation with a short burst of activity (G,H) assessed by monitoring AMPAR-EPSCs. Averaged sample traces and summary graphs are shown on the left and right side of each panel (C–H), respectively.

We next explored whether the reduction of mf-CA3 short-term facilitation following KAR blockade or in GluR6 knockout mice previously reported by other groups (Breustedt and Schmitz, 2004; Contractor et al., 2001; Schmitz et al., 2003; Schmitz et al., 2001) could actually arise, at least in part, from a decrease in network excitability mediated by postsynaptic KARs. Using sharp-microelectrode recordings from CA3 pyramidal cells, we found that a short burst of mossy fiber stimulation (5 stimuli, 25 Hz) triggered KAR-EPSPs that were large enough to trigger postsynaptic spiking (Fig. 7A) (membrane resting potential −60 ± 2 mV, action potential amplitude 78 ± 2 mV, n = 5). Subsequent bath application of the AMPAR/KAR antagonist NBQX abolished both KAR-EPSPs and the associated action potentials (Fig. 7B). Similar results were obtained while monitoring action potentials extracellularly in the CA3 cell body layer (Fig. 7C–E). Bath application of NBQX (50 μM) reduced the average number of action potentials per burst from 5.4 ± 1.2 to 0.6 ± 0.4 (Fig. 7F; n = 5 slices; p<0.001). We also found that stepping the rate of stimulation from 0.1 to 0.5 Hz for 2 minutes clearly increased the number of action potential per trial (Fig. 7G–H; 0.1 Hz: 1.1 ± 0.3, 0.5 Hz: 8.4 ± 2.2, n = 5, p<0.01) and this increase was abolished by subsequent bath application of 50 μM NBQX (0.1 Hz: 0.7 ± 0.3; 0.5 Hz: 2.2 ± 0.9, n = 5, p>0.1). These results show that postsynaptic KARs can contribute to the overall excitability of the CA3 network and quite possibly affect the measurement of synaptic facilitation.

Figure 7.

Figure 7

Open in a new tab

KAR-mediated synaptic transmission can drive CA3 pyramidal cell firing. (A) Superimposed KAR-EPSPs (10 individual responses) evoked by a brief burst (5 stimuli, 25 Hz) every 30 s. Action potentials were typically triggered on the fourth or fifth responses during bursts. (B) Averaged traces showing the blockade of KAR-EPSPs and action potentials by 50 μM NBQX. (C,D) Extracellular recordings from the CA3 pyramidal cell layer before (C) and after NBQX (D). 15 responses evoked by mossy fiber stimulation (5 stimuli, 25 Hz) are superimposed in each panel. (E) Average number of action potentials (APs) in GYKI 53655 and after NBQX. (F) Time course of total number of action potentials per burst before and after KAR blockade by NBQX. (G–H) Extracellular recordings in the CA3 pyramidal cell layer showing changes of action potential number during LFF. 3 traces at each frequency are superimposed (G) and total number of action potentials is plotted as a function of time (H). All experiments in this figure were performed in the presence of 30 μM GYKI 53655, 25 μM D-APV, and 100 μM picrotoxin.

If postsynaptic KARs, by increasing network excitability, contribute to overestimate the role of presynaptic KARs, then, decreasing excitability or removing postsynaptic KARs while monitoring AMPAR-mediated synaptic transmission should reduce the magnitude of mf-CA3 facilitation. Such manipulations should also reduce the effects of exogenous applications of low doses of KA known to increase mf-CA3 synaptic transmission (Breustedt and Schmitz, 2004; Contractor et al., 2003; Lauri et al., 2001; Schmitz et al., 2000; Schmitz et al., 2001) (but see Pinheiro et al., 2007). In fact, we found that 100 nM KA increases mf-CA3 AMPAR-EPSCs as previously shown by others (Breustedt and Schmitz, 2004; Contractor et al., 2003; Lauri et al., 2001; Schmitz et al., 2000; Schmitz et al., 2001). However, this effect was abolished by reducing the CA3 network excitability with a low dose of TTX (Fig. S5; control 118 ± 5.8% of baseline, n = 5, p<0.05; 30 nM TTX 95 ± 2.7% of baseline, n = 5, p>0.1). Consistent with the idea that GluR6-containing KARs can mediate polysynaptic transmission (Fig 7), we found that the rise time of mf-CA3 AMPAR-EPSCs is significantly faster in GluR6 knockout mice (GluR6+/+: 3.08 ± 0.68 ms, 7 cells, 4 animals; GluR6−/−: 1.08 ± 0.13 ms, 8 cells, 4 animals, p<0.01, figure not shown). Furthermore, as previously reported (Breustedt and Schmitz, 2004; Contractor et al., 2001), we confirm that the magnitude of mf-CA3 AMPAR-EPSCs facilitation is significantly reduced in GluR6−/− mice (Fig. 8A–C;PPF, GluR6+/+: 530 ± 49%, 7 cells, 4 animals; GluR6−/−: 318 ± 23%, 6 cells, 3 animals, p<0.005; LFF, GluR6+/+: 625 ± 66%, 6 cells, 3 animals; GluR6−/−: 391 ± 32%, 6 cells, 3 animals, p<0.01; facilitation with a short burst of activity, GluR6+/+: 1331 ± 126%, 6 cells, 4 animals; GluR6−/−: 888 ± 45%, 8 cells, 4 animals, p<0.005). However, this phenotype is no longer observed when AMPAR-EPSCs were recorded in the presence of low doses of TTX (Fig. 8D–F;PPF, GluR6−/−: 304 ± 22%; TTX: 313 ± 35%, 6 cells, 3 animals, p>0.5; LFF, GluR6−/−: 390 ± 30%; TTX: 381 ± 24%, 8 cells, 3 animals, p>0.5; facilitation with a short burst of activity, GluR6−/−: 873 ± 59%; TTX: 920 ± 74%, 6 cells, 3 animals, p>0.5). Taken together, these findings strongly suggest that polysynaptic contamination, mainly due to the activation of postsynaptic, GluR6-containing KARs in CA3 pyramidal cells may have contributed to overestimating the role of presynaptic KARs in previous studies assessing AMPAR-EPSCs.

Figure 8.

Figure 8

Open in a new tab

KAR-mediated network excitability is reduced in GluR6−/− animals. (A–C) Comparison of PPF (A), LFF (B), and facilitation with a short burst of activity (C) by monitoring AMPAR-EPSCs between GluR6−/− and littermate GluR6+/+ mice. (D–F) Magnitude of facilitation after further reduction of network excitability with low concentration of TTX in GluR6−/− mice. Averaged sample traces and summary graphs are shown on the left and right side of each panel (A–F), respectively.

DISCUSSION

In this study, we examined the relative contribution of two glutamate autoreceptors, mGluR and KAR, in mf-CA3 short-term plasticity. We show that protocols of mossy fiber repetitive activity known to release enough glutamate to activate presynaptic mGluRs and depress transmitter release (Figs. 1,2) are insufficient to facilitate mf-CA3 synaptic transmission via presynaptic KARs. We therefore conclude that a negative feedback via presynaptic mGluRs is the dominant autoregulatory effect at mf-CA3 synapses, at least at moderate frequencies of presynaptic activity typically observed in vivo (Henze et al., 2002; Jung and McNaughton, 1993).

Negative feed-back via presynaptic mGluR2/3

Using selective antagonists for group II and group III mGluRs, we show that group II mGluRs (i.e. mGluR2/3) are the main autoreceptors inhibiting glutamate release at mf-CA3 synapses. While a role for mGluRs as mediators of negative feedback at mf-CA3 synapses has been previously established (Min et al., 1998; Scanziani et al., 1997; Vogt and Nicoll, 1999), little was known about the precise pattern of presynaptic activity required for the activation of these autoreceptors. We demonstrate that afferent activity as low as 0.5 Hz is sufficient to activate presynaptic mGluR2/3, and the magnitude of the negative-feedback increases at slightly higher frequencies (e.g. 2 Hz). We also confirm previous observations that presynaptic mGluR2/3 are silent at low frequencies of afferent activity (≥0.1 Hz) (Scanziani et al., 1997; Toth et al., 2000). Interestingly, blockade of mGluR2/3 had less effect at higher frequencies of mossy fiber activity (≥10 Hz). A potential explanation for this observation is that the buildup of presynaptic Ca2+ at higher frequencies (Regehr et al., 1994) may overcome the mGluR2/3-mediated inhibition of presynaptic voltage-gated Ca2+ channels (Kamiya and Ozawa, 1999). In this context, it is worth noting that dentate granule cells (which give rise to mossy fibers) in vivo typically fire at low-frequency (<0.5 Hz), and this basal activity is interrupted by brief high-frequency bursts (~40 Hz) when the animal enters the cell's place field (Jung and McNaughton, 1993). The negative-feedback mediated by mGluR2/3 may contribute to sharpen the information transfer timing during transitions between basal activity and high-frequency bursts.

Presynaptic KARs and mossy fiber short-term plasticity

The most unexpected finding of our study is that KA autoreceptors seem to play a minor role, if any, in facilitating glutamate release at mf-CA3 synapses. Our study then clearly contradicts previous reports by several groups showing that activation of presynaptic KARs regulate glutamate release at these synapses (Contractor et al., 2003; Contractor et al., 2001; Lauri et al., 2001; Lauri et al., 2003; Pinheiro et al., 2007; Schmitz et al., 2003; Schmitz et al., 2001). Different recording conditions may underlie this apparent discrepancy. While we monitored mf-CA3 NMDAR-EPSCs under conditions of reduced network excitability (i.e., AMPAR blockade, high divalents), previous reports studying KARs at mossy fibers have typically monitored AMPAR-mediated synaptic responses, including blockade of inhibitory synaptic transmission in several cases, a condition known to increase network excitability in CA3. We do not claim that all studies monitoring AMPAR-mediated responses at mf-CA3 synapses are plagued with polysynaptic contamination. However, recording AMPAR-EPSCs in CA3 under inhibitory blockade are well-known conditions for promoting runaway excitability, in particular given the abundant CA3-CA3 pyramidal cell connections (Wittner et al., 2007), the blockade of powerful feed-forward inhibition that normally controls the CA3 network (Lawrence and McBain, 2003), and the relatively high efficacy of mf-CA3 synapses in driving CA3 pyramidal cell firing (particularly during brief repetitive stimulation) (Henze et al., 2000; Nicoll and Schmitz, 2005). Indeed, using low doses of TTX or GYKI 53655, two manipulations that reduce CA3 network excitability by different mechanisms, we show that a significant component of mf-CA3 AMPAR-EPSC facilitation is likely due to polysynaptic contamination. The smaller facilitation we observed under conditions of low excitability (Fig. 6) is reminiscent of the magnitude of mossy fiber facilitation observed when performing pre/post cell-pair recordings (Alle and Geiger, 2006; Mori et al., 2004), which clearly circumvents the error introduced by polysynaptic contamination. Furthermore, we provide evidence that postsynaptic KARs (Castillo et al., 1997; Vignes and Collingridge, 1997) can drive CA3 pyramidal cell firing, thereby recruiting associational/commissural inputs that can be easily interpreted as mossy fiber inputs. In this context, it is worth noting that activation of postsynaptic KARs can increase neuronal excitability by inhibiting the postspike slow afterhyperpolarization (sAHP) (Melyan et al., 2002). This is a potential additional mechanism by which pharmacological blockade of postsynaptic KARs could reduce CA3 network excitability. In conclusion, it is likely that some of the effects commonly ascribed to presynaptic KARs could actually be mediated by postsynaptic KARs driving CA3 cell firing and subsequent associational/commissural synaptic transmission.

Intriguingly, our findings differ from those by Schmitz et al. who also monitored mf-CA3 NMDAR-EPSCs and found a reduction of mossy fiber synaptic facilitation following blockade of KARs (Schmitz et al., 2001). At this time, the reasons for these contradicting results are unclear. However, while we used the more selective AMPAR/KAR antagonist NBQX in all our experiments, they mainly used CNQX, an antagonist that is known to interfere with NMDAR-mediated responses (Lester et al., 1989) and consequently, a partial blockade of NMDARs could have affected the interpretation of the results. In addition, we found a significant contribution of postsynaptic KAR to the overall synaptic response induced by a burst of mossy fiber stimulation (Fig. S6), whereas Schmitz et al. reported that this component was negligible (Schmitz et al., 2001), suggesting that the relative contribution of mossy fiber synapses may be slightly different between these studies.

One could argue that our protocols of stimulation did not release enough glutamate to activate presynaptic KARs. Against this notion, we found that several of these protocols release enough glutamate from mossy fibers sufficient to activate presynaptic mGluRs (e.g. low-frequency stimulation with 0.5 and 5.0 Hz) and postsynaptic KARs (e.g. 5 stimuli, 25 Hz). In addition, in agreement with a recent report (Pinheiro et al., 2007), we found that exogenous activation of KAR with a low dose of KA (50 nM), which reportedly facilitates transmitter release from mossy fiber terminals (Breustedt and Schmitz, 2004; Contractor et al., 2003; Lauri et al., 2001; Rodriguez-Moreno and Sihra, 2004; Schmitz et al., 2001), had no effect, whereas a higher doses of KA (200 and 500 nM) depressed synaptic transmission as expected (Contractor et al., 2003; Contractor et al., 2000; Kamiya and Ozawa, 2000; Pinheiro et al., 2007; Schmitz et al., 2000). As previously suggested, the effect induced by high doses of KA argues for the functional presence of presynaptic KARs at the mossy fiber synapse (Kamiya and Ozawa, 2000). It remains to be seen whether synaptically released glutamate from mossy fibers can activate these autoreceptors to suppress transmitter release.

Unsolved issues regarding presynaptic kainate receptors

While previous studies have postulated a role for presynaptic KARs in mossy fiber short-term and long-term plasticity, several important issues, most notably the subunit composition and the mechanism of action of KA autoreceptors, remain unclear. In addition, despite a recent anatomical report showing KARs at mossy fiber boutons (Darstein et al., 2003), direct evidence for functional presynaptic KARs at synaptic terminals -i.e., by recording from mossy fiber boutons- is lacking. Using a pharmacological approach, some studies have reported that GluR5 is the critical subunit of presynaptic KARs at mossy fibers (Bortolotto et al., 1999; Bortolotto et al., 2003; Lauri et al., 2001; Lauri et al., 2003; More et al., 2004). In contrast, consistent with the low GluR5 mRNA expression levels in dentate granule cells that give rise to mossy fibers (Bureau et al., 1999; Wisden and Seeburg, 1993), other studies using a combination of pharmacological and genetic approaches could not demonstrate any role for GluR5-containing KARs at mf-CA3 synapses, but rather reported that presynaptic KARs containing the GluR6 or GluR7 subunit play a critical role in facilitating glutamate release from mossy fibers (Breustedt and Schmitz, 2004; Contractor et al., 2001; Pinheiro et al., 2007; Schmitz et al., 2003). Notably, in those studies claiming a role for presynaptic GluR6-containing receptors, mossy fiber synaptic transmission was typically assessed by monitoring AMPAR-mediated responses and therefore (see above), some contribution of postsynaptic KARs (Castillo et al., 1997; Vignes and Collingridge, 1997), which contain the GluR6 subunit (Mulle et al., 1998), is expected.

The mechanism by which KARs facilitate glutamate release at mf-CA3 synapses is also unclear but it may include depolarization of the presynaptic terminal (Kamiya et al., 2002) and a direct KAR-dependent increase in presynaptic calcium (Lauri et al., 2003). Lauri et al (2003) suggested that presynaptic KARs at mossy fibers are Ca2+ permeable and that Ca2+ influx through these receptors facilitates glutamate release by recruiting intracellular Ca2+ stores. However, thus far, there is no direct evidence that presynaptic KARs are Ca2+ permeable and furthermore, a potential role for presynaptic Ca2+ stores in mf-CA3 synaptic facilitation could not be confirmed by another group (Breustedt and Schmitz, 2004). Lauri et al. (2003) also reported that the presynaptic Ca2+-dependent mechanism can be bypassed when [Ca2+]e is raised (e.g. from 2 mM to 4 mM) (Lauri et al., 2003), an observation that we were unable to confirm (Fig. 4A,B). Against Lauri et al's findings, several studies have reported a role for presynaptic KARs even at relatively high [Ca2+]e (Contractor et al., 2000; Schmitz et al., 2000; Schmitz et al., 2001).

Conclusions

To what are all these conflicting findings due? While a clear answer does not emerge at this point, our findings support the idea that minor differences in the experimental conditions between laboratories may be sufficient to explain most inconsistencies. In any case, our findings show that short-term plasticity at mf-CA3 synapses remains unchanged after pharmacological blockade or genetic removal of (presynaptic) KARs. Thus, the mechanism underlying the unique robustness of mossy fiber short-term plasticity is independent of KA autoreceptors. Furthermore, group II mGluR are the dominant autoreceptor depressing mCA3 synaptic transmission, albeit in a narrow frequency window.

METHODS

Slice preparation

Hippocampal slices were prepared from Wistar rats (16–25 days old) and C57BL mice (18–32 days old). All experiments were carried out in accordance with the National Institutes of Health guide for the care and use of laboratory animals. Animals were deeply anesthetized with isoflurane, decapitated, and the brain was rapidly removed. Transverse slices (400 μm) were cut on a vibratome (Dosaka, Kyoto, Japan) in ice-cold cutting solution containing (in mM) 238 sucrose, 2.5 KCl, 10 glucose, 25 NaHCO3, 1.25 NaH2PO4, 2.5 CaCl2, and 1.3 MgCl2. The cutting solution was slowly exchanged to the artificial cerebrospinal fluid (ACSF) containing (in mM) 124 NaCl, 2.5 KCl, 10 glucose, 25 NaHCO3, 1.25 NaH2PO4, 2.5 CaCl2, and 1.3 MgCl2. Both cutting and ACSF solution were saturated with 95% O2 and 5% CO2 (pH 7.4). The slices were incubated at room temperature for at least 1.5 hour before recording.

Electrophysiology

The slices were transferred to a recording chamber and were perfused with ACSF (2 ml/min) in which Ca2+ and Mg2+ extracellular concentrations were increased to 4 mM unless otherwise stated. All recordings were done at room temperature otherwise indicated. For voltage clamp recordings, the recording electrode was filled with an internal solution containing (in mM) 123 cesium gluconate, 8 NaCl, 1 CaCl2, 10 EGTA, 10 HEPES, 10 glucose (pH 7.3, 290–295 mOsm), and the recording pipette resistance ranged between 3–4 MΩ. For the experiments using a BAPTA (20 mM) containing internal solution, CaCl2 and EGTA were excluded and the concentration of cesium gluconate was reduced to compensate for osmolarity. 5 mM QX-314 was added to the internal solution when AMPAR-EPSCs were recorded. Series resistance (6–15 MΩ) was monitored during the whole experiments, and those experiments where there was more than 10 % change in series resistance were not included for analysis. For current clamp recording, sharp microelectrodes were filled with 3 M KCl and had resistances of 80–150 MΩ. Patch pipettes were pulled on a PP-830 Narishige vertical puller, whereas microelectrodes were pulled on a Flaming/Brown micropipette puller (P-97, Sutter Instrument). For extracellular field potential recordings, a recording patch-type pipette was filled with 1 M NaCl, and located in the CA3 pyramidal cell layer.

EPSCs were recorded in CA3 pyramidal cells in the hippocampus, and evoked by monopolar stimulation with a patch-type pipette widened (~5 μm tip size) and filled with ACSF. The stimulation pipettes were placed in the inner border of dentate granule cell layer. For AMPAR-EPSCs, cells were voltage-clamped at −70mV, and recordings were performed in the presence of picrotoxin (100 μM), CGP 55845 (3 μM) and D-APV (50 μM). Rise time was calculated as the duration of 20–80% of the EPSC peak amplitude. For KAR-EPSCs, cells were voltage-clamped at ~ −60 mV, and recordings were performed in the presence of picrotoxin (100 μM), CGP 55845 (3 μM), GYKI 53655 (30 μM) and D-APV (50 μM). NMDAR-EPSCs were isolated by applying picrotoxin (100 μM), CGP 55845 (3 μM) and GYKI 53655 (30 μM) or NBQX (50 μM), and voltages of cells were held at +30 mV to + 40 mV. Spontaneous IPSCs were recorded in CA1 pyramidal neurons voltage clamped at +10 mV in the presence of GYKI 53655 (30 μM) and D-APV (25 μM).

The baseline stimulation frequency for all experiments was 0.1 Hz, except for burst stimulation that was given every 30 s (5 stimuli, 25 Hz) or every 2 minutes (10 stimuli, 5 Hz and 10 Hz). Facilitation ratio was estimated by comparing an average size of the synaptic responses 3–5 min before increasing frequency to the mean size of at least 20 consecutive individual traces at the peak. To assess facilitation with bursts of 5 and 10 Hz, ten stimuli were delivered and the ratio of the 10th to the 1st NMDAR-EPSC (P10/P1) was measured. In the burst experiments, the magnitude of the last response was measured by subtracting the trace obtained with N-1 responses (being N the total number of pulses in the burst). Averaged traces include at least 15 successive synaptic responses. For measuring spontaneous IPSCs, external ACSF perfusion rate was sped up to two fold (4 ml/min) only when ATPA was applied to the bath. In all experiments examining mossy fiber input, DCG-IV (1–1.5 μM) was applied at the end of the experiments and data were included only when the inhibition was more than 90%. Mossy fiber responses were measured after subtraction of the remaining responses after DCG-IV application.

Data analysis and drugs

All experiments were executed with a MultiClamp 700B (Axon Instruments Inc., Union City, CA). Data were analyzed online using IgorPro (Wavemetrics Inc., Lake Oswego, OR). All values are shown as mean ± SEM. Student's t-test was used for testing statistical significance. NBQX, D-APV, picrotoxin, LY 341495, CGP 55845, DCG-IV, QX-314, GYKI 53655, ATPA, L-AP4, MSOP and UBP302 were obtained from Tocris-Cookson. All other chemicals and drugs were purchased from Sigma-Aldrich.

GluR6 −/− and GluR7 −/− mice

GluR6+/− (heterozygous) mice were purchased from The Jackson Laboratory (strain name: B6.129S1-Grik2tm1Sfh/J). Genotyping was performed by PCR using tail DNA. The primers used are following: oIMR0013, 5'-CTTGGGTGGAGAGGCTATTC -3'; oIMR0014, 5'- AGGTGAGATGACAGGAGATC -3'; oIMR0884, 5'- CAAAGCTTAGTTAACTGATATACAG -3'; oIMR0885, 5'-TTATGGTTACATGCACAGAGGC -3'. The PCR products were observed as 493 bp (wildtype), 280 bp (knockout) and both fragments (heterozygous). We confirmed the phenotype of GluR6 knockout mice by analyzing KAR-EPSCs and, as previously reported(Mulle et al., 1998), we found that these synaptic responses were indeed abolished in knockout animals. GluR7+/− (heterozygous) mice were kindly provided by Dr. S.F. Heinemann (Salk Institute) and the GluR7−/− genotype also confirmed by PCR from tail DNA using the following primers: G75, 5'- CTTGCTGGTGCACATGG -3', G76a, 5'-TGTGGCTCAGGGAGAC -3', Neo, 5'- GAGTAGAAGGTGGCGCG -3'. Examples for the results of genotyping GluR6 and GluR7 litters are shown in Fig. S7. All data were obtained from wildtype and knockout littermates from heterozygous mating.

Supplementary Material

01

Acknowledgments

We thank Reed Carroll and members of the Castillo laboratory for their constructive comments on the manuscript. We are grateful to Stephen Heinemann for providing GluR7+/− animals for us to breed them. We also thank Hunki Paek (Jean Hebert's laboratory, Dept. Neuroscience, Albert Einstein College of Medicine) for helping us with mouse genotyping. This work was supported by the US National Institutes of Health/NIMH, NIDA (P.E.C.), and the Pew Biomedical Program.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

REFERENCES

  1. Alle H, Geiger JR. Combined analog and action potential coding in hippocampal mossy fibers. Science. 2006;311:1290–1293. doi: 10.1126/science.1119055. [DOI] [PubMed] [Google Scholar]
  2. Bergles DE, Jahr CE. Glial contribution to glutamate uptake at Schaffer collateral-commissural synapses in the hippocampus. J Neurosci. 1998;18:7709–7716. doi: 10.1523/JNEUROSCI.18-19-07709.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bortolotto ZA, Clarke VR, Delany CM, Parry MC, Smolders I, Vignes M, Ho KH, Miu P, Brinton BT, Fantaske R, et al. Kainate receptors are involved in synaptic plasticity. Nature. 1999;402:297–301. doi: 10.1038/46290. [DOI] [PubMed] [Google Scholar]
  4. Bortolotto ZA, Lauri S, Isaac JT, Collingridge GL. Kainate receptors and the induction of mossy fibre long-term potentiation. Philos Trans R Soc Lond B Biol Sci. 2003;358:657–666. doi: 10.1098/rstb.2002.1216. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Breustedt J, Schmitz D. Assessing the role of GLUK5 and GLUK6 at hippocampal Mossy fiber synapses. J Neurosci. 2004;24:10093–10098. doi: 10.1523/JNEUROSCI.3078-04.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bureau I, Bischoff S, Heinemann SF, Mulle C. Kainate receptor-mediated responses in the CA1 field of wild-type and GluR6-deficient mice. J Neurosci. 1999;19:653–663. doi: 10.1523/JNEUROSCI.19-02-00653.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Castillo PE, Malenka RC, Nicoll RA. Kainate receptors mediate a slow postsynaptic current in hippocampal CA3 neurons. Nature. 1997;388:182–186. doi: 10.1038/40645. [DOI] [PubMed] [Google Scholar]
  8. Castillo PE, Schoch S, Schmitz F, Sudhof TC, Malenka RC. RIM1alpha is required for presynaptic long-term potentiation. Nature. 2002;415:327–330. doi: 10.1038/415327a. [DOI] [PubMed] [Google Scholar]
  9. Claiborne BJ, Xiang Z, Brown TH. Hippocampal circuitry complicates analysis of long-term potentiation in mossy fiber synapses. Hippocampus. 1993;3:115–121. doi: 10.1002/hipo.450030202. [DOI] [PubMed] [Google Scholar]
  10. Contractor A, Sailer AW, Darstein M, Maron C, Xu J, Swanson GT, Heinemann SF. Loss of kainate receptor-mediated heterosynaptic facilitation of mossy-fiber synapses in KA2−/− mice. J Neurosci. 2003;23:422–429. doi: 10.1523/JNEUROSCI.23-02-00422.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Contractor A, Swanson G, Heinemann SF. Kainate receptors are involved in short- and long-term plasticity at mossy fiber synapses in the hippocampus. Neuron. 2001;29:209–216. doi: 10.1016/s0896-6273(01)00191-x. [DOI] [PubMed] [Google Scholar]
  12. Contractor A, Swanson GT, Sailer A, O'Gorman S, Heinemann SF. Identification of the kainate receptor subunits underlying modulation of excitatory synaptic transmission in the CA3 region of the hippocampus. J Neurosci. 2000;20:8269–8278. doi: 10.1523/JNEUROSCI.20-22-08269.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Cossart R, Esclapez M, Hirsch JC, Bernard C, Ben-Ari Y. GluR5 kainate receptor activation in interneurons increases tonic inhibition of pyramidal cells. Nat Neurosci. 1998;1:470–478. doi: 10.1038/2185. [DOI] [PubMed] [Google Scholar]
  14. Cotman CW, Flatman JA, Ganong AH, Perkins MN. Effects of excitatory amino acid antagonists on evoked and spontaneous excitatory potentials in guinea-pig hippocampus. J Physiol. 1986;378:403–415. doi: 10.1113/jphysiol.1986.sp016227. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Darstein M, Petralia RS, Swanson GT, Wenthold RJ, Heinemann SF. Distribution of kainate receptor subunits at hippocampal mossy fiber synapses. J Neurosci. 2003;23:8013–8019. doi: 10.1523/JNEUROSCI.23-22-08013.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Engelman HS, MacDermott AB. Presynaptic ionotropic receptors and control of transmitter release. Nat Rev Neurosci. 2004;5:135–145. doi: 10.1038/nrn1297. [DOI] [PubMed] [Google Scholar]
  17. Frerking M, Malenka RC, Nicoll RA. Synaptic activation of kainate receptors on hippocampal interneurons. Nat Neurosci. 1998;1:479–486. doi: 10.1038/2194. [DOI] [PubMed] [Google Scholar]
  18. Henze DA, Urban NN, Barrionuevo G. The multifarious hippocampal mossy fiber pathway: a review. Neuroscience. 2000;98:407–427. doi: 10.1016/s0306-4522(00)00146-9. [DOI] [PubMed] [Google Scholar]
  19. Henze DA, Wittner L, Buzsaki G. Single granule cells reliably discharge targets in the hippocampal CA3 network in vivo. Nat Neurosci. 2002;5:790–795. doi: 10.1038/nn887. [DOI] [PubMed] [Google Scholar]
  20. Jung MW, McNaughton BL. Spatial selectivity of unit activity in the hippocampal granular layer. Hippocampus. 1993;3:165–182. doi: 10.1002/hipo.450030209. [DOI] [PubMed] [Google Scholar]
  21. Kamiya H, Ozawa S. Dual mechanism for presynaptic modulation by axonal metabotropic glutamate receptor at the mouse mossy fibre-CA3 synapse. J Physiol. 1999;518(Pt 2):497–506. doi: 10.1111/j.1469-7793.1999.0497p.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Kamiya H, Ozawa S. Kainate receptor-mediated presynaptic inhibition at the mouse hippocampal mossy fibre synapse. J Physiol. 2000;523(Pt 3):653–665. doi: 10.1111/j.1469-7793.2000.t01-1-00653.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Kamiya H, Ozawa S, Manabe T. Kainate receptor-dependent short-term plasticity of presynaptic Ca2+ influx at the hippocampal mossy fiber synapses. J Neurosci. 2002;22:9237–9243. doi: 10.1523/JNEUROSCI.22-21-09237.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Kamiya H, Shinozaki H, Yamamoto C. Activation of metabotropic glutamate receptor type 2/3 suppresses transmission at rat hippocampal mossy fibre synapses. J Physiol. 1996;493(Pt 2):447–455. doi: 10.1113/jphysiol.1996.sp021395. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Kingston AE, Ornstein PL, Wright RA, Johnson BG, Mayne NG, Burnett JP, Belagaje R, Wu S, Schoepp DD. LY341495 is a nanomolar potent and selective antagonist of group II metabotropic glutamate receptors. Neuropharmacology. 1998;37:1–12. doi: 10.1016/s0028-3908(97)00191-3. [DOI] [PubMed] [Google Scholar]
  26. Kobayashi K, Manabe T, Takahashi T. Presynaptic long-term depression at the hippocampal mossy fiber-CA3 synapse. Science. 1996;273:648–650. doi: 10.1126/science.273.5275.648. [DOI] [PubMed] [Google Scholar]
  27. Langdon RB, Johnson JW, Barrionuevo G. Asynchrony of mossy fibre inputs and excitatory postsynaptic currents in rat hippocampus. J Physiol. 1993;472:157–176. doi: 10.1113/jphysiol.1993.sp019941. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Lauri SE, Bortolotto ZA, Bleakman D, Ornstein PL, Lodge D, Isaac JT, Collingridge GL. A critical role of a facilitatory presynaptic kainate receptor in mossy fiber LTP. Neuron. 2001;32:697–709. doi: 10.1016/s0896-6273(01)00511-6. [DOI] [PubMed] [Google Scholar]
  29. Lauri SE, Bortolotto ZA, Nistico R, Bleakman D, Ornstein PL, Lodge D, Isaac JT, Collingridge GL. A role for Ca2+ stores in kainate receptor-dependent synaptic facilitation and LTP at mossy fiber synapses in the hippocampus. Neuron. 2003;39:327–341. doi: 10.1016/s0896-6273(03)00369-6. [DOI] [PubMed] [Google Scholar]
  30. Lawrence JJ, McBain CJ. Interneuron diversity series: containing the detonation--feedforward inhibition in the CA3 hippocampus. Trends Neurosci. 2003;26:631–640. doi: 10.1016/j.tins.2003.09.007. [DOI] [PubMed] [Google Scholar]
  31. Lerma J. Roles and rules of kainate receptors in synaptic transmission. Nat Rev Neurosci. 2003;4:481–495. doi: 10.1038/nrn1118. [DOI] [PubMed] [Google Scholar]
  32. Lester RA, Quarum ML, Parker JD, Weber E, Jahr CE. Interaction of 6-cyano-7-nitroquinoxaline-2,3-dione with the N-methyl-D-aspartate receptor-associated glycine binding site. Mol Pharmacol. 1989;35:565–570. [PubMed] [Google Scholar]
  33. Manzoni OJ, Castillo PE, Nicoll RA. Pharmacology of metabotropic glutamate receptors at the mossy fiber synapses of the guinea pig hippocampus. Neuropharmacology. 1995;34:965–971. doi: 10.1016/0028-3908(95)00060-j. [DOI] [PubMed] [Google Scholar]
  34. Melyan Z, Wheal HV, Lancaster B. Metabotropic-mediated kainate receptor regulation of IsAHP and excitability in pyramidal cells. Neuron. 2002;34:107–114. doi: 10.1016/s0896-6273(02)00624-4. [DOI] [PubMed] [Google Scholar]
  35. Miller RJ. Presynaptic receptors. Annu Rev Pharmacol Toxicol. 1998;38:201–227. doi: 10.1146/annurev.pharmtox.38.1.201. [DOI] [PubMed] [Google Scholar]
  36. Min MY, Rusakov DA, Kullmann DM. Activation of AMPA, kainate, and metabotropic receptors at hippocampal mossy fiber synapses: role of glutamate diffusion. Neuron. 1998;21:561–570. doi: 10.1016/s0896-6273(00)80566-8. [DOI] [PubMed] [Google Scholar]
  37. More JC, Nistico R, Dolman NP, Clarke VR, Alt AJ, Ogden AM, Buelens FP, Troop HM, Kelland EE, Pilato F, et al. Characterisation of UBP296: a novel, potent and selective kainate receptor antagonist. Neuropharmacology. 2004;47:46–64. doi: 10.1016/j.neuropharm.2004.03.005. [DOI] [PubMed] [Google Scholar]
  38. Mori M, Abegg MH, Gahwiler BH, Gerber U. A frequency-dependent switch from inhibition to excitation in a hippocampal unitary circuit. Nature. 2004;431:453–456. doi: 10.1038/nature02854. [DOI] [PubMed] [Google Scholar]
  39. Mulle C, Sailer A, Perez-Otano I, Dickinson-Anson H, Castillo PE, Bureau I, Maron C, Gage FH, Mann JR, Bettler B, Heinemann SF. Altered synaptic physiology and reduced susceptibility to kainate-induced seizures in GluR6-deficient mice. Nature. 1998;392:601–605. doi: 10.1038/33408. [DOI] [PubMed] [Google Scholar]
  40. Nicoll RA, Schmitz D. Synaptic plasticity at hippocampal mossy fibre synapses. Nat Rev Neurosci. 2005;6:863–876. doi: 10.1038/nrn1786. [DOI] [PubMed] [Google Scholar]
  41. Pelkey KA, Lavezzari G, Racca C, Roche KW, McBain CJ. mGluR7 is a metaplastic switch controlling bidirectional plasticity of feedforward inhibition. Neuron. 2005;46:89–102. doi: 10.1016/j.neuron.2005.02.011. [DOI] [PubMed] [Google Scholar]
  42. Pelkey KA, Topolnik L, Lacaille JC, McBain CJ. Compartmentalized Ca(2+) channel regulation at divergent mossy-fiber release sites underlies target cell-dependent plasticity. Neuron. 2006;52:497–510. doi: 10.1016/j.neuron.2006.08.032. [DOI] [PubMed] [Google Scholar]
  43. Perrais D, Pinheiro PS, Jane DE, Mulle C. Antagonism of recombinant and native GluR7-containing kainate receptors. Neuropharmacology. 2008 doi: 10.1016/j.neuropharm.2008.08.002. [DOI] [PubMed] [Google Scholar]
  44. Pinheiro PS, Mulle C. Presynaptic glutamate receptors: physiological functions and mechanisms of action. Nat Rev Neurosci. 2008;9:423–436. doi: 10.1038/nrn2379. [DOI] [PubMed] [Google Scholar]
  45. Pinheiro PS, Perrais D, Coussen F, Barhanin J, Bettler B, Mann JR, Malva JO, Heinemann SF, Mulle C. GluR7 is an essential subunit of presynaptic kainate autoreceptors at hippocampal mossy fiber synapses. Proc Natl Acad Sci U S A. 2007 doi: 10.1073/pnas.0608891104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Regehr WG, Delaney KR, Tank DW. The role of presynaptic calcium in short-term enhancement at the hippocampal mossy fiber synapse. J Neurosci. 1994;14:523–537. doi: 10.1523/JNEUROSCI.14-02-00523.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Rodriguez-Moreno A, Sihra TS. Presynaptic kainate receptor facilitation of glutamate release involves protein kinase A in the rat hippocampus. J Physiol. 2004;557:733–745. doi: 10.1113/jphysiol.2004.065029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Salin PA, Scanziani M, Malenka RC, Nicoll RA. Distinct short-term plasticity at two excitatory synapses in the hippocampus. Proc Natl Acad Sci U S A. 1996;93:13304–13309. doi: 10.1073/pnas.93.23.13304. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Scanziani M, Salin PA, Vogt KE, Malenka RC, Nicoll RA. Use-dependent increases in glutamate concentration activate presynaptic metabotropic glutamate receptors. Nature. 1997;385:630–634. doi: 10.1038/385630a0. [DOI] [PubMed] [Google Scholar]
  50. Schmitz D, Frerking M, Nicoll RA. Synaptic activation of presynaptic kainate receptors on hippocampal mossy fiber synapses. Neuron. 2000;27:327–338. doi: 10.1016/s0896-6273(00)00040-4. [DOI] [PubMed] [Google Scholar]
  51. Schmitz D, Mellor J, Breustedt J, Nicoll RA. Presynaptic kainate receptors impart an associative property to hippocampal mossy fiber long-term potentiation. Nat Neurosci. 2003;6:1058–1063. doi: 10.1038/nn1116. [DOI] [PubMed] [Google Scholar]
  52. Schmitz D, Mellor J, Nicoll RA. Presynaptic kainate receptor mediation of frequency facilitation at hippocampal mossy fiber synapses. Science. 2001;291:1972–1976. doi: 10.1126/science.1057105. [DOI] [PubMed] [Google Scholar]
  53. Shigemoto R, Kinoshita A, Wada E, Nomura S, Ohishi H, Takada M, Flor PJ, Neki A, Abe T, Nakanishi S, Mizuno N. Differential presynaptic localization of metabotropic glutamate receptor subtypes in the rat hippocampus. J Neurosci. 1997;17:7503–7522. doi: 10.1523/JNEUROSCI.17-19-07503.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Tong G, Shepherd D, Jahr CE. Synaptic desensitization of NMDA receptors by calcineurin. Science. 1995;267:1510–1512. doi: 10.1126/science.7878472. [DOI] [PubMed] [Google Scholar]
  55. Toth K, Suares G, Lawrence JJ, Philips-Tansey E, McBain CJ. Differential mechanisms of transmission at three types of mossy fiber synapse. J Neurosci. 2000;20:8279–8289. doi: 10.1523/JNEUROSCI.20-22-08279.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Vignes M, Collingridge GL. The synaptic activation of kainate receptors. Nature. 1997;388:179–182. doi: 10.1038/40639. [DOI] [PubMed] [Google Scholar]
  57. Vogt KE, Nicoll RA. Glutamate and gamma-aminobutyric acid mediate a heterosynaptic depression at mossy fiber synapses in the hippocampus. Proc Natl Acad Sci U S A. 1999;96:1118–1122. doi: 10.1073/pnas.96.3.1118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Weisskopf MG, Nicoll RA. Presynaptic changes during mossy fibre LTP revealed by NMDA receptor-mediated synaptic responses. Nature. 1995;376:256–259. doi: 10.1038/376256a0. [DOI] [PubMed] [Google Scholar]
  59. Wigstrom H, Gustafsson B. Facilitated induction of hippocampal long-lasting potentiation during blockade of inhibition. Nature. 1983;301:603–604. doi: 10.1038/301603a0. [DOI] [PubMed] [Google Scholar]
  60. Wisden W, Seeburg PH. A complex mosaic of high-affinity kainate receptors in rat brain. J Neurosci. 1993;13:3582–3598. doi: 10.1523/JNEUROSCI.13-08-03582.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Wittner L, Henze DA, Zaborszky L, Buzsaki G. Three-dimensional reconstruction of the axon arbor of a CA3 pyramidal cell recorded and filled in vivo. Brain Struct Funct. 2007;212:75–83. doi: 10.1007/s00429-007-0148-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Yamamoto C, Sawada S, Takada S. Suppressing action of 2-amino-4-phosphonobutyric acid on mossy fiber-induced excitation in the guinea pig hippocampus. Exp Brain Res. 1983;51:128–134. doi: 10.1007/BF00236810. [DOI] [PubMed] [Google Scholar]
  63. Zucker RS, Regehr WG. Short-term synaptic plasticity. Annu Rev Physiol. 2002;64:355–405. doi: 10.1146/annurev.physiol.64.092501.114547. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

01
NIHMS85021-supplement-01.pdf (663KB, pdf)

RESOURCES