Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2015 Jun 4.
Published in final edited form as: J Immunol. 2013 Jun 17;191(2):670–677. doi: 10.4049/jimmunol.1203211

IL-4 upregulates Igα and Igβ protein, resulting in augmented IgM maturation and BCR-triggered B cell activation1

Benchang Guo *,§, Thomas L Rothstein *,¶,#
PMCID: PMC4456092  NIHMSID: NIHMS695462  PMID: 23776171

Abstract

Interleukin 4 (IL-4) is critical for optimal B cell activation and germinal center B cell expansion in T-dependent immune responses; however, the underlying mechanism remains elusive. In the present study, we found that primary B cells express little Igα and Igβ protein despite substantial levels of messenger RNA. IL-4 markedly up-regulates Igα and Igβ protein expression that requires STAT6. Elevated Igα and Igβ protein form heterodimers that associate with IgM and significantly promote IgM maturation and surface IgM expression, resulting in amplified BCR-initiated signaling that is Lyn-dependent. In vivo, we found that pre-germinal center B cells express upregulated Igα, Igβ, and surface IgM expression, in conjunction with elevated BCR-triggered pERK ex vivo, that are dependent on IL-4 and reversed by in vivo administration of neutralizing anti-IL-4 antibody. Thus, this study elucidates a novel mechanism for crosstalk between the IL-4 and B cell receptors that programs enhancement of subsequent BCR signaling.

Introduction

B cell receptor (BCR) signaling is pivotal for B cell activation and differentiation. Multivalent antigens initiate BCR clustering. As a result, tyrosine residues in ITAMs of Igα/Igβ heterodimers are phosphorylated by Src family kinases. Phosphorylated ITAMs recruit and assemble BCR signaling molecules and adaptors, which are pivotal for BCR signal transduction to downstream events that include MAP kinase (MAPK) activation and transcription factor expression (1, 2).

The germinal center is a specialized compartment in which B cell activation, expansion, somatic hypermutation, and antibody affinity maturation occurs (3). Optimal B cell activation depends on both antigen binding and T cell help. After encountering antigen in the follicle (4) or the T cell zone (5), B cells experience up-regulation of chemokines and chemokine receptors (6) that facilitate migration to the boundary between the B cell follicle and the T cell zone, or the interfollicular zone (7). In this region, activated B cells and cognate T cells cluster and form long-lasting conjugates (8) that remain at the follicle periphery for approximately 3 days (7, 9) before migrating to the follicle interior (10). During this time, B cells present processed cognate antigen for T cell activation and Tfh cell maintenance (7, 11, 12), and activated T cells, in turn, influence B cell activation either through surface co-stimulatory molecules such as ICOS (13) and CD40L (14) or by secreted cytokines such as IL-4 (15, 16).

Both Th2 cells and Tfh cells are sources for IL-4 production. In keeping with derivation from Th2 cells, IL-4 is critical for immunoglobulin class-switching from IgM to IgE and IgG1 (17) that plays a protective role in parasite immunity. In keeping with derivation from Tfh cells, IL-4 is critical for germinal center formation and germinal center B cell differentiation and expansion (16, 18-20). IL-4 is a potent B cell stimulatory factor that was discovered early on to amplify anti-Ig-stimulated B cell activation (21). The mechanism by which IL-4 amplifies BCR signaling remains unclear because IL-4 alone does not activate B cells (22, 23). In the current study, we demonstrate that IL-4 pretreatment significantly enhances subsequent BCR-stimulated ERK phosphorylation. We show here that IL-4 amplifies BCR-triggered phosphorylation events by significantly upregulating Igα and Igβ protein expression that in turn promotes IgM maturation and migration to the B cell surface in vitro and in vivo. Thus, IL-4 acts to enhance subsequent BCR signaling by altering the level of key components of the BCR complex. This represents a novel mechanism by which IL-4 receptor engagement regulates BCR-triggered B cell activation.

Materials and Methods

Mice

Male BALB/cByJ mice, C57BL/6 mice, anti-HEL transgenic mice (C57BL/6-Tg (IghelMD4)4Ccg/J) (24), and STAT6-deficient mice at 8-14 weeks of age were obtained from The Jackson Laboratory. Lyn-deficient mice on the C57BL/6 background have been described (25). All mice were cared for and handled in accordance with National Institutes of Health and institutional guidelines, and studies with these mice were approved by the Institutional Animal Care and Use Committee.

Adoptive transfers and immunizations

B cells were isolated from anti-HEL transgenic mice by MACS (Milteny Biotec) followed by labeling with CFSE (Molecular Probes) as previously described (26). CFSE labeled B cells (2×107) were injected (i.v.) into pre-immunized syngeneic mice. For immunization, C57BL/6 mice were given 100 μg HEL in alum i.p. 3 days before B cell transfer. Recipient mice were boosted with 50 μg HEL in PBS at the time of B cell transfer as previously described (27). Recipient mice received 2.5 mg neutralizing anti-IL-4 antibody (11B11; a gift from, Biological Response Modifiers Program, National Cancer Institute.) or isotype control rat IgG1 antibody (R&D systems) i.p. daily from day 3 to day 5. Recipient and control mice were euthanized and spleens subjected to analysis. For sheep red blood cell (SRBC) immunization, BALB/c mice were injected (i.p.) with 5×108 SRBC (Lamprie biological laboratories) in PBS.

B Lymphocyte isolation and stimulation

B cells were prepared from spleen cell suspensions by negative selection using magnetic-activated cell sorting (Miltenyi Biotec). Unless otherwise stated, B cells were incubated in medium for 3 h or with IL-4 or IL-21 at 10 ng/ml for 24 h. B cells were either treated with IL-4 (10 ng/ml) or IL-21 (10 ng/ml) and stimulated by F(ab')2 goat anti-mouse IgM (anti-Ig) (15 μg/ml) or HEL (100 ng/ml). For “one pulse” stimulation (anti-Igp), purified B cells were incubated with anti-Ig antibody on ice for 30 min. Unbound anti-Ig was removed by washing with medium. The B cells were resuspended in medium and shifted to a 37 °C incubator. For continuous anti-Ig (anti-Igc) stimulation, purified B cells were incubated with anti-Ig antibody on ice for 30 min, and then B cells were shifted to a 37 °C incubator without washing.

Immunoblotting analysis

Naive or IL-4-treated B cells were stimulated with 15 μg/ml F(ab')2 fragments of anti-IgM antibody for the indicated times, and reactions were terminated with ice-cold PBS. Cells were centrifuged and resuspended in RIPA lysis buffer and equal amounts of protein for each condition (15–30 μg) were subjected to SDS-PAGE separation followed by immunoblotting. Immunoreactive proteins were detected by ECL (Amersham Biosciences). Immunoblots were stripped and reprobed with control Ab to verify that equal amounts of protein were loaded in each lane.

Quantitative RT-PCR

Total RNA was obtained from sorted naive and IL-4-treated B cells. cDNA was prepared using AMV reverse transcriptase (Roche Applied Sciences). Igα and Igβ gene expression was assessed and normalized to beta-actin expression by real-time PCR using a MX3000P quantitative PCR machine (Stratagene) with the following primers (forward/reverse): Igβ, GCCCATCTTCC TGCTACTTG/TGCTCTCCTACCGACCACTT; Igα, AACCACAGGGGCTTGTACTG/TGAT GATGCGGTTCTTGGTA, beta-actin, CTAAGGCCAACCGTGAAAAG/GAGGCATACAGG GACAGCAC.

Retrovirus transduction

Full-length Igα and Igβ cDNA was cloned into the MSCV retroviral vector. The virus was propagated using BOSC packaging cells grown in DMEM with 10% fetal bovine serum, 5 mM L-glutamine, and penicillin/streptomycin. The BOSC cells were transfected with 2 μg MSCV-Igα and MSCV-Igβ vector or 1 μg MSCV mock vector, and 2 μg of the retroviral envelope plasmid pCL-eco, using FUGENE (Amersham). One day after transfection the BOSC cells were fed with the medium described above. The following day the supernatant from the BOSC cells was removed, cleared of cells by centrifugation, and used for transduction of BAL17 B cells. Two days after transduction, GFP positive BAL17 B cells were sorted and assayed.

Proliferation

FACS-sorted B cells were cultured in RPMI 1640 medium as described above. The B cells were stimulated for 48 h with 1 μg/mL of anti-Ig or 100 ng/ml HEL, or 1 ng/ml IL-4, or a combination of anti-Ig or HEL with IL-4. Cultures were pulsed with 0.5 μCi of [3H]thymidine (Amersham) for the last 6 h of culture. Thymidine incorporation was measured by scintillation counting of beta particle emissions.

Flow cytometric analysis

Naïve, IL-4-treated B cells or splenic cells were stained with anti-B220, anti-IgM, anti-IgD, anti-CD79a, anti-CD79b, and corresponding isotype control antibodies followed by flow cytometric analysis (BD Calibur or FACSVerse). To evaluate p-ERK in pre-germinal center B cells from immunized mice, splenic cells were unstimulated or stimulated with HEL (100 ng/ml) for 5 min followed by fixation and permeabilization as previously described (28). The resultant cells were stained with anti-phospho-ERK antibody (Cell Signaling Technology) and anti-B220 antibody followed by APC-conjugated goat anti rabbit secondary antibody (Jackson immunoResearch).

Antibodies and reagents

Affinity-purified F(ab')2 fragments of polyclonal goat anti-mouse IgM (anti-Ig) were obtained from Jackson ImmunoResearch Laboratories. Anti-CD79a-APC was obtained from BioLegend. Anti-CD79b-PE antibody was obtained from Southern Biotech. Anti-IgM-APC, anti-IgD-FITC, anti-IgD-Pacific Blue, anti-GL-7-APC, anti-IgD-FITC, anti-B220-PE-CY7, and anti-B220-PE antibodies were obtained from BD Biosciences. Lectin PNA-APC was obtained from Invitrogen. Anti-phospho-ERK1/2 (Thr202/Tyr204) and anti-ERK1/2, and secondary Abs for immunoblottingting were obtained from Cell Signaling Technology. Anti-Igα was obtained from R&D systems. Anti-Igβ antibody was obtained from Epitomics and Santa Cruz Biotechnology. Anti-actin antibody and HEL were obtained from Sigma-Aldrich. Recombinant murine IL-4 was obtained from BD Pharmingen. Recombinant murine IL-21 was obtained from Peprotech.

Results

IL-4 does not directly affect BCR signaling

IL-4 enhances BCR-initiated B cell proliferation in vitro and is critical for optimal B cell activation and germinal center B cell expansion in vivo, yet, by itself, IL-4 alone does not induce B cell proliferation. BCR signaling strength is strongly correlated to BCR-initiated B cell proliferation, suggesting that IL-4 enhances BCR-initiated B cell proliferation by amplifying BCR-stimulated signaling. There are two possibilities by which IL-4 can influence BCR-stimulated signaling: 1. IL-4 directly enhances BCR-stimulated signaling strength in a synergistic manner; 2. IL-4 reprograms BCR signaling machinery that results in elevated BCR-stimulated signaling strength. To determine whether IL-4 treatment can directly change BCR-initiated signaling strength, purified splenic B cells were either unstimulated or stimulated with anti-IgM (anti-Ig) antibody, IL-4, or IL-4 plus anti-Ig, and activation of ERK was analyzed by immunoblotting. As shown in Figure 1A, anti-Ig alone stimulated substantial phosphorylation of ERK. In contrast, IL-4 alone did not stimulate phosphorylation of ERK. Notably, IL-4 did not affect anti-Ig-stimulated activation of ERK when IL-4 and anti-Ig were added concurrently. These results indicate that IL-4 neither activates the ERK MAPK pathway nor acts in a direct synergistic role with anti-Ig in promoting B cell signaling.

Figure 1.

Figure 1

Open in a new tab

IL-4 pretreatment enhances BCR signaling that is Lyn-dependent. (A and B) Purified splenic B cells were unstimulated (0) or were stimulated with anti-Ig, IL-4 or IL-21, or a combination of anti-Ig and IL-4 or IL-21, for 1, 5, or 15 minutes. Cell lysates were subjected to immunoblotting using antibody directed against phosphorylated ERK. Membranes were stripped and reprobed with ERK-specific antibody as a loading control. (C) Purified splenic B cells or (D) anti-HEL transgenic splenic B cells were cultured in medium for 3 h (MED) or were treated with IL-4 or IL-21 for 24 hours, followed by stimulation with anti-Ig (αIg) or HEL for 0, 1, and 5 minutes. Cell lysates were subjected to immunoblotting using antibody directed against phosphorylated ERK. Membranes were stripped and reprobed with ERK-specific antibody as a loading control. (E) Purified anti-HEL transgenic splenic B cells were untreated (MED) or were treated with HEL, IL-4, and a combination of HEL plus IL-4. Incorporation of [3H] thymidine during the last 6 hours of 48 hours cultures was evaluated by scintillation counting. Counts per minute of triplicate cultures are shown, along with lines indicating means and standard deviations. (F) Purified splenic B cells were cultured in medium for 3 h (MED) or were treated with IL-4, or a combination of anti-Igp or anti-Igc plus IL-4 (as described in EXPERIMENTAL PROCEDURES) for 24 hours; The resultant B cells were stimulated with anti-Ig (αIg) for 0, 1, and 5 minutes. Cell lysates were subjected to immunoblotting using antibody directed against phosphorylated ERK. Membranes were stripped and reprobed with ERK-specific antibody as a loading control. (G) Purified splenic B cells from Lyn-deficient (KO) or littermate control (WT) mice were cultured in medium for 3 h (MED) or were treated with IL-4 for 24 hours, followed by stimulation with anti-Ig for 0, 1, and 5 minutes. Cell lysates were subjected to immunoblotting using antibody directed against phosphorylated ERK. Membranes were stripped and reprobed with ERK-specific antibody as a loading control. Results shown from (A) to (G) represent one of three independent experiments.

IL-21 is another Tfh-derived cytokine that plays a compensatory role with IL-4 in the regulation of germinal center B cell expression and germinal center formation (18). We found that, like IL-4, IL-21 alone does not trigger ERK phosphorylation in B cells. Also, IL-21 does not affect BCR-initiated signaling when added with anti-Ig at the same time (Figure 1B).

IL-4 pretreatment enhances BCR signaling

IL-4 does not directly influence BCR signaling suggesting that IL-4 may reprogram the BCR signaling machinery. To address this issue, anti-Ig-stimulated ERK phosphorylation was evaluated in naïve B cells versus IL-4-pretreated B cells. As shown in Figure 1C, stimulation of naïve B cells with anti-Ig produced phosphorylation of ERK. Importantly, after treatment with IL-4, BCR engagement produced significantly more phospho-ERK. The level of phosphorylated ERK (p-ERK) at 1 or 5 min was 364 ± 7 % (mean ± SD, n=3) and 318 ± 8 %, respectively, as that in naïve B cells upon anti-Ig-stimulation. These results indicate that IL-4 pretreatment may alter BCR signaling machinery resulting in enhanced BCR signaling to ERK, as previously suggested (29). Also, these results are consistent with previous reports that pretreatment with IL-4 speeds B cell mitosis induced by anti-Ig (22). Although IL-21 plays a compensatory role with IL-4 in regulating germinal center formation (18), IL-21 did not change BCR-stimulated signaling even after 24 hour pretreatment (Figure 1C). These results suggest that IL-4 and IL-21 influence B cell activation in different ways and that the enhancing effect of IL-4 is specific.

To determine whether the effect of IL-4 on subsequent BCR signaling depends on the particular kind of cross-linking produced by anti-Ig, B cells obtained from anti-HEL transgenic mice were stimulated with specific Ag HEL. IL-4 pretreatment substantially enhanced HEL-initiated ERK phosphorylation, much like the results obtained with anti-Ig stimulation (Figure 1D).

To determine whether IL-4 enhances B cell proliferation produced by specific antigen, purified anti-HEL transgenic B cells were unstimulated or were stimulated with HEL alone, IL-4 alone, or a combination of HEL and IL-4, for 48 h. As shown in Figure 1E, HEL alone produced a very weak proliferative response, but this was markedly enhanced by the presence of IL-4. These results indicate that IL-4 treatment can positively influence subsequent antigen-induced B cell responses.

After encountering antigen, B cells are transiently activated and migrate to the boundary between the B cell follicle and the T cell zone, suggesting that B cells experience antigen stimulation before IL-4 binding. In this scenario, B cells are primed by “one pulse” antigen stimulation. To address whether “one pulse” antigen priming affects subsequent IL-4-induced changes in BCR signaling, purified B cells were bound with anti-Ig antibody on ice. Unbound anti-Ig was removed by washing with medium. Naïve or anti-Ig-bound B cells were then treated with IL-4 followed by anti-Ig stimulation. As expected, IL-4-pretreatment enhanced BCR-stimulated ERK phosphorylation in naïve B cells. Further, IL-4-pretreatment comparably enhanced BCR-stimulated ERK phosphorylation in anti-Ig-bound B cells (Figure 1F). These results suggest that IL-4-pretreatment enhances subsequent BCR-stimulated B cell activation, irrespective of initial “one pulse” antigen priming.

To compare with “one pulse” antigen stimulation, naïve B cells were continually exposed to a combination of anti-Ig and IL-4 for 24 hour followed by anti-Ig stimulation. As shown in Figure 1E, in comparison with “one pulse” anti-Ig stimulation, B cells continually exposed to anti-Ig and IL-4 did not respond to subsequent anti-Ig stimulation.

IL-4-enhanced BCR signaling requires Lyn

To determine whether enhancement of BCR-triggered ERK phosphorylation produced by IL-4 pretreatment is mediated by Lyn, which mediates IL-4-enhanced anti-Ig-induced B cell proliferation (30, 31), B cells were obtained from Lyn-deficient and littermate WT control mice, and anti-Ig-stimulated ERK phosphorylation was evaluated in naïve B cells versus IL-4-pretreated B cells. As shown in Figure 1G, IL-4 pretreatment markedly enhanced subsequent anti-Ig-stimulated phosphorylation of ERK in WT B cells. However, IL-4-induced enhancement of anti-Ig-stimulated ERK phosphorylation was largely abrogated by Lyn deficiency. These results indicate that enhanced BCR signaling produced by IL-4 pretreatment depends on Lyn.

IL-4 promotes IgM maturation

The requirement for Lyn in mediating IL-4-enhanced BCR signaling suggests that IL-4 pretreatment might act by altering BCR constituents that lie directly upstream of Lyn. To determine whether IL-4-enhanced BCR signaling results from a change in BCR constituents, naïve and IL-4-treated B cells were analyzed for surface immunoglobulin M (IgM), as well as IgD, expression. Remarkably, IL-4 treatment significantly upregulated both surface IgM and IgD expression (Figure 2A). IgM expression increased by 244 ± 13% (n=3) and IgD expression increased by 278 ± 9% (n=3). Because the size of B cells might vary after culture with IL-4, which might affect measurement of surface IgM and IgD expression, naïve B cells and IL-4-pretreated B cells were evaluated by flow cytometric forward scatter (FSC) analysis, along with analysis of the typical B cell surface marker B220 by flow cytometry. The results are shown in Figure 2B. After culture with IL-4, B cells became slightly bigger (FSC: 9.9 ± 7.8% increase in MFI, n=3), and the values for B220 mean fluorescence intensity were also very slightly higher (17.9 ± 6.5% increase in MFI, n=3) compared with naïve B cells. The slight increases for IL-4-treated B cells in cell size, and in B220 expression as a surface antigen reflection of increased cell size, can not explain the marked increases in surface IgM and IgD produced by IL-4 treatment. These results suggest that IL-4-treatment, indeed, specifically increases surface IgM and IgD expression.

Figure 2.

Figure 2

Open in a new tab

IL-4 promotes IgM maturation. Purified splenic B cells were cultured in medium for 3 h (MED, fine line) or treated with IL-4 (bold line) for 24 hours and subjected to flow cytometric analysis using fluorescent monoclonal antibody against IgM (A), IgD (A), and B220 (B) or isotype control (IC, shaded area), or FSC (B) or (C) immunoblotting using anti-IgM antibody. Membranes were stripped and reprobed with actin-specific antibody as a loading control. Results shown represent one of four independent experiments. (D) Fold increase of total IgM protein expression in purified splenic B cells treated with IL-4 for 24 h relative to naïve B cells cultured in medium (MED) for 3 h (mean and standard deviation of five independent experiments). (E) Purified splenic B cells were cultured in medium for 3 h (MED) or were treated with IL-4 for 24 hours (IL-4). Cell lysates were subjected to endo H digestion followed by immunoblotting using anti-IgM antibody to identify endo H-resistant (rIgM) and endo H sensitive (sIgM) species. Results shown represent one of three independent experiments.

Primary B cells express not only surface IgM but also intracellular IgM, representing a different level of immunoglobulin maturation. Although IL-4 markedly upregulated surface IgM expression, there was little change in the total amount of IgM detected (Figure 2C and 2D). These results suggest that IL-4 treatment might alternatively affect IgM maturation.

Naïve primary B cells express two IgM heavy chains, as shown in Figure 2C and 2E. The major band (that is faster migrating) is immature IgM that is sensitive to endo H digestion (Figure 2E). The minor band (that is slower migrating) is mature IgM that is resistant to endo H digestion (Figure 2E). Although IL-4 did not change total IgM expression, it reversed the ratio of IgM maturation status, as the upper band became the dominant form of IgM while the lower band diminished in intensity. These results indicate that IL-4 significantly promotes IgM maturation even though it does not change total IgM expression.

IL-4 significantly upregulates Igα and Igβ protein expression

IgM maturation and transportation to the surface requires proper assembly with Igα/Igβ heterodimers (32, 33). IL-4 promotes IgM maturation and increases surface IgM expression suggesting that IL-4 treatment may change expression of Igα and Igβ. To address this issue, Igα and Igβ proteins were evaluated in naïve and IL-4-treated B cells. Strikingly, IL-4 significantly upregulated expression of Igα protein by 5-6 fold and Igβ protein by more than 10-fold, as compared to that in naïve B cells, as shown in Figures 3A and 3B.

Figure 3.

Figure 3

Open in a new tab

IL-4 upregulates Igα and Igβ protein expression. (A) Purified splenic B cells were cultured in medium for 3 h (MED) or were treated with IL-4 for 24 hours. Cell lysates were subjected to immunoblotting using anti-Igα, and anti-Igβ antibodies. Membranes were stripped and reprobed with actin-specific antibody as a loading control. Results shown represent one of more than ten independent experiments. (B) Fold increase of Igα and Igβ protein expression in purified splenic B cells treated with IL-4 for 24 h relative to naïve B cells cultured in medium (MED) for 3 h (mean and standard deviation of ten independent experiments). (C) Purified splenic B cells were cultured in medium for 3 h (MED) or were treated with IL-4 for 24 hours (IL-4). Cell lysates were prepared with NP-40 lysis buffer under non-reducing conditions and analyzed by immunoblotting using anti-Igα and anti-Igβ antibodies. Results represent one of 3 independent experiments. (D) Purified splenic B cells were cultured in medium for 3 h (MED) or were treated with IL-4 for 24 hours (IL-4). Cell lysates were prepared with digitonin lysis buffer. Cell lysates were immunoprecipitated (IP) with anti-IgM. IP samples (IPs) and whole cell lysate (WCL) were subjected to immunoblotting (IB) with anti-Igβ and IgM. WCL membranes were stripped and reprobed with anti-actin antibody. Results represent one of 3 independent experiments. (E and F) Purified splenic B cells were cultured in medium for 3 h (MED, gray line) or were treated with IL-4 (bold line) or IL-21 (fine line) for 24 hours and subjected to (E) immunoblotting using anti-Igα, and anti-Igβ antibodies, or (F) flow cytometric analysis using fluorescent anti-IgM monoclonal antibody or isotype control (IC, shaded area). Membranes were stripped and reprobed with actin-specific antibody as a loading control. Results shown represent one of 3 independent experiments. (G and H) Purified splenic B cells were cultured in medium for 3 h (MED) or were treated with IL-4 for 24 hours, after which mRNA was analyzed by realtime PCR for the level of Igα (G) and Igβ (H) gene expression, normalized to beta-actin. Mean results for 3 independent experiments are shown along with lines indicating standard deviations.

In naïve B cells, Igα and Igβ are covalently associated to form heterodimers (33, 34). To determine whether IL-4-induced Igα and Igβ exist in a heterodimeric form, cell lysates from naïve and IL-4-treated B cells were separated in non-reducing gels followed by immunoblotting with anti-Igα and anti-Igβ antibodies. As shown in Figure 3C, in naïve B cells, Igα and Igβ were associated in heterodimeric form and there was no detectible monomeric Igα or Igβ. Igα and Igβ were similarly associated in heterodimeric form in IL-4-treated B cells. Because IL-4 induces more Igβ than Igα (Figure 3A and 3B), there was no detectible monomeric Igα protein but some unbound Igβ was present in monomeric form. These results reveal that IL-4 significantly upregulates Igα and Igβ expression, and elevated Igα and Igβ proteins form heterodimers that may potentiate IgM maturation and migration to cell surface. Igα and Igβ heterodimers have also been shown to associate with MHC II (35). To determine whether IL-4-induced Igα and Igβ heterodimers directly associate with IgM, naïve and IL-4-treated B cell lysates were immunoprecipitated with anti-IgM antibody followed by immunoblotting with anti-Igβ antibody. As shown in Figure 3D, the association between IgM and Igβ is dramatically increased in IL-4 treated B cells. These results indicate that IL-4-induced heterodimers of Igα and Igβ directly associate with IgM and promote IgM maturation.

IL-21 does not influence BCR-stimulated signaling, as IL-4 does. We thus speculated that IL-21 might not change the expression profile of BCR complex components. To explore these issues, naïve or IL-21-pretreated B cells were analyzed for expression of surface IgM, Igα, and Igβ. Results are shown in Figure 3E and 3F. Unlike IL-4, IL-21 did not change surface IgM, Igα, or Igβ expression in B cells.

The origin of increased Igα and Igβ protein expression after B cell incubation with IL-4 was then probed by evaluating transcript levels with real-time PCR. As shown in Figures 3G and 3H, naïve B cells expressed a high basal level of Igα and Igβ transcription, relative to the level of beta-actin mRNA. This high level of Igα and Igβ gene expression was little changed by IL-4— after IL-4 treatment, Igβ gene expression was only modestly increased (∼1.4 fold increase, Figure 3H) and Igα gene expression was not increased at all (Figure 4G). Thus, IL-4 produced a marked increase in protein expression that far outweighed the minimal increase in gene expression for both Igα and Igβ, suggesting uncoupling between expression of protein and mRNA in IL-4 treated B cells.

Figure 4.

Figure 4

Open in a new tab

IL-4-induced upregulation of Igα and Igβ expression requires STAT6. (A,B) Purified splenic B cells from STAT6-deficient (KO) or littermate control (WT) mice were cultured in medium for 3 h (MED, fine line) or were treated with IL-4 (bold line) and subjected to (A) immunoblotting using anti-Igα, anti-Igβ, and anti-IgM antibody, or (B) flow cytometric analysis using fluorescent anti-IgM monoclonal antibody or isotype control (IC, shaded area). Membranes were stripped and reprobed with actin-specific antibody as a loading control. Results shown represent one of 3 independent experiments. (C) Purified splenic B cells from STAT6-deficient (KO) or littermate control (WT) mice were cultured in medium for 3 h (MED) or were treated with IL-4 for 24 hours, followed by stimulation with anti-Ig (αIg) for 0, 1, and 5 minutes. Cell lysates were subjected to immunoblotting using anti-phospho-ERK antibodies. Membranes were stripped and reprobed with ERK-specific antibody as a loading control. Results shown represent one of three independent experiments. (D) Purified splenic B cells from STAT6-deficient or littermate control mice were untreated (MED) or were treated with anti-Ig (1 μg/ml), IL-4 (1 ng/ml), and the combination of anti-Ig plus IL-4. Incorporation of [3H] thymidine during the last 6 hours of 48 hours cultures was evaluated by scintillation counting. Counts per minute of triplicate cultures are shown for one of 3 independent experiments, along with lines indicating standard deviations.

IL-4-induced upregulation of Igα and Igβ expression requires STAT6

Upon binding of IL-4 to its receptor, two signaling pathways are activated: one is mediated by STAT6; the other is mediated by IRS-2 (36). To determine whether the STAT6 pathway mediates IL-4-induced upregulated expression of Igα and Igβ, B cells were isolated from STAT6-deficient mice and littermate WT control mice, and Igα and Igβ protein expression was evaluated in naïve B cells relative to IL-4-treated B cells. As shown in Figure 4A, IL-4 induced a large increase in both Igα and Igβ in WT control B cells. In contrast, IL-4 failed to induce a similar increase in Igα and Igβ in STAT6-deficient B cells. Thus, IL-4 induces expression of Igα and Igβ through a STAT6-dependent pathway. To determine whether the loss of upregulated Igα and Igβ in STAT6-deficient B cells is associated with abrogation of IL-4-induced IgM maturation, B cells were isolated from STAT6-deficient mice and littermate WT control mice, and IgM expression was examined in naïve B cells compared with IL-4-treated B cells. As expected, in WT B cells IL-4 stimulated upregulated Igα and Igβ protein; redistribution of faster migrating, endo H-sensitive to slower migrating, endo H-resistant, mature IgM; and, increased surface IgM expression. In marked contrast, IL-4 failed to produce any of these changes in STAT6 deficient B cells (Figure 4A and 4B). Thus, STAT6 is required for the positive effect of IL-4 on expression of BCR complex components.

IL-4-enhanced BCR signaling requires STAT6

To the extent that IL-4-induced upregulated expression of Igα, Igβ and surface IgM is associated with IL-4-enhanced BCR signaling, interruption of the former might be accompanied by abrogation of the latter. To address this issue, purified B cells were isolated from STAT6-deficient and littermate WT control mice, and anti-Ig-stimulated ERK phosphorylation was determined in naïve B cells compared with IL-4-pretreated B cells. As shown in Figure 4C, anti-Ig stimulated phospho-ERK expression in naïve WT B cells was substantially enhanced (176 ± 12% and 550 ± 15% (mean ± SD, n=3) at 1 and 5 min, respectively) by prior IL-4 treatment, as expected. Further, in STAT6 KO B cells, anti-Ig also stimulated phospho-ERK expression, but here IL-4 failed to enhance BCR-triggered ERK phosphorylation (125 ± 8% and 95 ± 8% (mean ± SD, n=3) at 1 and 5 min, respectively, compared with that in naïve B cells). Thus, IL-4-enhanced BCR signaling for ERK phosphorylation requires STAT6.

Beyond downstream signaling, the effect of STAT6 deficiency on IL-4-enhanced, BCR-triggered B cell proliferation was examined. Purified B cells isolated from STAT6-deficient mice and littermate WT control mice were unstimulated or were stimulated with anti-Ig alone, IL-4 alone, or a combination of anti-Ig and IL-4, for 48 h. As shown in Figure 4D, and as expected, anti-Ig produced a vigorous proliferative response in WT B cells, which was substantially enhanced by IL-4. In STAT6 KO B cells, anti-Ig also produced a vigorous proliferative response, but here IL-4 failed to enhance BCR-triggered proliferation. These results show that loss of STAT6 results not only in the failure of IL-4 to upregulate Igα, Igβ and IgM expression but is accompanied by elimination of IL-4-induced amplification of BCR signaling, as exemplified by the loss of enhanced BCR-triggered phosphorylation of ERK, and by the loss of enhanced BCR-stimulated proliferation.

Over-expression of Igα/β upregulates surface IgM expression and enhances anti-Ig-stimulated BCR signaling

It is possible that factors beyond Igα and Igβ, which are also influenced by IL-4, direct IgM maturation and membrane migration. To determine whether increased Igα and Igβ are sufficient for increased surface IgM expression and increased BCR signaling after IL-4 treatment, Igα and Igβ were over-expressed in BAL17 B cells using MSCV retroviral vectors, after which surface IgM and BCR-triggered ERK phosphorylation were examined. As shown in Figure 5A, BAL-17 B cells transfected with both MSCV.Igα and MSCV.Igβ expressed much more surface IgM than BAL-17 B cells transfected with empty-vector control. Importantly, over-expression of Igα and Igβ markedly enhanced BCR signaling to phospho-ERK in transfected BAL17 cells (298 ± 10% (mean ± SD, n=3) and 882±18% at 1 μg/ml and 0.2 μg/ml, respectively, compared with that in empty-vector-transfected control BAL17 B cells) (Figure 5B). These results demonstrate that Igα and Igβ are key molecules that independently mediate increased surface IgM expression and enhanced BCR signaling.

Figure 5.

Figure 5

Open in a new tab

Over-expression of Igα/β upregulates surface IgM expression and enhances anti-Ig-stimulated BCR signaling. Full length Igα and Igβ cDNAs were cloned into MSCV retroviral vectors and transduced into BAL17 B cells (MSCV-Igα/β). Separately, BAL17 B cells were transduced with native, empty vector MSCV. GFP positive cells were sort-purified. (A) Empty vector MSCV (fine line) transduced and MSCV-Igα/β (bold line) transduced BAL17 B cells were subjected to flow cytometric analysis using fluorescent anti-IgM monoclonal antibody or isotype control (IC, shaded area). Results shown represent one of three independent experiments. (B) MSCV transduced or MSCV-Igα/β transduced BAL17 B cells were stimulated with anti-Ig (1 μg/ml and 0.2 μg/ml) for 5 minutes. Cell lysates were subjected to immunoblotting using anti-phospho-ERK antibody. Membranes were stripped and reprobed with ERK-specific antibody as a loading control. Results shown represent one of 3 independent experiments.

IL-4 enhances B cell activation in vivo

The results recounted above indicate a mechanism by which B cell activation and proliferation are enhanced by IL-4 in vitro. Due to spatiotemporal complexity for immune responses in vivo, the dynamics for B cell activation are complicated. After antigen priming, B cells migrate to the periphery of the follicle, then migrate into the germinal center. B cells access an IL-4 environment at the follicle periphery or in the germinal center. Although most IL-4-secreting Tfh cells reside in the germinal center (8, 15), germinal center B cells express low levels of surface IgM, Igα, and Igβ protein and are hypo-responsive to BCR stimulation (Figure 6A-6C) (37). These features are similar to the characteristics of B cells stimulated by anti-Ig in vitro (Figure 6D-6F), suggesting that germinal center B cells may be post-activation as a result of contact with FDC-associated antigen. This modulating effect of BCR engagement complicates examination of the role of IL-4 on B cells in the germinal center. For this reason we turned to pre-germinal center B cells present in the follicle periphery.

Figure 6.

Figure 6

Open in a new tab

Germinal center B cells and continuously anti-Ig-stimulated B cells are hyporesponsive to anti-Ig stimulation. (A) BALB/c mice were immunized with 5×108 SRBC. One week after immunization. Splenic cells were stained with PNA-APC and antibodies against IgM, isotype control (IC, shaded area), GL-7, and B220. Germinal center B cells (GCB: PNA+GL-7+B220+, fine line) and follicular B cells (FOB: CD21+CD23+, bold line) were analyzed for surface IgM expression by flow cytometry. Results represent one of 3 independent experiments. (B) GCB cells and FOB cells were FACS sorted and analyzed for Igα and Igβ expression by immunoblotting. Membranes were stripped and reprobed with anti-actin antibody as a loading control. Results shown represent one of three independent experiments. (C) GCB cells and FOB cells were FACS sorted followed by anti-Ig stimulation for 0 (-) and 5 min (+). Cell lysates were subjected to immunoblotting using antibody directed against phosphorylated ERK. Membranes were stripped and reprobed with ERK-specific antibody as a loading control. Results shown represent one of three independent experiments. (D) Purified splenic B cells were unstimulated (MED, bold line) or stimulated with anti-Ig (AS: ant-Ig stimulated B cells, fine line) for 24 hours. The resultant B cells were subjected to flow cytometric analysis using fluorescent anti-IgM monoclonal antibody or isotype control (IC, shaded area) or (E) immunoblotting using anti-Igα, and anti-Igβ antibodies. Membranes were stripped and reprobed with actin-specific antibody as a loading control. Results shown represent one of three independent experiments. (F) Purified splenic B cells were cultured in medium for 3 h (MED) or were treated with anti-Ig for 24 hours, followed by stimulation with anti-Ig for 0, 1, and 5 minutes. Cell lysates were subjected to immunoblotting using antibody directed against phosphorylated ERK. Membranes were stripped and reprobed with ERK-specific antibody as a loading control. Results shown represent one of three independent experiments.

We asked whether under normal, physiological in vivo conditions, Tfh cell-derived IL-4 potentiates pre-germinal center B cell activation. To address this issue, anti-HEL Ig transgenic B cell responses were evaluated in C57BL/6 mice, in view of the smaller and less synchronous antigen-specific responses of normal mice. C57BL/6 mice were immunized with HEL in alum i.p. (day 0). Anti-HEL Ig transgenic B cells were labeled with CFSE and injected into immunized mice at day 3 along with an HEL boost. Recipient mice received either 2.5 mg per mouse 11B11 neutralizing anti-IL-4 antibody or rat IgG1 isotype control antibody daily from day 3 to 5. B cells from recipient mice were then analyzed at day 6 before B cells migrate into germinal centers (27). As shown in Figure 7, a substantial number of CFSE-labeled anti-HEL Ig transgenic B cells responded as evidenced by replication, and proliferating CFSElow B cells expressed higher Igα (increased by 61.2 ± 7.8% (MFI, n=6)), Igβ (increased by 58.5 ± 11.7% (MFI, n=6)) and surface IgM (increased by 69.5 ± 10.6% (MFI, n=6)) relative to poorly responding and nonresponding CFSEhigh B cells. Although IgM is elevated in CFSElow B cells, surprisingly and unexpectedly, IgD expression is significantly lower (decreased by 62.7 ± 6.2% (MFI, n=6)) (Figure 7). Moreover, after stimulation with HEL, BCR signaling triggered more phosphorylated ERK (increased by 90.9 ± 12.7% (MFI, n=6)) in CFSElow as compared with CFSEhigh B cells. Most importantly, administration of neutralizing anti-IL-4 antibody markedly diminished elevated Igα (decreased by 78.6 ± 9.2% (MFI, n=6)), Igβ (decreased by 75.7 ± 11.4% (MFI, n=6)) and surface IgM (decreased by 66.8 ± 8.4% (MFI, n=6)) expression, and HEL-stimulated ERK phosphorylation (decreased by 64.6 ± 11.3% (MFI, n=6)). Interestingly, pre-germinal center B cells continue to express low level of surface IgD (increased by 7.6 ± 8.8% (MFI, n=6)) after administration of neutralizing anti-IL-4 antibody (Figure 7), suggesting that expression of surface IgM and IgD is differentially regulated in immune responses. These results strongly suggest that IL-4 is responsible for enhancing BCR signaling in vivo as it is in vitro, through a mechanism involving upregulated expression of Igα, Igβ and surface IgM.

Figure 7.

Figure 7

Open in a new tab

IL-4 enhances B cell activation in vivo. C57BL/6 mice were immunized with HEL and injected with neutralizing anti-IL-4 antibody (11B11) or isotype control rat IgG1 antibody as described in Materials and Methods. At day 6, splenic cells from recipient mice were analyzed by flow cytometry for expression of B220 and CFSE. B220+ B cells were gated for high (non-proliferating) and low (proliferating) labeling of CFSE. These fractions (CFSEhi, CFSElo, and 11B11CFSElo) were analyzed by flow cytometry for Igα, Igβ, and surface expression of IgM and IgD. Separately, spleen cells were stimulated with HEL, permeabilized, and immunofluorescently stained for phospho-ERK expression. Results represent one of 2 independent experiments with 3 mice per group.

Discussion

In this study, we found for the first time that IL-4 induces upregulated expression of Igα and Igβ proteins, that elevated Igα/β associates with IgM and results in increased surface IgM expression, that increased surface IgM leads to enhanced anti-Ig-initiated B cell activation and proliferation, and that similar IL-4-dependent changes occur during an immune response in vivo.

Primary B cells express two forms of IgM with different molecular sizes representing different maturation stages. Maturation and membrane translocation of IgM require association with Igα and Igβ heterodimers (32, 33), suggesting that the amount of heterodimeric Igα/β is the key factor in determining IgM status. We found that IL-4 markedly upregulates Igα and Igβ expression, and that isolated over-expression of Igα and Igβ upregulates surface IgM. Thus, our results strongly suggest that IL-4-induced Igα and Igβ protein expression plays a pivotal role in IL-4-induced enhancement of IgM maturation and IgM surface expression in mouse and probably human B cells (38). These findings are specific for IL-4, as they were not reproduced by IL-21.

We found that BCR engagement of IL-4-treated B cells in which surface IgM is increased results in amplified BCR signaling and B cell proliferation in vitro. We extended this study in an animal model and found that IL-4-induced up-regulation of Igα, Igβ, surface IgM, and BCR-initiated signaling was recapitulated in vivo during the pre-germinal center phase. In immune responses, B cell activation follows a particular pathway that includes three stages: 1. In the antigen-priming stage, B cells are primed by macrophage or dendritic cell-associated antigen; antigen priming facilitates B cell migration to the interface of the T and B cell zones; 2. In the interacting stage, a mutual interaction between B and T cells occurs, and B cells are prepared in this stage for subsequent antigen activation in the germinal center compartment; 3. In the activation stage, B cells are activated by FDC-associated antigen in the germinal center and undergo expansion and somatic hypermutation. Tfh cells are the only source for IL-4 in germinal center immune responses, suggesting that only B cells in stages 2 and 3 access an IL-4 environment. Although B cells in stage 3 are exposed to abundant IL-4, they simultaneously encounter antigen and, therefore, exhibit features of post-activated cells, expressing low levels of surface IgM, Igα, and Igβ and hypo-responding to antigen stimulation. In stage 2, B cells are activated by cognate Tfh cells and start to express Bcl6, an indication of the germinal center B cell commitment pathway (12), but still reside in the periphery of the B cell follicle. At this stage B cells are termed pre-germinal center B cells.

Pre-germinal center B cells present processed cognate antigen for T cell re-activation, a requirement for rapid IL-4 expression in Tfh cells (39), and obtain T cell help in the form of IL-4, as well as other ligands. From here, B cells are exposed to an IL-4-rich environment for approximately 3 days before further migration into the follicle during which B cells are activated by FDC-associated antigens. Although most of IL-4-secreting Tfh cells reside in germinal centers in the late phase of immunization or infection (8, 15, 16), the first wave of IL-4-secreting Tfh cells appear in the follicle periphery though with low frequency (8). The dose threshold for IL-4 to affect B cells is very low (data not shown), and Tfh cell-derived IL-4 can permeate the reactive lymph node (40), suggesting that Tfh cell-derived IL-4 from a low frequency population is sufficient to affect B cells. Consistent with this we found that proliferating pre-germinal center B cells express up-regulated surface IgM, Igα, Igβ, and BCR-stimulated ERK phosphorylation that rely on the presence of IL-4. Importantly, we found that “one pulse” transient antigen stimulation did not affect subsequent IL-4-enhanced BCR-initiated B cell activation. This is quite different from the situation that exists after B cells migrate into follicles to form germinal centers, after which it is thought that B cells are activated continuously by FDC associated antigen. Thus, our in vitro protocol models stage 2 of in vivo pre-germinal center B cell stimulation. In contrast to “one pulse”, transient antigen stimulation, continuous antigen stimulation down-regulates surface IgM as well as Igα and Igβ expression (37), as is found in germinal center B cells.

Tfh cells secrete IL-4 and IL-21 that play a compensatory role in regulating germinal center formation (18). In the present study, we found that IL-4 upregulates surface IgM expression by inducing substantial Igα and Igβ expression. Elevated surface IgM facilitates antigen uptake from FDC. Although IL-21 neither induces Igα and Igβ nor surface IgM expression, it can facilitate B cell spreading for antigen collection (our unpublished observation). Efficient B cell spreading and antigen collection are essential for immune responses (41). Thus, it seems that IL-4 and IL-21 play synergistic but nonoverlapping roles in the collection of antigen.

In B cells, IL-4 activates two signaling pathways mediated by STAT6 and IRS-2 (36). Our results indicate that IL-4-induced upregulated Igα and Igβ, as well as increased IgM maturation and surface expression, are mediated by STAT6, which typically operates as a transcription factor to regulate gene expression. However, Igα and Igβ transcripts are little increased by IL-4, in contrast to the marked IL-4-induced increase in Igα and Igβ protein, suggesting that expression of Igα and Igβ in transcripts and protein is uncoupled. However, the underlying mechanism remains to be explored. Still, the constitutively high levels of Igα and Igβ mRNA, and low but inducible levels of Igα and Igβ protein, suggest that in this respect B cells are “ready and waiting” to rapidly upregulate the intensity of BCR signaling during immune responses involving IL-4.

Although Lyn is considered to be a key src family kinase in BCR signal initiation, it can be compensated by other Src family kinases, such as Fyn and Blk (42). Moreover, Lyn has been demonstrated to be a negative regulator of B cell activation (43). However, as shown here, after IL-4 treatment Lyn is required for enhanced BCR-triggered ERK phosphorylation. This is, to our knowledge, the first direct evidence that Lyn plays an irreplaceable, positive role in the regulation of BCR signaling. Our results might explain why Lyn-deficient mice fail to generate germinal centers or humoral immune responses when immunized with low doses of antigen (44). In this view, Lyn is a central molecule for optimal B cell activation, which is a prerequisite for germinal center formation, through its connection to IL-4-induced upregulated Igα and Igβ protein, increased IgM surface expression, and enhanced BCR signaling, which is particularly important at limiting antigen doses. And Lyn has been demonstrated to be critical for IL-4-enhanced, BCR-triggered proliferation (30). However, although IL-4-enhanced BCR signaling is mediated by Lyn, IL-4 and Lyn are not completely synonymous in that Lyn-deficient mice fail to generate germinal centers (44) whereas IL-4 receptor deficiency produces only attenuation of germinal center size (16, 19). Regardless of these differences, all together our results indicate that the IL-4 receptor, via STAT6, “crosstalks” to the BCR by upregulating surface immunoglobulin complex constituents that program for enhanced BCR-mdiated, Lyn-dependent signaling and B cell expansion in response to subsequently occurring BCR engagement.

Footnotes

1

This work was supported by USPHS grant AI075141 awarded by the national Institutes of Health.

The authors declare that they have no completing financial interests.

References

  • 1.Reth M, Wienands J. Initiation and processing of signals from the B cell antigen receptor. Annu Rev Immunol. 1997;15:453–479. doi: 10.1146/annurev.immunol.15.1.453. [DOI] [PubMed] [Google Scholar]
  • 2.DeFranco AL. The complexity of signaling pathways activated by the BCR. Curr Opin Immunol. 1997;9:296–308. doi: 10.1016/s0952-7915(97)80074-x. [DOI] [PubMed] [Google Scholar]
  • 3.Allen CD, Okada T, Cyster JG. Germinal-center organization and cellular dynamics. Immunity. 2007;27:190–202. doi: 10.1016/j.immuni.2007.07.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Batista FD, Harwood NE. The who, how and where of antigen presentation to B cells. Nat Rev Immunol. 2009;9:15–27. doi: 10.1038/nri2454. [DOI] [PubMed] [Google Scholar]
  • 5.Qi H, Egen JG, Huang AY, Germain RN. Extrafollicular activation of lymph node B cells by antigen-bearing dendritic cells. Science. 2006;312:1672–1676. doi: 10.1126/science.1125703. [DOI] [PubMed] [Google Scholar]
  • 6.Damdinsuren B, Zhang Y, Khalil A, Wood WH, 3rd, Becker KG, Shlomchik MJ, Sen R. Single round of antigen receptor signaling programs naive B cells to receive T cell help. Immunity. 2010;32:355–366. doi: 10.1016/j.immuni.2010.02.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Kerfoot SM, Yaari G, Patel JR, Johnson KL, Gonzalez DG, Kleinstein SH, Haberman AM. Germinal center B cell and T follicular helper cell development initiates in the interfollicular zone. Immunity. 2011;34:947–960. doi: 10.1016/j.immuni.2011.03.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Reinhardt RL, Liang HE, Locksley RM. Cytokine-secreting follicular T cells shape the antibody repertoire. Nat Immunol. 2009;10:385–393. doi: 10.1038/ni.1715. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Suzuki K, Maruya M, Kawamoto S, Sitnik K, Kitamura H, Agace WW, Fagarasan S. The sensing of environmental stimuli by follicular dendritic cells promotes immunoglobulin A generation in the gut. Immunity. 33:71–83. doi: 10.1016/j.immuni.2010.07.003. [DOI] [PubMed] [Google Scholar]
  • 10.Qi H, Cannons JL, Klauschen F, Schwartzberg PL, Germain RN. SAP-controlled T-B cell interactions underlie germinal centre formation. Nature. 2008;455:764–769. doi: 10.1038/nature07345. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Choi YS, Kageyama R, Eto D, Escobar TC, Johnston RJ, Monticelli L, Lao C, Crotty S. ICOS receptor instructs T follicular helper cell versus effector cell differentiation via induction of the transcriptional repressor Bcl6. Immunity. 2011;34:932–946. doi: 10.1016/j.immuni.2011.03.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Kitano M, Moriyama S, Ando Y, Hikida M, Mori Y, Kurosaki T, Okada T. Bcl6 protein expression shapes pre-germinal center B cell dynamics and follicular helper T cell heterogeneity. Immunity. 2011;34:961–972. doi: 10.1016/j.immuni.2011.03.025. [DOI] [PubMed] [Google Scholar]
  • 13.McAdam AJ, Greenwald RJ, Levin MA, Chernova T, Malenkovich N, Ling V, Freeman GJ, Sharpe AH. ICOS is critical for CD40-mediated antibody class switching. Nature. 2001;409:102–105. doi: 10.1038/35051107. [DOI] [PubMed] [Google Scholar]
  • 14.Grewal IS, Flavell RA. CD40 and CD154 in cell-mediated immunity. Annu Rev Immunol. 1998;16:111–135. doi: 10.1146/annurev.immunol.16.1.111. [DOI] [PubMed] [Google Scholar]
  • 15.Yusuf I, Kageyama R, Monticelli L, Johnston RJ, Ditoro D, Hansen K, Barnett B, Crotty S. Germinal center T follicular helper cell IL-4 production is dependent on signaling lymphocytic activation molecule receptor (CD150) J Immunol. 2010;185:190–202. doi: 10.4049/jimmunol.0903505. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.King IL, Mohrs M. IL-4-producing CD4+ T cells in reactive lymph nodes during helminth infection are T follicular helper cells. J Exp Med. 2009;206:1001–1007. doi: 10.1084/jem.20090313. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Kopf M, Le Gros G, Bachmann M, Lamers MC, Bluethmann H, Kohler G. Disruption of the murine IL-4 gene blocks Th2 cytokine responses. Nature. 1993;362:245–248. doi: 10.1038/362245a0. [DOI] [PubMed] [Google Scholar]
  • 18.Ozaki K, Spolski R, Feng CG, Qi CF, Cheng J, Sher A, Morse HC, 3rd, Liu C, Schwartzberg PL, Leonard WJ. A critical role for IL-21 in regulating immunoglobulin production. Science. 2002;298:1630–1634. doi: 10.1126/science.1077002. [DOI] [PubMed] [Google Scholar]
  • 19.Cunningham AF, Serre K, Toellner KM, Khan M, Alexander J, Brombacher F, MacLennan IC. Pinpointing IL-4-independent acquisition and IL-4-influenced maintenance of Th2 activity by CD4 T cells. Eur J Immunol. 2004;34:686–694. doi: 10.1002/eji.200324510. [DOI] [PubMed] [Google Scholar]
  • 20.Vajdy M, Kosco-Vilbois MH, Kopf M, Kohler G, Lycke N. Impaired mucosal immune responses in interleukin 4-targeted mice. J Exp Med. 1995;181:41–53. doi: 10.1084/jem.181.1.41. [DOI] [PubMed] [Google Scholar]
  • 21.Howard M, Farrar J, Hilfiker M, Johnson B, Takatsu K, Hamaoka T, Paul WE. Identification of a T cell-derived b cell growth factor distinct from interleukin 2. J Exp Med. 1982;155:914–923. doi: 10.1084/jem.155.3.914. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Rabin EM, Ohara J, Paul WE. B-cell stimulatory factor 1 activates resting B cells. Proceedings of the National Academy of Sciences of the United States of America. 1985;82:2935–2939. doi: 10.1073/pnas.82.9.2935. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Oliver K, Noelle RJ, Uhr JW, Krammer PH, Vitetta ES. B-cell growth factor (B-cell growth factor I or B-cell-stimulating factor, provisional 1) is a differentiation factor for resting B cells and may not induce cell growth. Proceedings of the National Academy of Sciences of the United States of America. 1985;82:2465–2467. doi: 10.1073/pnas.82.8.2465. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Goodnow CC, Crosbie J, Adelstein S, Lavoie TB, Smith-Gill SJ, Brink RA, Pritchard-Briscoe H, Wotherspoon JS, Loblay RH, Raphael K, et al. Altered immunoglobulin expression and functional silencing of self-reactive B lymphocytes in transgenic mice. Nature. 1988;334:676–682. doi: 10.1038/334676a0. [DOI] [PubMed] [Google Scholar]
  • 25.Chan VW, Meng F, Soriano P, DeFranco AL, Lowell CA. Characterization of the B lymphocyte populations in Lyn-deficient mice and the role of Lyn in signal initiation and down-regulation. Immunity. 1997;7:69–81. doi: 10.1016/s1074-7613(00)80511-7. [DOI] [PubMed] [Google Scholar]
  • 26.Lyons AB, Parish CR. Determination of lymphocyte division by flow cytometry. J Immunol Methods. 1994;171:131–137. doi: 10.1016/0022-1759(94)90236-4. [DOI] [PubMed] [Google Scholar]
  • 27.Coffey F, Alabyev B, Manser T. Initial clonal expansion of germinal center B cells takes place at the perimeter of follicles. Immunity. 2009;30:599–609. doi: 10.1016/j.immuni.2009.01.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Krutzik PO, Nolan GP. Intracellular phospho-protein staining techniques for flow cytometry: monitoring single cell signaling events. Cytometry Part A : the journal of the International Society for Analytical Cytology. 2003;55:61–70. doi: 10.1002/cyto.a.10072. [DOI] [PubMed] [Google Scholar]
  • 29.Guo B, Blair D, Chiles TC, Lowell CA, Rothstein TL. Cutting Edge: B cell receptor (BCR) cross-talk: the IL-4-induced alternate pathway for BCR signaling operates in parallel with the classical pathway, is sensitive to Rottlerin, and depends on Lyn. J Immunol. 2007;178:4726–4730. doi: 10.4049/jimmunol.178.8.4726. [DOI] [PubMed] [Google Scholar]
  • 30.Wang J, Koizumi T, Watanabe T. Altered antigen receptor signaling and impaired Fas-mediated apoptosis of B cells in Lyn-deficient mice. J Exp Med. 1996;184:831–838. doi: 10.1084/jem.184.3.831. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Nishizumi H, Taniuchi I, Yamanashi Y, Kitamura D, Ilic D, Mori S, Watanabe T, Yamamoto T. Impaired proliferation of peripheral B cells and indication of autoimmune disease in lyn-deficient mice. Immunity. 1995;3:549–560. doi: 10.1016/1074-7613(95)90126-4. [DOI] [PubMed] [Google Scholar]
  • 32.Hombach J, Leclercq L, Radbruch A, Rajewsky K, Reth M. A novel 34-kd protein co-isolated with the IgM molecule in surface IgM-expressing cells. EMBO J. 1988;7:3451–3456. doi: 10.1002/j.1460-2075.1988.tb03219.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Venkitaraman AR, Williams GT, Dariavach P, Neuberger MS. The B-cell antigen receptor of the five immunoglobulin classes. Nature. 1991;352:777–781. doi: 10.1038/352777a0. [DOI] [PubMed] [Google Scholar]
  • 34.Matsuuchi L, Gold MR, Travis A, Grosschedl R, DeFranco AL, Kelly RB. The membrane IgM-associated proteins MB-1 and Ig-beta are sufficient to promote surface expression of a partially functional B-cell antigen receptor in a nonlymphoid cell line. Proceedings of the National Academy of Sciences of the United States of America. 1992;89:3404–3408. doi: 10.1073/pnas.89.8.3404. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Jin L, Stolpa JC, Young RM, Pugh-Bernard AE, Refaeli Y, Cambier JC. MHC class II structural requirements for the association with Igalpha/beta, and signaling of calcium mobilization and cell death. Immunology letters. 2008;116:184–194. doi: 10.1016/j.imlet.2007.11.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Nelms K, Keegan AD, Zamorano J, Ryan JJ, Paul WE. The IL-4 receptor: signaling mechanisms and biologic functions. Annu Rev Immunol. 1999;17:701–738. doi: 10.1146/annurev.immunol.17.1.701. [DOI] [PubMed] [Google Scholar]
  • 37.Khalil AM, Cambier JC, Shlomchik MJ. B cell receptor signal transduction in the GC is short-circuited by high phosphatase activity. Science. 2012;336:1178–1181. doi: 10.1126/science.1213368. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Rigley KP, Thurstan SM, Callard RE. Independent regulation of interleukin 4 (IL-4)-induced expression of human B cell surface CD23 and IgM: functional evidence for two IL-4 receptors. Int Immunol. 1991;3:197–203. doi: 10.1093/intimm/3.2.197. [DOI] [PubMed] [Google Scholar]
  • 39.Scheu S, Stetson DB, Reinhardt RL, Leber JH, Mohrs M, Locksley RM. Activation of the integrated stress response during T helper cell differentiation. Nat Immunol. 2006;7:644–651. doi: 10.1038/ni1338. [DOI] [PubMed] [Google Scholar]
  • 40.Perona-Wright G, Mohrs K, Mohrs M. Sustained signaling by canonical helper T cell cytokines throughout the reactive lymph node. Nat Immunol. 2011;11:520–526. doi: 10.1038/ni.1866. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Fleire SJ, Goldman JP, Carrasco YR, Weber M, Bray D, Batista FD. B cell ligand discrimination through a spreading and contraction response. Science. 2006;312:738–741. doi: 10.1126/science.1123940. [DOI] [PubMed] [Google Scholar]
  • 42.Saijo K, Schmedt C, Su IH, Karasuyama H, Lowell CA, Reth M, Adachi T, Patke A, Santana A, Tarakhovsky A. Essential role of Src-family protein tyrosine kinases in NF-kappaB activation during B cell development. Nat Immunol. 2003;4:274–279. doi: 10.1038/ni893. [DOI] [PubMed] [Google Scholar]
  • 43.Chan VW, Lowell CA, DeFranco AL. Defective negative regulation of antigen receptor signaling in Lyn-deficient B lymphocytes. Curr Biol. 1998;8:545–553. doi: 10.1016/s0960-9822(98)70223-4. [DOI] [PubMed] [Google Scholar]
  • 44.Hibbs ML, Tarlinton DM, Armes J, Grail D, Hodgson G, Maglitto R, Stacker SA, Dunn AR. Multiple defects in the immune system of Lyn-deficient mice, culminating in autoimmune disease. Cell. 1995;83:301–311. doi: 10.1016/0092-8674(95)90171-x. [DOI] [PubMed] [Google Scholar]

RESOURCES