Skip to main content
PLOS One logoLink to PLOS One
. 2015 Jun 5;10(6):e0128509. doi: 10.1371/journal.pone.0128509

Quorum Sensing Controls Swarming Motility of Burkholderia glumae through Regulation of Rhamnolipids

Arvin Nickzad 1, François Lépine 1, Eric Déziel 1,*
Editor: Michael M Meijler2
PMCID: PMC4457897  PMID: 26047513

Abstract

Burkholderia glumae is a plant pathogenic bacterium that uses an acyl-homoserine lactone-mediated quorum sensing system to regulate protein secretion, oxalate production and major virulence determinants such as toxoflavin and flagella. B. glumae also releases surface-active rhamnolipids. In Pseudomonas aeruginosa and Burkholderia thailandensis, rhamnolipids, along with flagella, are required for the social behavior called swarming motility. In the present study, we demonstrate that quorum sensing positively regulates the production of rhamnolipids in B. glumae and that rhamnolipids are necessary for swarming motility also in this species. We show that a rhlA- mutant, which is unable to produce rhamnolipids, loses its ability to swarm, and that this can be complemented by providing exogenous rhamnolipids. Impaired rhamnolipid production in a quorum sensing-deficient B. glumae mutant is the main factor responsible for its defective swarming motility behaviour.

Introduction

Burkholderia glumae is a notorious phytopathogen of rice that uses a LuxI/LuxR-type quorum sensing (QS) system to regulate diverse cellular processes such as protein secretion, oxalate production and expression of major known virulence factors, including toxoflavin, lipase, KatG and flagella [14]. In B. glumae, the TofR QS regulator is activated by the N-octanoyl homoserine lactone (C8-HSL) autoinducer, the product of the TofI N-acyl homoserine lactone synthase, to control the expression of the target genes [5].

Among major virulence determinants of B. glumae, flagellum-driven motility plays a critical role in its pathogenicity [1]. Besides swimming motility, this bacterium is also able to spread by a social motility behaviour called swarming motility, which typically requires both functional flagella and production of a surface-wetting agent (surfactant) [6]. Since swarming is a multicellular behaviour, in many bacteria it is dependent on QS regulation [7]. QS modulates swarming motility by diverse mechanisms, either by regulating the flagellar machinery and propulsive force, or by inducing the expression of wetting agent biosynthesis pathways [8]. For instance, in B. glumae, QS positively regulates the expression of flagellar biosynthesis genes, which are essential for swarming motility [1]. Furthermore, in B. glumae, growth temperature also regulates flagellar morphogenesis [9]. Indeed, while a QS-deficient mutant is aflagellated at 37°C and thus does not exhibit swarming nor swimming motilities, it retains normal flagella and motility at 28°C, which shows that flagellum formation requires QS at 37°C but not at 28°C [1]. The wetting agent allowing swarming motility of B. glumae has not been identified yet. In some swarming bacteria, such as Pseudomonas aeruginosa and Burkholderia thailandensis, this social motility behaviour is promoted by the production of rhamnolipids [1012]. We have previously reported that B. glumae also is capable of rhamnolipids production and carries a rhl operon homologous to those responsible for rhamnolipid biosynthesis in B. thailandensis, Burkholderia pseudomallei and P. aeruginosa [13].

Here we investigate the regulation and role of rhamnolipids in B. glumae. We confirm that a rhlA - mutant which lacks rhamnolipid production completely loses its ability to swarm. Furthermore, we show that QS positively regulates rhamnolipid production, and thus swarming motility. Importantly, although QS is necessary for flagellar motility at 37°C, our results demonstrate that the observed lack of swarming at lower temperatures solely goes through QS-dependent regulation of rhamnolipid production. Given that QS regulates many virulence determinants in B. glumae, such as flagellar motility, rhamnolipids, as factors involved in surface-associated motility might contribute to the pathogenicity of this bacterium.

Materials and Methods

Bacterial strains, plasmids, media and growth conditions

All B. glumae strains used are derivatives of the wild-type strain BGR1 and are listed in Table 1. Unless otherwise specified, the bacteria were routinely grown from frozen stocks by culturing at 37°C in tryptic soy broth (TSB) (BD) and 240 rpm in a TC-7 roller drum (New Brunswick, Canada), or on TSB agar plates. Antibiotics were used at the following concentrations: tetracycline (Tc), 10 μg ml-1, gentamycin (Gm), 20 μg ml-1 and triclosan 25 μg ml-1.

Table 1. Bacterial strains and plasmids.

Bacteria Relevant characteristics Source or reference
E. coli
DH5α F-, φ80dlacZΔM15, Δ(lacZYA-argF)U169, deoR, recA1, endA1, hsdR17(rk-, mk+), phoA, supE44, λ-, thi-1, gyrA96, relA1 [14]
SM10 λpir thi-1 thr leu tonA lacY supE recA::RP4-2-Tc::Mu Kmr λpir [15]
B. glumae
BGR1 Wild-type, RifR [16]
BGS2 tofI::Ω in BGR1 [5]
ED2106 Deletion of rhlA in BGR1 This study
ED2123 BGR1::pAN2 This study
ED2124 BGS2::pAN2 This study
Plasmids
pEX18Gm Gmr, oriT+ sacB+, gene replacement vector with multiple cloning site from pUC18 [17]
pFTC1 Tetracycline resistance cassette FRT vector, TetR [18]
pFLPe4 Curable Flp recombinase expression vector, KmR [19]
mini-CTX-lux Integration vector with promoterless luxCDABE [20]
pAN1 pEX18Gm with 5’ and 3’ fragments of rhlA interrupted by a TcR cassette This study
pAN2 rhlA promoter fused to luxCDABE in mini-CTX-lux This study

For swarming and swimming assays, plates consisted of modified M9 medium [20 mM NH4Cl; 12 mM Na2HPO4; 22 mM KH2PO4; 8.6 mM NaCl; 1 mM MgSO4; 1 mM CaCl2·2H2O; 11 mM dextrose; 0.5% casamino acids (Difco)], solidified with 0.5% or 0.25% Bacto-agar (Difco) respectively [11]. The method was essentially as before [21], except that plates were allowed to dry for 30 min, and 34°C was chosen as the incubation temperature. These key parameters which affect swarming were optimized for B. glumae in order to maximize the reproducibility of swarm plate results. One ml of an overnight culture of each strain was adjusted to OD600 3.0, centrifuged and washed twice with phosphate-buffer saline (PBS) and suspended in 100 μl PBS. To inoculate the plates, 5 μl (swarming) or 1 μl (swimming) of bacteria suspension were spotted in the center. Five replicates were performed for every test and the experiments were performed three times, independently.

The same medium as above without agar was used for production of rhamnolipids in liquid cultures. To determine whether rhamnolipid production could be restored by exogenous addition of signal molecules, culture media were supplemented with 8 μM C8-HSL (Sigma-Aldrich). The extract of B. glumae rhamnolipids used for complementation of swarming was obtained as described previously [22].

Mutant and reporter construction

Plasmids utilized are listed in Table 1. A rhlA - mutant was generated by allelic replacement with a fragment of gene bglu_2g05650 (rhlA) containing a TcR resistance cassette flanked by FLP recognition target (FRT) sites. To accomplish this, a 862 bp DNA fragment corresponding to the 5’ end of rhlA and adjacent chromosomal sequences was amplified using primers VDrhlA2F and VDrhlA2R, and a 763 bp DNA fragment corresponding to the 3’ end of rhlA and its adjacent sequences was amplified using VDrhlA3F and VDrhlA3R (Table 2). A 2014 bp TcR resistance cassette was amplified from the pFTC1 plasmid with 50-bp overhang sequences identical to the adjacent region fragments by using primers VDrhlA1F and VDrhlA1R. In a second amplification, the three PCR products were joined together and amplified using the primer pair VDrhlA2F/VDrhlA3R. The resulting 3639 bp PCR product was T/A cloned into the pGEM-T Easy Vector (Promega, Madison, WI, USA), excised by EcoRI digestion and finally ligated into the corresponding site of pEX18Gm [17]. This construct, pAN1, was introduced into B. glumae BGR1 by conjugation with donor E. coli SM10λpir and the recombinants were selected on LB agar with Tc (10 μg ml-1) while E. coli was inhibited with triclosan (25 μg ml-1). To counterselect for bacteria that had undergone a double crossover event, colonies were streaked onto LB agar supplemented with sucrose (30%) and Tc (10 μg ml-1). Gm-sensitive colonies were analyzed by PCR to verify that rhlA had been successfully replaced with a mutated copy of the allele. Finally, the TcR cassette was excised by Flp-mediated recombination, using pFLPe4 [19]. The Flp-mediated removal of the TcR cassette was confirmed by PCR.

Table 2. PCR Primers.

Oligonucleotides Sequence (5’→ 3’)
VDrhlA2F CCTGGAATTTTTCCCGTTTT
VDrhlA2R CAGGTCGAAGCAGATGGAAT
VDrhlA3F GCGAGCTCGACGAATACAC
VDrhlA3R ACACCTGCACCGACACGTAG
VDrhlA1F AGACCGTGCGCTACCTCGGCGAGCGGCTCAATTCCATCTGCTT
VDrhlA1R GCTGCCGAGCCGGCGCACGTCGGCGGGGGTGGTGTATTCGTCGAGCTCC
promrhlAF ACGTAGAATTCGGGAAAGCAGGCAGGGTAG
promrhlAR ACGTAAAGCTTTTTCGATAGGCATGGCGTACTC

Transcriptional fusion strains of B. glumae were constructed by PCR amplification of a 923-bp fragment containing the promoter region of rhlA from BGR1 genome using primers promrhlAF and promrhlAR (Table 2). The PCR product was digested with EcoRI and HindIII and ligated within the corresponding sites in mini-CTX-lux [20]. The resulting construct was integrated into BGR1 and tofI - mutant chromosome at the attB site through conjugation. Successful chromosomal integration of construct in BGR1 and tofI - mutant was verified by PCR.

LC/MS rhamnolipid analysis

The rhamnolipid concentration in the various bacterial cultures was determined by LC/MS [23]. During a period of six days, 400 μl culture samples were retrieved at regular time intervals and the OD600 was measured (Nanodrop ND-1000, Thermo Fisher Scientific). Then the samples were centrifuged at 16,000 × g for 10 min. to remove the bacteria. To 300 μl of supernatant, 300 μl acetonitrile containing 20 mg/L 5,6,7,8-tetradeutero-4-hydroxy-2-heptylquinoline (HHQ-d4) as the internal standard were added [12]. Samples were analyzed by high-performance liquid chromatography (HPLC; Waters 2795, Mississauga, ON, Canada) equipped with a C8 reverse-phase column (Kinetex, Phenomenex) using a water/acetonitrile gradient with a constant 2 mmol l-1 concentration of ammonium acetate [12]. The detector was a mass spectrometer (Quattro Premier XE, Waters). Analyses were carried out in the negative electrospray ionization (ESI-) mode.

Measurement of rhlA’-lux expression

Expression from the rhl operon promoter in wild-type and QS-defective tofI - strains was quantified by measuring the luminescence of cultures of bacteria containing a transcriptional fusion of the rhlA promoter with the luciferase gene integrated in the genome. Cells from overnight cultures were washed twice in PBS and inoculated into 5 ml of liquid swarming medium at an initial OD600 = 0.05. The cultures were grown at 34°C with shaking (240 rpm) in a roller drum. At regular time intervals 200 μl culture samples were retrieved and the OD600 and luminescence (relative light units, RLU) were measured using a multimode plate reader (Cytation3, BioTek, Winooski, VT). The luminescence (rhlA-lux activity) corrected for culture density (RLU/OD600) was determined at the peak of rhlA expression after 10 h of incubation.

Results

Rhamnolipid production is necessary for B. glumae swarming motility

To verify whether rhamnolipids are involved in swarming motility of B. glumae, a rhlA - mutant was constructed in the wild-type strain BGR1 background and confirmed to have completely lost its ability to produce rhamnolipids (Fig 1). Investigating swarming motility showed that BGR1 exhibits a typical dendritic pattern formation, while the rhlA - mutant is unable to swarm (Fig 2a and 2b). We then examined whether the rhlA - mutant could recover its swarming phenotype by using the rhamnolipids produced by the wild-type strain. To do so, the rhlA - mutant and the wild-type strain were both inoculated on the same plate separated by distance of 2 cm between the inoculation points. The results show that the rhlA - mutant can exploit the rhamnolipids produced by the neighbouring wild-type colony and exhibit swarming (Fig 2d). Similarly, the rhlA - mutant could regain swarming motility when supplied with exogenous rhamnolipids: a drop of B. glumae rhamnolipids at 1 cm from the inoculation point of the rhlA - mutant was sufficient to induce swarming (Fig 2f), indicating that rhamnolipids are the only factor missing for swarming of that mutant, and likely the element provided by the WT colony in Fig 2d.

Fig 1. Rhamnolipids production of various B. glumae strains.

Fig 1

Bacteria were grown in liquid swarming medium for 24 hours at 34°C. The mutant rhlA - is not capable of producing rhamnolipids. While the production of rhamnolipids by the tofI - mutant is almost abrogated, near wild-type production level are restored upon exogenous addition of 8 μM C8-HSL. The C8-HSL addition to wild-type does not significantly modify its rhamnolipid production. The error bars indicate the standard deviation of the mean for three independent cultures.

Fig 2. Swarming motilities of various B. glumae strains.

Fig 2

Plates were incubated for 18 hours at 34°C. (a) Wild-type strain BGR1. (b) rhlA - mutant which is not capable to produce rhamnolipids completely loses its swarming phenotype. (c) Swarming of quorum sensing signal negative tofI - mutant is essentially abolished. (d) Wild-type strain (right) and rhlA - mutant (left) were placed on the same plate separated by a 2 cm distance between the inoculation points. The rhlA - mutant, which is incapable of swarming by itself, recovers its swarming phenotype by using the rhamnolipids diffusing from the wild-type strain colony. (e) Swarming motility of the tofI - mutant is recovered by exogenous addition of 8 μM C8-HSL to the swarming medium. (f) The rhlA - mutant recovers its swarming following exogenous supply of rhamnolipids, applied as a 5 μl drop of a 100 mg/ml rhamnolipids methanol solution on the surface of the swarming medium prior from inoculation at a 1 cm distance. (g) The addition of rhamnolipids to the swarming medium was performed like in (f), and similarly promotes the swarming of the tofI - mutant.

Quorum sensing modulates swarming motility of B. glumae through regulation of rhamnolipid production

Earlier studies have demonstrated the lack of swarming motility in a QS signal-negative mutant (tofI -) of strain BGR1 at both 28°C and 37°C [1]. While at 37°C the tofI - mutant is aflagellated, at 28°C the flagella are present and functional, leaving unexplained the non-swarming phenotype at 28°C. Since QS-controlled wetting agents are essential for swarming motility in other bacteria, we tested QS-dependent regulation of biosurfactant biosynthesis in B. glumae through examining the swarming motility of the wild-type strain BGR1 and tofI - mutant.

Swarming motility of the tofI - mutant was significantly reduced (Fig 2c) and the normal phenotype was restored by adding C8-HSL to the plates (Fig 2e). To investigate whether this impaired swarming motility is due to the lack of a surface wetting agent, we examined the production of rhamnolipids by the tofI - mutant grown in liquid culture, and measured a near-complete loss of production. Furthermore, exogenous addition of C8-HSL restored the production of rhamnolipids by the tofI - mutant to wild-type level (Fig 1).

Using a rhlA-lux reporter gene fusion, we found that transcription from the rhl operon promoter in the tofI - mutant was only 15% of wild-type levels, and was complemented by the exogenous addition of C8-HSL (Fig 3), demonstrating that QS positively regulates the expression of the rhl operon in B. glumae.

Fig 3. Expression from the rhl operon promoter in wild-type and tofI - strains carrying a chromosomal rhlA’-lux transcriptional reporter.

Fig 3

Cultures were performed in liquid swarming medium cultures at 34°C for 10 h. The activity of rhlA-lux is significantly lower in the tofI - mutant than the wild-type strain and increases with the addition of 8 μM C8-HSL to the culture medium. The error bars indicate the standard deviation of the mean for three independent experiments.

To verify whether the decreased swarming of the tofI - mutant is solely due to the decreased production of rhamnolipids, we tested the swarming of the tofI - with exogenous addition of rhamnolipids. Similar to the rhlA- mutant (Fig 2f), the tofI - mutant swarming defect was complemented by exogenous rhamnolipids (Fig 2g). Overall, these results demonstrate that rhamnolipids are positively regulated by QS in B. glumae and that QS directs swarming motility of B. glumae through rhamnolipids regulation.

As mentioned above, in B. glumae QS is required for the formation of flagella at 37°C, but not at 28°C [9]. Since we carried out our swarming assays at 34°C, the temperature found optimal for the development of well-defined B. glumae migrating tendrils, there was a possibility that lack of swarming of the tofI - mutant was due mainly to the absence of flagella, as 34°C is closer to 37°C than to 28°C. Thus, in order to ascertain that the abrogated swarming of the tofI - mutant (Fig 2c) is solely due to lack of rhamnolipids and not to defective flagella, we also compared the swarming of tofI - mutant at 28°C and 37°C. In accordance with results from Kim et al. (2007), the tofI - mutant was unable to swarm at 37°C, and at 28°C its swarming was essentially the same than at 34°C (Fig 4a and 4b). Accordingly, the tofI - mutant swarming defect at 28°C was restored by exogenous rhamnolipids but not at 37°C (Fig 4C). Furthermore, we examined flagella-driven swimming motility of the tofI - and rhlA -mutants at 34°C. In line with the data shown in Fig 2g indicating that impaired swarming of the tofI - mutant is merely due to the lack of rhamnolipid biosynthesis, swimming motility in the tofI - mutant was similar to that of the wild-type strain (Fig 5).

Fig 4. Swarming motility of tofI - mutant at 28°C and 37°C.

Fig 4

(a) Wild-type strain BGR1 exhibits swarming at both temperatures, however it has larger/less defined tendrils than at 34°C. (b) No swarming of the tofI - mutant is observed at 37°C, and at 28°C it is nearly abolished, like at 34°C (Fig 2c). (c) While the tofI - mutant recovers its swarming upon exogenous addition of rhamnolipids at 28°C, the complementation is not achieved at 37°C.

Fig 5. Swimming motility of B. glumae strains.

Fig 5

Motility capacity was measured by diameter of motility zone on swimming agar plates at 34°C. The error bars indicate the standard deviation of the mean for three independent experiments.

Discussion

Similar to B. pseudomallei, B. thailandensis and P. aeruginosa, B. glumae also produces extracellular surface-active rhamnolipids. Over the last two decades, the regulation of rhamnolipids via QS and their role in swarming motility and as virulence factors have been extensively characterized in P. aeruginosa [11,24,25]. However, these biosurfactants have been much less investigated in Burkholderia species. Previously, we have reported a role for rhamnolipids in the swarming motility of B. thailandensis [12]. However, no study had yet addressed the function and regulation of rhamnolipids in the phytopathogen B. glumae.

We have confirmed that rhamnolipids are necessary for swarming of B. glumae by generating a rhamnolipid-negative rhlA - mutant in the wild-type BGR1 model strain background and by complementing with rhamnolipids provided either by the wild-type strain or added exogenously to the medium.

Since in P. aeruginosa QS controls the expression of the rhlAB operon, responsible for rhamnolipid biosynthesis, we hypothesized that a similar regulatory system directs rhamnolipid biosynthesis in B. glumae. Indeed, we found that rhamnolipids are positively regulated by QS in this bacterium, adding this biosurfactant to the list of QS-dependent factors in B. glumae. Considering the dual regulation of polar flagellum genes and flagellar morphogenesis by QS and temperature in B. glumae [1,9], our finding is important to understand the mechanistic role of QS in regulation of factors contributing to swarming motility.

Previous studies have demonstrated that, while at 37°C the wild-type strain is capable of swimming and swarming motility, both of these motility phenotypes are strongly reduced in the tofI - mutant [1]. On the other hand, a QS-deficient mutant of strain BGR1 grown at 28°C retains its flagella and regains swimming, but is still incapable of swarming [1]. We thus reasoned that a swarming motility defect at lower temperatures could be due to lack of wetting agent production. A similar phenomenon was observed for Burkholderia cepacia and evidence was provided that its swarming motility might be controlled through QS-dependent regulation of biosurfactant biosynthesis [26]. Our results of normal swimming and defective swarming of the tofI - mutant at 34°C that can be complemented with rhamnolipids demonstrate that at a temperature where QS does not regulate flagellar morphogenesis, it controls swarming motility solely through rhamnolipid production. However, at higher temperatures such as 37°C, where flagellar biosynthesis is under control of QS, the tofI - mutant is aflagellated and hence exhibits no swarming even if the rhamnolipids are being provided exogenously. Furthermore, with regards to the swarming of the tofI - mutant at 28°C and 37°C, we can conclude that at 34°C the flagellar morphogenesis and swarming phenotype are similar to those at 28°C.

Many factors regulated by QS in B. glumae are virulence determinants (e.g. toxoflavin, flagella). Motility is important for virulence and there are many reports that non-motile strains of phytopathogenic bacteria are avirulent [1,27]; furthermore rhamnolipids contribute to the virulence of P. aeruginosa and B. pseudomallei [28,29]. Taken together, rhamnolipids might well contribute to the virulence of B. glumae through promotion of swarming motility.

It has been proposed that when environmental conditions (e.g. nutrient availability) are becoming less suitable for the bacteria, swarming motility promotes their dispersion towards finding new niches [30]. Since rhamnolipids are costly metabolites to produce, we can envisage that in a phytopathogenic bacterium such as B. glumae the regulation of rhamnolipids by QS enhances the efficacy of rhamnolipids by balancing their benefits to their cost of production in situations where they contribute the most to the survival and fitness [31].

Overall, our results demonstrate that rhamnolipids production is required for swarming motility of B. glumae, which could reflect a possible role in pathogenicity and survival in the host tissue. Therefore, elucidating the exact function of rhamnolipids in swarming motility and bacterial dispersal, combined with pathogenicity tests with the rhlA - mutant may provide insight into future strategies for controlling B. glumae virulence.

Acknowledgments

Thanks to You-Hee Cho (CHA University, South Korea) for providing strains BGR1 and BGS2. Special thanks to Marie-Christine Groleau for her insightful comments and to Sylvain Milot for his technical advice. The help of Valérie Dekimpe with the construction of the rhlA - mutant is gratefully acknowledged. ED holds a Canada Research Chair in Sociomicrobiology.

Data Availability

All relevant data are within the paper.

Funding Statement

Investigations on rhamnolipids in the ED laboratory are funded by the Natural Sciences and Engineering Research Council of Canada (NSERC) Discovery grant No. 312478. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1. Kim J, Kang Y, Choi O, Jeong Y, Jeong JE, Lim JY, et al. Regulation of polar flagellum genes is mediated by quorum sensing and FlhDC in Burkholderia glumae . Mol Microbiol. 2007;64(1):165–79. [DOI] [PubMed] [Google Scholar]
  • 2. Goo E, Kang Y, Kim H, Hwang I. Proteomic analysis of quorum sensing-dependent proteins in Burkholderia glumae . J Proteome Res. 2010;9(6):3184–99. 10.1021/pr100045n [DOI] [PubMed] [Google Scholar]
  • 3. Goo E, Majerczyk CD, An JH, Chandler JR, Seo YS, Ham H, et al. Bacterial quorum sensing, cooperativity, and anticipation of stationary-phase stress. Proc Natl Acad Sci U S A. 2012;109(48):19775–80. 10.1073/pnas.1218092109 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Chun H, Choi O, Goo E, Kim N, Kim H, Kang Y, et al. The quorum sensing-dependent gene katG of Burkholderia glumae is important for protection from visible light. J Bacteriol. 2009;191(13):4152–7. 10.1128/JB.00227-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Kim J, Kim JG, Kang Y, Jang JY, Jog GJ, Lim JY, et al. Quorum sensing and the LysR-type transcriptional activator ToxR regulate toxoflavin biosynthesis and transport in Burkholderia glumae . Mol Microbiol. 2004;54(4):921–34. [DOI] [PubMed] [Google Scholar]
  • 6. Kearns DB. A field guide to bacterial swarming motility. Nat Rev Microbiol. 2010;8(9):634–44. 10.1038/nrmicro2405 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Daniels R, Vanderleyden J, Michiels J. Quorum sensing and swarming migration in bacteria. FEMS Microbiol Rev. 2004;28(3):261–89. [DOI] [PubMed] [Google Scholar]
  • 8. Partridge JD, Harshey RM. Swarming: flexible roaming plans. J Bacteriol. 2013;195(5):909–18. 10.1128/JB.02063-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Jang MS, Goo E, An JH, Kim J, Hwang I. Quorum sensing controls flagellar morphogenesis in Burkholderia glumae . PLoS One. 2014;9(1):e84831 10.1371/journal.pone.0084831 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Köhler T, Curty LK, Barja F, van Delden C, Pechère JC. Swarming of Pseudomonas aeruginosa is dependent on cell-to-cell signaling and requires flagella and pili. J Bacteriol. 2000;182(21):5990–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Tremblay J, Richardson AP, Lépine F, Déziel E. Self-produced extracellular stimuli modulate the Pseudomonas aeruginosa swarming motility behaviour. Environ Microbiol. 2007;9(10):2622–30. [DOI] [PubMed] [Google Scholar]
  • 12. Dubeau D, Déziel E, Woods DE, Lépine F. Burkholderia thailandensis harbors two identical rhl gene clusters responsible for the biosynthesis of rhamnolipids. BMC Microbiol. 2009;9:263 10.1186/1471-2180-9-263 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Costa SGVAO, Déziel E, Lépine F. Characterization of rhamnolipid production by Burkholderia glumae . Lett Appl Microbiol. 2011;53(6):620–7. 10.1111/j.1472-765X.2011.03154.x [DOI] [PubMed] [Google Scholar]
  • 14. Hanahan D. Techniques for transformation of E. coli . DNA cloning. 1985;1:109–35. [Google Scholar]
  • 15. Simon R, Priefer U, Puhler A. A road host range mobilization system for invivo genetic-engineering—ransposon mutagenesis in Gram-negative bacteria. Bio-Technol. 1983;1(9):784–91. [Google Scholar]
  • 16. Jeong Y, Kim J, Kim S, Kang Y, Nagamatsu T, Hwang I. Toxoflavin produced by Burkholderia glumae causing rice grain rot is responsible for inducing bacterial wilt in many field crops. Plant Dis. 2003;87(8):890–5. [DOI] [PubMed] [Google Scholar]
  • 17. Hoang TT, Karkhoff-Schweizer RR, Kutchma AJ, Schweizer HP. A broad-host-range Flp-FRT recombination system for site-specific excision of chromosomally-located DNA sequences: application for isolation of unmarked Pseudomonas aeruginosa mutants. Gene. 1998;212(1):77–86. [DOI] [PubMed] [Google Scholar]
  • 18. Choi KH, Gaynor JB, White KG, Lopez C, Bosio CM, Karkhoff-Schweizer RR, et al. A Tn7-based broad-range bacterial cloning and expression system. Nat Methods. 2005;2(6):443–8. [DOI] [PubMed] [Google Scholar]
  • 19. Choi KH, Mima T, Casart Y, Rholl D, Kumar A, Beacham IR, et al. Genetic tools for select-agent-compliant manipulation of Burkholderia pseudomallei . Appl Environ Microbiol. 2008;74(4):1064–75. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Becher A, Schweizer HP. Integration-proficient Pseudomonas aeruginosa vectors for isolation of single-copy chromosomal lacZ and lux gene fusions. Biotechniques. 2000;29(5):948–50, 52 [DOI] [PubMed] [Google Scholar]
  • 21. Tremblay J, Déziel E. Improving the reproducibility of Pseudomonas aeruginosa swarming motility assays. J Basic Microb. 2008;48(6):509–15. 10.1002/jobm.200800030 [DOI] [PubMed] [Google Scholar]
  • 22. Déziel E, Lépine F, Dennie D, Boismenu D, Mamer OA, Villemur R. Liquid chromatography/mass spectrometry analysis of mixtures of rhamnolipids produced by Pseudomonas aeruginosa strain 57RP grown on mannitol or naphthalene. Biochim Biophys Acta. 1999;1440(2–3):244–52. [DOI] [PubMed] [Google Scholar]
  • 23. Abdel-Mawgoud AM, Lépine F, Déziel E. Liquid chromatography/mass spectrometry for the identification and quantification of rhamnolipids. Methods Mol Biol. 2014;1149:359–73. 10.1007/978-1-4939-0473-0_30 [DOI] [PubMed] [Google Scholar]
  • 24. Abdel-Mawgoud A, Hausmann R, Lépine F, Müller M, Déziel E. Rhamnolipids: Detection, Analysis, Biosynthesis, Genetic Regulation, and Bioengineering of Production In: Soberón-Chávez G, editor. Biosurfactants. Microbiology Monographs. 20: Springer; Berlin Heidelberg; 2011. p. 13–55. [Google Scholar]
  • 25. Dusane DH, Zinjarde SS, Venugopalan VP, McLean RJ, Weber MM, Rahman PK. Quorum sensing: implications on rhamnolipid biosurfactant production. Biotechnol Genet Eng Rev. 2010;27:159–84. [DOI] [PubMed] [Google Scholar]
  • 26. Huber B, Riedel K, Hentzer M, Heydorn A, Gotschlich A, Givskov M, et al. The cep quorum-sensing system of Burkholderia cepacia H111 controls biofilm formation and swarming motility. Microbiology. 2001;147(Pt 9):2517–28. [DOI] [PubMed] [Google Scholar]
  • 27. Tans-Kersten J, Huang H, Allen C. Ralstonia solanacearum needs motility for invasive virulence on tomato. J Bacteriol. 2001;183(12):3597–605. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Zulianello L, Canard C, Köhler T, Caille D, Lacroix JS, Meda P. Rhamnolipids are virulence factors that promote early infiltration of primary human airway epithelia by Pseudomonas aeruginosa . Infect Immun. 2006;74(6):3134–47. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Häussler S, Rohde M, von Neuhoff N, Nimtz M, Steinmetz I. Structural and functional cellular changes induced by Burkholderia pseudomallei rhamnolipid. Infect Immun. 2003;71(5):2970–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Tremblay J, Déziel E. Gene expression in Pseudomonas aeruginosa swarming motility. BMC Genomics. 2010;11:587 10.1186/1471-2164-11-587 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Xavier JB, Kim W, Foster KR. A molecular mechanism that stabilizes cooperative secretions in Pseudomonas aeruginosa . Mol Microbiol. 2011;79(1):166–79. 10.1111/j.1365-2958.2010.07436.x [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All relevant data are within the paper.


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES