Skip to main content
PLOS One logoLink to PLOS One
. 2015 Jun 8;10(6):e0128423. doi: 10.1371/journal.pone.0128423

Role of Staphylococcus aureus Virulence Factors in Inducing Inflammation and Vascular Permeability in a Mouse Model of Bacterial Endophthalmitis

Ajay Kumar 1, Ashok Kumar 1,2,3,*
Editor: Lbachir BenMohamed4
PMCID: PMC4459968  PMID: 26053426

Abstract

Staphylococcus (S.) aureus is a common causative agent of bacterial endophthalmitis, a vision threatening complication of eye surgeries. The relative contribution of S. aureus virulence factors in the pathogenesis of endophthalmitis remains unclear. Here, we comprehensively analyzed the development of intraocular inflammation, vascular permeability, and the loss of retinal function in C57BL/6 mouse eyes, challenged with live S. aureus, heat-killed S. aureus (HKSA), peptidoglycan (PGN), lipoteichoic acid (LTA), staphylococcal protein A (SPA), α-toxin, and Toxic-shock syndrome toxin 1 (TSST1). Our data showed a dose-dependent (range 0.01 μg/eye to 1.0 μg/eye) increase in the levels of inflammatory mediators by all virulence factors. The cell wall components, particularly PGN and LTA, seem to induce higher levels of TNF-α, IL-6, KC, and MIP2, whereas the toxins induced IL-1β. Similarly, among the virulence factors, PGN induced higher PMN infiltration. The vascular permeability assay revealed significant leakage in eyes challenged with live SA (12-fold) and HKSA (7.3-fold), in comparison to other virulence factors (~2-fold) and controls. These changes coincided with retinal tissue damage, as evidenced by histological analysis. The electroretinogram (ERG) analysis revealed a significant decline in retinal function in eyes inoculated with live SA, followed by HKSA, SPA, and α-toxin. Together, these findings demonstrate the differential innate responses of the retina to S. aureus virulence factors, which contribute to intraocular inflammation and retinal function loss in endophthalmitis.

Introduction

Infectious endophthalmitis is one of the most devastating complications of ophthalmic surgeries and penetrating injuries [1]. The most common isolated microorganisms are Gram-positive staphylococci, which constitute up to 90% of all bacterial pathogens [2]. The course of infectious endophthalmitis varies widely depending upon the organism involved, ranging from therapeutically responsive infections to therapeutically challenging infections caused by more virulent pathogens such as Bacillus cereus [3, 4] and Staphylococcus(S) aureus [5–7]. As one of the most feared ocular pathogens, S. aureus causes severe intraocular inflammation, significant vision loss, and can even cause loss of the eye [8, 9]. Despite therapeutic and surgical interventions, endophthalmitis results in partial or complete visual loss within a few days of microbial inoculation [10].

The current treatment for bacterial endophthalmitis involves intravitreal administration of antibiotics [11]. Some of the antibiotics, in the process of destroying the bacteria, release lipoteichoic acid (LTA) and peptidoglycan (PGN) from the bacterial cell walls, thereby exacerbating the acute inflammatory response [12, 13]. Indeed, previous studies have shown that the Gram-positive bacterial cell wall can induce cytokine production, inflammatory cell chemotaxis, and cellular toxicity in a number of experimental models, including endophthalmitis [14, 15]. Similarly, our previous studies have implicated the role of Toll-like receptors (TLRs) in mediating retinal innate responses to S. aureus cell wall components, including PGN and LTA [16–18]. In addition to cell wall components, S. aureus produces various toxins, such as α-toxin and Toxic-shock syndrome toxin (TSST1). However, their role in eliciting retinal innate responses remains elusive [6, 19].

The pathogenesis of bacterial endophthalmitis involves complex host-pathogen interactions that results in intraocular inflammation, vascular leakage, and retinal tissue damage. The relative contribution of S. aureus virulence factors in evoking these innate responses is not well understood. Thus, in the current study, we investigated the role of individual virulence factors in the pathogenesis of staphylococcal endophthalmitis and comparisons were made with live and heat-inactivated S. aureus. Together, our data suggest that S. aureus virulence factors incite differential innate responses in the retina and suggest that the neutralization of a single, specific virulence factors may not be effective in preventing/treating bacterial endophthalmitis.

Material and Methods

Ethics Statement

Female C57BL/6 (aged ~8 weeks) specific pathogen free mice obtained from the Jackson Laboratory were maintained at the Kresge Eye Institute in specific pathogen free conditions. All the procedures were conducted in compliance with the ARVO statement for the Use of Animals in Ophthalmic and Vision Research, and were approved by the Institutional Animal Care and Use Committee of Wayne State University (protocol A-08-02-13).

Bacterial strain and virulence factors

The S. aureus strain RN6390 was used to induce endophthalmitis [20, 21]. The bacterial strain was maintained and grown in tryptic soy broth (Sigma Aldrich, St. Louise, USA) overnight at 37°C. The bacterial count was adjusted to 5000 cfu/ml in PBS. For the preparation of heat killed S. aureus (HKSA), 105 cfu/ml of bacterial culture was boiled in a water bath for 10 min., followed by a viability assay using bacterial plating. Purified PGN, SPA, α-toxin, TSST1, and LTA from Staphylococcus aureus were purchased from Sigma Aldrich, USA. A dose response study was performed to select the suitable dose that worked for each bacterial virulence factor to elicit inflammation (Fig 1). Alpha-toxin was tested for hemolytic activity in 5% sheep blood agar before injection. All the virulence factors were dissolved in endotoxin-free water and checked for endotoxin levels prior to injection by using LIMULUS amoebocyte lysate assay (Genescript, NJ, USA). The endotoxin levels in LTA, PGN and TSST1 were <0.005 EU/μg while in α-toxin and SPA it was <0.05 EU/μg, of protein.

Fig 1. Effect of S. aureus virulence factors on inflammatory responses.

Fig 1

Eyes of C57BL/6 mice (4–6 per group) were inoculated with indicated dose of heat-killed S. aureus (HKSA) (5X105 CFU/eye), its cell wall components (PGN and LTA; 0.1μg each), and cell surface and secreted proteins (SPA, TSST, and α-toxin; 0.1μg each). After 24h, eyes (n = 6) were enucleated and subjected to ELISA, eyes injected with PBS served as controls. Statistical analysis was performed by using one way ANOVA with Dunnett’s multi-comparison test. *p <0.05, **p <0.005, ***p<0.0005.

Induction of endophthalmitis

C57BL/6 mice were maintained in a 12 h light/dark cycle and temperature was controlled at 22°C. Mice were provided free access to the water and standard laboratory chow. During experiment, mice were anesthetized by intraperitoneal injection of ketamin/xylazine (ketamin, 100–125 mg/kg; xylazine, 10–12.5 mg/kg). For intravitreal injections, a 32-G needle attached to a 10 μl glass syringe (Hamilton, Reno, USA) was used under a dissecting microscope. Mice were injected with live S. aureus (5000 CFU), heat-killed S. aureus (HKSA), or bacterial factors as indicated in 1.

Enzyme-linked immunosorbent assay (ELISA)

Following injection with either S. aureus or bacterial virulence factors, the mouse eyes were enucleated and crushed in a tissue lyser and protein was estimated using a protein estimation kit (Thermoscientific, USA) according to manufacturer’s instructions. To determine the levels of cytokines and chemokines in the retinal tissue lysates, ELISA was performed using ELISA kits for TNF-α, IL-1β, and IL-6 (BD biosciences, San Diego, CA, USA) and MIP2 and KC (R & D systems, Minneapolis, MN, USA) according to manufacturer’s instructions. All of the values were expressed as mean ± standard deviations (SD).

Real-time PCR

The expression of MMP2, MMP3, MMP13, S100A7, and S100A9 were determined with qRT-PCR from mice treated with virulence factors. The retinas were removed and processed for ultrasonication on ice. Total RNA was extracted using TRIzol solution (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s Instructions. cDNA was synthesized using 2 μg of total RNA by reverse transcription (Thermo scientific, Rockford, IL, USA). Sybergreen based qRT-PCR was performed using specific primers, as listed in Table 1. GAPDH was used as a housekeeping gene to calculate the relative quantification. qRT-PCR was performed using the StepOnePlus real-time PCR system (Applied Biosystem, Grand Island, NY, USA). The data analysis was performed using the 2−ΔΔ CT method.

Table 1. Sequences and product sizes of PCR primers.

Gene ID Primer sequences Product size (bp)
MMP2 F: CCGATCTACACCTACACCAAGAAC 107
R: CCAGTACCAGTGTCAGTATCAG
MMP9 F: CTCTACAGAGTCTTTGAGTCCG 143
R: CCTGTAATGGGCTTCCTCTATG
MMP13 F: CTGGACCAAACTATGGTGGG 135
R: GGTCCTTGGAGTGATCCAGA
S100A7 F: TGCACCAAGAGCAACAGACT 229
R: CCATGAAGCGAGGCACACTA
S100A9 F: GCTCCTCGGCTTTGACAGAGTGCAAC 92
R: GCATTTGTGTCCAGGTCCTCCATGAT

Neutrophil infiltration

Flowcytometry was used to determine the extent of PMN infiltration in the retina, as described earlier [18]. The retinas were removed from mice injected with bacterial virulence factors, HKSA, or live S. aureus and digested with Accumax (Millipore, Billerica, MA, USA) for 10 min. at 37°C. Retinal tissue was passed from a 23-G needle/syringe to make a single cell suspension and filtered through a 40-μm cell strainer (BD Falcon, San Jose, CA, USA). Blocking was performed by using Fc block for 30 minutes and then washing with PBS containing 0.5% BSA. Cells were incubated in the dark at room temperature with conjugated monocloncal antibodies and respective isotypes for 30 minutes. Again, washing was performed in PBS with 0.5% BSA and cells were acquired on a BD Accuri C6 (BD Immunocytometry Systems, San Jose, CA, USA). The data analysis was performed using Flow Jo (Tree Star, Inc., Ashland, OR, USA).

Fundus imaging and fluorescein angiography

For fundoscopic examination, mice pupils were dilated with a mixed ophthalmic solution containing 0.5% atropine sulfate (E. Fougera & Co., NY, USA) and 1.25% phenylephrine hydrochloride (Wilson Ophthamic, OK, USA). The fundus was photographed with a Micron III (Phoenix Research Lab., Pleasanton, CA, USA) fundus camera for small animals. Mouse pupils were dilated, and mice were intraperitoneally injected with 20% AK-FLUOR (Akorn, Inc., Lake Forest, IL, USA) at a dose of 0.01 ml/5 g of mouse body weight. Photographs were taken with Micron III containing a barrier filter for fluorescein angiography and processed for Photoshop for digital images.

Assessment of vascular permeability

Immunohistochemistry was performed on retinal tissue sections from mice injected with bacterial virulence factors, live S. aureus, or HKSA for the purpose of determining the extent of vascular permeability. CD31 (a vascular marker) and fibrinogen (a leakage marker) were used for the immunostaining. Eyes were enucleated and fixed in 4% para-formaldehyde for 2–3 hrs, followed by washing in PBS for 5 minutes. The eyes were placed in 5%, 10%, 20% sucrose in PBS for 30 minutes each, followed by 30% sucrose plus embedding medium (Tissue-Tek OCT compound, Sakura Fintek, USA Inc., Torrence, CA, USA) in a 1:1 ratio overnight at 4°C. The eyes were fixed in OCT, sectioned, and mounted on slides. For immunostaining, sections were kept at 4% para-formaldehyde for 15 minutes, and then washed twice in PBS for 5 minutes each. For permeabilization and to prevent non-specific binding, sections were incubated in 1% BSA containing 0.5% Triton-X100. Primary antibodies for CD31 (1:100, Abcam, Cambridge, MA, USA) and fibrinogen (1:20, Developmental Studies Hybridoma Bank, University of Iowa, Iowa City, IA.) diluted in blocking solution were allowed to sit overnight in a humidified chamber at 4°C; secondary antibodies for goat anti-mouse-FITC (1:100) and PE-Cy3 anti-hamster (BD Bioscience, San Jose, CA, USA) were also used. Photomicrographs were taken using fluorescence microscope. Fluorescent intensity was measured using imageJ software and calculated using the following formula [22].

Fluorescence intensity = Integrated Density—(Area of selected cell X Mean fluorescence of background readings).

Histology

Eyes from the euthanized mice were enucleated 24h post-injection for histopathological examination and fixed in 10% formalin for 24h. The embedding, sectioning, and hematoxylin and eosin stain (H&E) staining were performed by Excalibur Pathology, Inc. (Oklahoma City, OK, USA).

Electroretinography (ERG)

Scotopic electroretinography (ERG) was used to determine retinal function following S. aureus infection and injection of bacterial virulence factors. The mice (control and infected) were anesthetized 24h after injection. The temperature of the mice was maintained at 37°C using a heat pad. The pupils were dilated using a 1% tropicamide ophthalmic solution. ERGs were recorded following bilateral mydriasis and at least 12h of dark adaptation. Indifferent, silver-embedded thread eye electrodes (OcuscienceLLC, Kansas City, MO) were used to record the ERG. Reference needle electrodes (stainless steel subdermal electrodes) were placed in anterior scalp and a ground needle electrode was placed in the tail. ERG responses were acquired using an ERG system (OcuscienceLLC, Kansas City, MO) and analyzed using ERGVIEW 4.600V. Ganzfeld light stimulus was used to present ten 10 ms flashes, with light intensities increasing from 0.0001 to 100 cd-s/m2. The amplitudes of the a- and b-waves were recorded. The ERG a-wave amplitude was measured between the ERG baseline and the first negative peak, while the ERG b-wave amplitude was measured between the first negative peak and the first positive peak.

Results

S. aureus virulence factors evoke distinct inflammatory responses in mouse eyes

Intraocular inflammation is a hallmark of bacterial endophthalmitis [2] and peaks between 24 and 48h post bacterial inoculation [5, 23, 24]. To investigate the role of S. aureus virulence factors in generating inflammatory responses, the eyes of C57BL/6 mice were injected with various doses of S. aureus cell wall components and toxins for 24h. To this end, our data showed a dose-dependent induction of inflammatory mediators, as evidenced by increased levels of cytokines (IL-1β, TNF-α, and IL-6) and chemokines (MIP-2 and KC) by all virulence factors (Fig 1). However, the expression pattern was differentially regulated. For example, IL-6 and MIP2 levels were significantly higher in HKSA, PGN, and LTA injected eyes. In contrast, TSST1, α-toxin, and SPA seem to have no effect on these cytokines. The levels of TNF-α and KC were significantly increased by all virulence factors. Interestingly, IL-1β was induced more by the higher concentration of toxins. Overall, the cell wall components seem to induce higher inflammatory responses as compared to toxins.

In addition to inflammatory mediators, we also assessed the expression of metalloproteinases (MMPs) and danger-associated molecular pattern (DAMPs, S100A7/S100A9), which are implicated in the inflammatory response. As shown in Fig 2, live S. aureus significantly induced MMP9 expression in the mouse retina, whereas MMP2, MMP13, S100A7 and S100A9 levels were increased, but did not reach statistical significance. In contrast, eyes injected with HKSA did not exhibit significant changes in any of the MMPs or DAMPs. Among the cell wall components, PGN stimulated the increased expression of MMP2 and MMP13, LTA-challenged eyes exhibited higher levels of S100A7 and S100A9, and SPA induced the expression of MMP2, MMP9, and MMP13. Among the toxins, α-toxin increased the expression of MMP2, MMP9, MMP13, and S100A9, while TSST-1 appears to have no effect on these mediators.

Fig 2. Expressions of MMPs and S100As in eye challenged with S. aureus and its virulence factors.

Fig 2

Eyes of C57BL/6 mice (4–6 per group) were inoculated intravitreally with live S. aureus (5000 CFU/eye), HKSA (5X105 CFU/eye), LTA (0.1μg/eye), PGN (0.1μg/eye), TSST1 (0.1μg/eye), α-toxin (0.1μg/eye), SPA (0.1μg/eye), and PBS (2μl) for 24h. The mRNA expression of MMP2, MMP9, MMP13, S100A7, and S100A9 was determined by Real-time RT-PCR. Statistical analysis was performed by using one way ANOVA with Dunnett’s multi-comparison test. *p <0.05, **p <0.005.

Live S. aureus and PGN induced maximum PMN infiltration in the retina

Neutrophils are the first innate immune cells recruited to the retina in endophthalmitis [25]. To determine the effect of S. aureus virulence factors on PMN infiltration, we performed flowcytometry. As expected, the highest PMNs levels were observed in eyes challenged with live SA (82.6%), followed by PGN (18.5%), HKSA (8.4%), and SPA (4.7%) injected mice (Fig 3). Surprisingly, LTA was not found to induce significant PMN infiltration and a similar trend was observed in eyes challenged with toxins.

Fig 3. Effect of S. aureus virulence factors on neutrophil infiltration to the retina.

Fig 3

Eyes of C57BL/6 mice (4–6 per group) were inoculated intravitreally with S. aureus (5000 CFU/eye), HKSA (5x105 CFU), or and the indicated virulence factors (0.1μg /eye). At 24h post infection, eyes were enucleated and retinas from two eyes were pooled to make single-cell suspensions and stained with anti-CD45 and anti-Ly6G mAbs. Post-acquisition, the cells were size gated to differentiate them from debris. The percentage of dually positive PMNs was determined using a CD45 versus Ly6G dot plot (upper-right right [Q2] quadrant). The data are representative of duplicate experiments. Statistical analysis was performed by using one way ANOVA with Dunnett’s multi-comparison test. *p <0.05, ***p <0.0005.

S. aureus virulence factors increased vascular leakage and tissue damage in the retina

The influx of PMNs and other immune cells to the retina is tightly controlled by the blood retinal barriers (BRB) [26, 27]. Funduscopic imaging combined with fluorescent angiography revealed retinal vessel occlusions, ischemia, and signs of vascular leakage in S. aureus virulence factor challenged eyes versus control (PBS) (Fig 4). To further confirm the breakdown of the BRB, we determined the degree of vascular permeability by assessing the release of fibrinogen using immunohistochemistry (Fig 5). Our data showed visible signs of vascular leakage in the retina of eyes injected with S. aureus virulence factors. The quantification of comparative fibrinogen intensity revealed significantly higher vascular leakages in the retina of S. aureus (12-fold) and HKSA (7.3-fold) injected mice, whereas eyes challenged with other virulence factors exhibited ≤ 2-fold increases.

Fig 4. Fundus imaging of eyes challenged with S. aureus virulence factors.

Fig 4

Eyes of C57BL/6 mice (4–6 per group) were inoculated intravitreally with S. aureus (5000 CFU/eye), HKSA (5x105 CFU), or and the indicated virulence factors (0.1μg /eye). At 24h post infection, eyes were examined by fundus microscope and images were captured using Micron III. Angiography was performed by intraperitoneal injections of 2% fluorescent dye.

Fig 5. Determination of vascular leakage in infected retina.

Fig 5

To determine the vascular permeability, infected eyes were embedded in OCT at 24h and the cryosections were subjected to IHC analysis. Fluorescent densities for CD31 (Green, biomarker for blood vessels) and Fibrinogen (Red, released from blood into the retinal tissue) were measured. Fluorescent intensities were scanned in three different regions of the retina in each slide and an average of 3 to 4 retina in each treatment group. Fold change was calculated by calculating the ratio between CD31 (Vascular marker) and Fibrinogen (Leakage marker) and presented as mean ± SD. Statistical significance was determined by One way ANOVA with Dunnett’s multi-comparison test. ***p<0.0005, **p<0.005, n = 6). Original magnification 20x.

The effect of S. aureus virulence factors on retinal structural integrity was assessed using histological analysis (Fig 6). In control (PBS injected) eyes, the retinal structure was intact, with no significant changes. In contrast, eyes challenged with S. aureus exhibited severe retinal damage, as evidenced by a loss of architecture, retinal folding, edema, and the presence of infiltrated cells (Fig 6). Among the virulence factors, only α-toxin was found to cause mild retinal damage and edema.

Fig 6. Histological assessment of the impact of S. aureus virulence factors on retinal tissue damage.

Fig 6

Histological analysis was performed on eyes challenged with S. aureus virulence factors as indicated in Fig 2 legend. Representative images of eyes of inoculated challenged with S. aureus and α-toxin (0.1μg/eye) showed retinal damage. Original magnifications 20X. VC, Vitreous Chamber; R, Retina; OD, Optic Disk.

S. aureus virulence factors exerted a differential effect on retinal function

To determine the impact of individual virulence factors on retinal function, ERG analysis was performed. As shown in Fig 7, both live S. aureus and HKSA caused a significant (~60–70%) decline in the amplitude of both a- and b-waves. Among the virulence factors, SPA and TSST1 reduced a- and b-wave amplitudes by 30–40%. PGN and LTA seem to have no significant impact of retinal function, whereas α-toxin causes decline in a-wave, but not b-wave, amplitude.

Fig 7. Retinal function analysis in S. aureus virulence factors challenged eyes.

Fig 7

Eyes of C57BL/6 mice (4–6 per group) were inoculated intravitreally with S. aureus (5000CFU), HKSA (5x105 CFU), LTA (0.1μg), PGN (0.1μg), SPA (0.1μg), TSST1 (0.1μg), α-toxin (0.1μg), and PBS (2μl). ERG was performed after overnight dark adaptation. Electroretinogram responses to a 6-dB flash were recorded and the percentage amplitude of a- and b-wave retained in infected eyes was compared to that of uninjected mice control and presented as mean ± SD. ERG amplitudes Statistical analysis was performed using one-way ANOVA with Dunnett’s multi-comparison test. *p <0.05, **p <0.005, ***p <0.001 (n = 6 mice were used per treatment). UN,uninjected.

Discussion

Previous studies from our laboratory and others have shown that S. aureus induces severe endophthalmitis in experimental models [7, 24, 28–31]. However, which virulence factors contribute to the induction of intraocular inflammation, BRB breakdown, and retinal function impairment, the hallmarks of endophthalmitis, remain unclear. In the present in vivo study, we evaluated the role of S. aureus cell wall components (HKSA, PGN, and LTA) and cell surface or secreted proteins (SPA, α-toxin, and TSST-1) on the pathogenesis of endophthalmitis. Our data showed that all virulence factors induced a concentration-dependent release of various inflammatory mediators (IL-1β, TNF-α, IL-6, MIP-2, and KC) in mouse eyes. These changes coincided with increased vascular leakage and PMN infiltration, resulting in diminished retinal function. Collectively, our study indicates that the pathogenicity of S. aureus is primarily due to the expression of a large variety of virulence factors, as the effect of any one virulence factors was not sufficient to cause endophthalmitis.

Similar to other organs/tissues, in the retina, the innate immune response prevent the establishment of an infection by recognizing pathogens at the early stages of infection and providing a first, rapid line of host defense [2, 16]. It is now well-established that the host uses pattern-recognition receptors (PRRs), such as TLRs, to recognize microbial-associated molecular patterns (MAMPs) present on pathogens [16]. In the case of Gram-positive bacteria, including staphylococci, PGN and teichoic acids (LTA and WTA) serve as MAMPs [32] and constitute 70% of the weight of their cell wall [33, 34]. Indeed, our in vitro studies have implicated the role of TLR2 in inducing the inflammatory response in retinal microglia following challenge with staphylococcal PGN and LTA [18]. Similarly, TLR2 was found to mediate the innate response of Müller glia towards S. aureus [35, 36]. We postulated that, under in vivo conditions, proliferating staphylococci could release cell wall components, which percolate through the vitreous and are recognized by retinal residential innate immune cells, such as the glial cells [17]. In the current study, we mimicked this situation by giving intravitreal injections of purified PGN and LTA and demonstrated that staphylococcal cell wall components induce the secretion of pro-inflammatory mediators and cause retinal vascular leakage. However, it is important to mention that the vascular leakage may not be due to the direct effects of PGN or LTA, but rather the secondary effects of intraocular inflammation.

In addition to their cell wall components, the damaging effects seen in staphylococcal infections could be due to an arsenal of virulence factors such as surface binding protein A (SPA) and secreted toxins [37]. Due to their IgG binding ability, the role of SPA has been primarily implicated in promoting immune evasion by inhibiting bacterial phagocytosis [38, 39]. However, studies from our laboratory [40] and others have shown that SPA exerts pro-inflammatory stimuli via tumor-necrosis factor receptor 1 (TNFR1) signaling [41, 42]. Here, we demonstrate that SPA induces the production of pro-inflammatory mediators, including TNF-α, suggesting its role in promoting intraocular inflammation in endophthalmitis. Staphylococcal superantigens, such as TSST1, manifest disease through hyper-activation of the immune system, resulting in massive cytokine production and septic shock [43]. Toxins also possess the ability to bind to human vascular epithelial cells and induce the production of pro-inflammatory mediators through the activation of NF-kB [44, 45]. S. aureus secreted α-toxin is a major cytolytic toxin which acts through inserting pores in the membrane of targeted host cells [46, 47]. The damaging effects of α-toxin have been demonstrated in staphylococcal endophthalmitis, as evidenced by the reduced pathogenicity of Agr and Sar mutants [6, 48]. In the current study, we demonstrated the ability of α-toxin to induce the inflammatory response, particularly via IL-1β, indicating another role of α-toxin in increasing the virulence of S. aureus in endophthalmitis. Previous studies have demonstrated the activation of the inflammasome by α-toxin as an underlying mechanism for IL-1β production [49]. Similarly, S. aureus mediated inflammasome activation has been reported in conjunctiva goblet cells [50]. Our preliminary studies (unpublished data) have also indicated the potential involvement of the inflammasome complex in staphylococcal endophthalmitis and studies are in progress to delineate the mechanisms.

The MMPs belong to the large family of zinc-dependent neutral endopeptidases that are capable of degrading the extracellular matrix. Although MMPs play an important role in injury repair during inflammation by cleaving components of extracellular matrix, the excessive expression of MMPs can also destroy the extracellular matrix and promote further inflammation. The role of MMP13 has been described in Pseudomonas aeruginosa induced corneal ulceration [51]. In diabetic retinopathy, the elevated expression of MMPs may facilitate an increase in vascular permeability via proteolytic degradation of the tight junction protein occludin, followed by disruption of tight junction complex [52]. Our data showed increased expression of MMP2, MMP9, and MMAP13, indicating their involvement in bacterial endophthalmitis. In addition to MMPs, increased levels of S100 proteins were also detected in S. aureus-infected retina. The S100/calgranulin complex has antimicrobial properties [47, 53] and is massively released by dying neutrophils to provide host defense [54]. Three main S100 proteins have been linked to innate immune function, as they are expressed in cells of myloid origin [55]. These S100 proteins can be secreted via an alternate route, bypassing the classic Golgi-rout, which is the typical mode of secretion for DAMP-related factors [56]. These DAMPs have a role in maintaining cellular homeostasis, but turn into pro-inflammatory danger signals when released into the extracellular environment following cell damage, infection, or inflammation [57].

The eye is protected from inflammatory cells due to the existence of blood retina barrier (BRB), which is composed of the retinal endothelium and retinal pigmented epithelial cells. Increased BRB permeability has previously been reported in bacterial endophthalmitis [26]. However, which bacterial virulence factors induce this response is not yet clearly defined. In the current study, we demonstrate increased vascular permeability, mainly in eyes injected with live S. aureus, indicating a synergistic effect of S. aureus virulence factors in inducing vascular permeability. Another mechanism of BRB breakdown could be due to increased levels of inflammatory mediators, as was demonstrated by increased PMN and mononuclear cell infiltration in rat eyes injected with IL-1β or TNF-α [58]. The combined effect of increased vascular permeability and intraocular inflammation culminates to impaired retinal function [5, 23, 59]. We hypothesize that some virulence factors, specifically toxins, could directly impact retinal function through their direct lytic action. Surprisingly, individual virulence factors were found to have little impact on retinal function, as evidenced by the observation that there was no significant decline in either a- or b-wave amplitude following injection.

Conclusions

In this study, we comprehensively demonstrated the role S. aureus cell wall components and secreted virulence factors in evoking retinal innate responses leading to intraocular inflammation, vascular permeability, and a loss of retinal function. Although the ideal approach for the management of endophthalmitis should include both bacterial eradication and inflammation resolution, monotherapy with intravitreal antibiotic injections remains the current standard of treatment. The antibiotics, while destroying the bacteria, may release bacterial cell wall components, which contribute to intraocular inflammation in bacterial endophthalmitis. Thus, we need adopt both antimicrobial and adjunct anti-inflammatory therapeutic approaches to treat infectious endophthalmitis.

Supporting Information

S1 ARRIVE Guideline Checklist. Completed “The ARRIVE Guidelines Checklist” for reporting animal research experiments in this manuscript.

(PDF)

Acknowledgments

This study was supported by grants from National Institute of Health (Grant R01 EY19888) and Research to Prevent Blindness (RPB) Williams and Mary Greve special Scholar award. Authors would like to thank Dr. Pawn K. Singh (Kresge Eye Institute) for his technical help in performing intravitreal injections.

Data Availability

All relevant data are within the paper.

Funding Statement

This study was supported by grants from the National Institute of Health (Grant R01 EY19888) and Research to Prevent Blindness (RPB) Williams and Mary Greve Special Scholar award. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1. Durand ML. Endophthalmitis. Clin Microbiol Infect. 2013;19(3):227–34. Epub 2013/02/27. 10.1111/1469-0691.12118 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Callegan MC, Gilmore MS, Gregory M, Ramadan RT, Wiskur BJ, Moyer AL, et al. Bacterial endophthalmitis: therapeutic challenges and host-pathogen interactions. Prog Retin Eye Res. 2007;26(2):189–203. Epub 2007/01/24. S1350-9462(06)00069-3 [pii] 10.1016/j.preteyeres.2006.12.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Callegan MC, Guess S, Wheatley NR, Woods DC, Griffin G, Wiskur BJ, et al. Efficacy of vitrectomy in improving the outcome of Bacillus cereus endophthalmitis. Retina. 2011;31(8):1518–24. Epub 2011/05/25. 10.1097/IAE.0b013e318206d176 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Ramadan RT, Ramirez R, Novosad BD, Callegan MC. Acute inflammation and loss of retinal architecture and function during experimental Bacillus endophthalmitis. Curr Eye Res. 2006;31(11):955–65. Epub 2006/11/23. X486J08937426P85 [pii] 10.1080/02713680600976925 . [DOI] [PubMed] [Google Scholar]
  • 5. Kumar A, Singh CN, Glybina IV, Mahmoud TH, Yu FS. Toll-like receptor 2 ligand-induced protection against bacterial endophthalmitis. J Infect Dis. 2010;201(2):255–63. Epub 2009/12/10. 10.1086/649589 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Booth MC, Cheung AL, Hatter KL, Jett BD, Callegan MC, Gilmore MS. Staphylococcal accessory regulator (sar) in conjunction with agr contributes to Staphylococcus aureus virulence in endophthalmitis. Infect Immun. 1997;65(4):1550–6. Epub 1997/04/01. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Sugi N, Whiston EA, Ksander BR, Gregory MS. Increased resistance to Staphylococcus aureus endophthalmitis in BALB/c mice: Fas ligand is required for resolution of inflammation but not for bacterial clearance. Infect Immun. 2013;81(6):2217–25. Epub 2013/04/10. doi: 10.1128/IAI.00405-12 IAI.00405-12 [pii]. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Callegan M, Gilmore M, Gregory M, Ramadan R, Wiskur B, Moyer A, et al. Bacterial endophthalmitis: therapeutic challenges and host-pathogen interactions. Prog Retin Eye Res. 2007;26:189–203. 10.1016/j.preteyeres.2006.12.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Major JC Jr, Engelbert M, Flynn HW Jr, Miller D, Smiddy WE, Davis JL. Staphylococcus aureus endophthalmitis: antibiotic susceptibilities, methicillin resistance, and clinical outcomes. Am J Ophthalmol. 2010;149(2):278–83 e1 Epub 2009/11/21. S0002-9394(09)00626-6 [pii] 10.1016/j.ajo.2009.08.023 . [DOI] [PubMed] [Google Scholar]
  • 10. Gregory M, Callegan MC, Gilmore MS. Role of bacterial and host factors in infectious endophthalmitis. Chem Immunol Allergy. 2007;92:266–75. Epub 2007/02/01. 10.1159/000099277 [pii]. . [DOI] [PubMed] [Google Scholar]
  • 11. Callegan MC, Ramirez R, Kane ST, Cochran DC, Jensen H. Antibacterial activity of the fourth-generation fluoroquinolones gatifloxacin and moxifloxacin against ocular pathogens. Adv Ther. 2003;20(5):246–52. Epub 2004/02/18. doi: 307 [pii]. . [DOI] [PubMed] [Google Scholar]
  • 12. Jackson JJ, Kropp H. beta-Lactam antibiotic-induced release of free endotoxin: in vitro comparison of penicillin-binding protein (PBP) 2-specific imipenem and PBP 3-specific ceftazidime. J Infect Dis. 1992;165(6):1033–41. Epub 1992/06/01. . [DOI] [PubMed] [Google Scholar]
  • 13. van Langevelde P, Kwappenberg KM, Groeneveld PH, Mattie H, van Dissel JT. Antibiotic-induced lipopolysaccharide (LPS) release from Salmonella typhi: delay between killing by ceftazidime and imipenem and release of LPS. Antimicrob Agents Chemother. 1998;42(4):739–43. Epub 1998/04/29. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Callegan MC, Booth MC, Jett BD, Gilmore MS. Pathogenesis of gram-positive bacterial endophthalmitis. Infect Immun. 1999;67(7):3348–56. Epub 1999/06/22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Fox A, Hammer ME, Lill P, Burch TG, Burrish G. Experimental uveitis. Elicited by peptidoglycan-polysaccharide complexes, lipopolysaccharide, and muramyl dipeptide. Arch Ophthalmol. 1984;102(7):1063–7. Epub 1984/07/01. . [DOI] [PubMed] [Google Scholar]
  • 16. Pandey RK, Yu FS, Kumar A. Targeting toll-like receptor signaling as a novel approach to prevent ocular infectious diseases. Indian J Med Res. 2013;138(5):609–19. Epub 2014/01/18. doi: IndianJMedRes_2013_138_5_609_124632 [pii]. [PMC free article] [PubMed] [Google Scholar]
  • 17. Kumar A, Pandey RK, Miller LJ, Singh PK, Kanwar M. Muller glia in retinal innate immunity: a perspective on their roles in endophthalmitis. Crit Rev Immunol. 2013;33(2):119–35. Epub 2013/04/16. doi: 384cd997794a6ddc,6401b8b11a7124d1 [pii]. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Kochan T, Singla A, Tosi J, Kumar A. Toll-Like Receptor 2 Ligand Pretreatment Attenuates Retinal Microglial Inflammatory Response but Enhances Phagocytic Activity toward Staphylococcus aureus. Infect Immun. 2012;80(6):2076–88. Epub 2012/03/21. IAI.00149-12 [pii] 10.1128/IAI.00149-12 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Booth MC, Hatter KL, Miller D, Davis J, Kowalski R, Parke DW, et al. Molecular epidemiology of Staphylococcus aureus and Enterococcus faecalis in endophthalmitis. Infect Immun. 1998;66(1):356–60. Epub 1998/01/10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Peng HL, Novick RP, Kreiswirth B, Kornblum J, Schlievert P. Cloning, characterization, and sequencing of an accessory gene regulator (agr) in Staphylococcus aureus. J Bacteriol. 1988;170(9):4365–72. Epub 1988/09/01. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Kumar A, Shamsuddin N. Retinal Muller glia initiate innate response to infectious stimuli via toll-like receptor signaling. PLoS One. 2012;7(1):e29830. Epub 2012/01/19. doi: 10.1371/journal.pone.0029830 PONE-D-11-22080 [pii]. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Bai Y, Shi Z, Zhuo Y, Liu J, Malakhov A, Ko E, et al. In glaucoma the upregulated truncated TrkC.T1 receptor isoform in glia causes increased TNF-alpha production, leading to retinal ganglion cell death. Invest Ophthalmol Vis Sci. 2010;51(12):6639–51. Epub 2010/06/25. iovs.10-5431 [pii] 10.1167/iovs.10-5431 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Talreja D, Kaye KS, Yu FS, Walia SK, Kumar A. Pathogenicity of ocular isolates of Acinetobacter baumannii in a mouse model of bacterial endophthalmitis. Invest Ophthalmol Vis Sci. 2014;55(4):2392–402. Epub 2014/03/20. doi: 10.1167/iovs.13-13401 iovs.13-13401 [pii]. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Engelbert M, Gilmore MS. Fas ligand but not complement is critical for control of experimental Staphylococcus aureus Endophthalmitis. Invest Ophthalmol Vis Sci. 2005;46(7):2479–86. Epub 2005/06/28. 46/7/2479 [pii] 10.1167/iovs.04-1139 . [DOI] [PubMed] [Google Scholar]
  • 25. Giese MJ, Rayner SA, Fardin B, Sumner HL, Rozengurt N, Mondino BJ, et al. Mitigation of neutrophil infiltration in a rat model of early Staphylococcus aureus endophthalmitis. Invest Ophthalmol Vis Sci. 2003;44(7):3077–82. Epub 2003/06/26. . [DOI] [PubMed] [Google Scholar]
  • 26. Moyer AL, Ramadan RT, Novosad BD, Astley R, Callegan MC. Bacillus cereus-induced permeability of the blood-ocular barrier during experimental endophthalmitis. Invest Ophthalmol Vis Sci. 2009;50(8):3783–93. Epub 2009/03/07. iovs.08-3051 [pii] 10.1167/iovs.08-3051 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Hu P, Pollard JD, Chan-Ling T. Breakdown of the blood-retinal barrier induced by activated T cells of nonneural specificity. Am J Pathol. 2000;156(4):1139–49. Epub 2000/04/07. S0002-9440(10)64982-6 [pii] 10.1016/S0002-9440(10)64982-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Singh PK, Donovan DM, Kumar A. Intravitreal Injection of the Chimeric Phage Endolysin Ply187 Protects Mice from Staphylococcus aureus Endophthalmitis. Antimicrobial Agents and Chemotherapy. 2014;58(8):4621–9. 10.1128/aac.00126-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Sadaka A, Durand ML, Gilmore MS. Bacterial endophthalmitis in the age of outpatient intravitreal therapies and cataract surgeries: Host–microbe interactions in intraocular infection. Progress in Retinal and Eye Research. 2012;31(4):316–31. 10.1016/j.preteyeres.2012.03.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Rarey KA, Shanks RM, Romanowski EG, Mah FS, Kowalski RP. Staphylococcus aureus isolated from endophthalmitis are hospital-acquired based on Panton-Valentine leukocidin and antibiotic susceptibility testing. J Ocul Pharmacol Ther. 2012;28(1):12–6. Epub 2011/10/22. 10.1089/jop.2011.0107 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Whiston EA, Sugi N, Kamradt MC, Sack C, Heimer SR, Engelbert M, et al. alphaB-crystallin protects retinal tissue during Staphylococcus aureus-induced endophthalmitis. Infect Immun. 2008;76(4):1781–90. Epub 2008/01/30. IAI.01285-07 [pii] 10.1128/IAI.01285-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Pietrocola G, Arciola CR, Rindi S, Di Poto A, Missineo A, Montanaro L, et al. Toll-like receptors (TLRs) in innate immune defense against Staphylococcus aureus. Int J Artif Organs. 2011;34(9):799–810. Epub 2011/11/19. doi: 10.5301/ijao.5000030 8AEDA61B-67BC-4784-8897-FD9966C45350 [pii]. . [DOI] [PubMed] [Google Scholar]
  • 33. Umeda A, Ueki Y, Amako K. Structure of the Staphylococcus aureus cell wall determined by the freeze-substitution method. J Bacteriol. 1987;169(6):2482–7. Epub 1987/06/01. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Talreja D, Singh PK, Kumar A. In vivo role of TLR2 and MyD88 signaling in eliciting innate immune responses in Staphylococcal endophthalmitis. Invest Ophthalmol Vis Sci. 2015;In press. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Shamsuddin N, Kumar A. TLR2 mediates the innate response of retinal Muller glia to Staphylococcus aureus. J Immunol. 2011;186(12):7089–97. Epub 2011/05/24. jimmunol.1100565 [pii] 10.4049/jimmunol.1100565 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Singh P, Shiha M, Kumar A. Antibacterial responses of retinal Muller glia: production of antimicrobial peptides, oxidative burst and phagocytosis. Journal of Neuroinflammation. 2014;11(1):33 10.1186/1742-2094-11-33 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Otto M. Staphylococcus aureus toxins. Current Opinion in Microbiology. 2014;17(0):32–7. 10.1016/j.mib.2013.11.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Kobayashi SD, DeLeo FR. Staphylococcus aureus protein A promotes immune suppression. MBio. 2013;4(5):e00764–13. Epub 2013/10/03. doi: 10.1128/mBio.00764-13e00764-13 [pii] mBio.00764-13 [pii]. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Votintseva AA, Fung R, Miller RR, Knox K, Godwin H, Wyllie DH, et al. Prevalence of Staphylococcus aureus protein A (spa) mutants in the community and hospitals in Oxfordshire. BMC Microbiol. 2014;14:63. Epub 2014/03/14. doi: 10.1186/1471-2180-14-63 1471-2180-14-63 [pii]. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Kumar A, Tassopoulos AM, Li Q, Yu FS. Staphylococcus aureus protein A induced inflammatory response in human corneal epithelial cells. Biochem Biophys Res Commun. 2007;354(4):955–61. Epub 2007/02/03. doi: S0006-291X(07)00120-9 [pii] 10.1016/j.bbrc.2007.01.072 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Classen A, Kalali BN, Schnopp C, Andres C, Aguilar-Pimentel JA, Ring J, et al. TNF receptor I on human keratinocytes is a binding partner for staphylococcal protein A resulting in the activation of NF kappa B, AP-1, and downstream gene transcription. Exp Dermatol. 2011;20(1):48–52. Epub 2010/10/20. 10.1111/j.1600-0625.2010.01174.x . [DOI] [PubMed] [Google Scholar]
  • 42. Gomez MI, Lee A, Reddy B, Muir A, Soong G, Pitt A, et al. Staphylococcus aureus protein A induces airway epithelial inflammatory responses by activating TNFR1. Nat Med. 2004;10(8):842–8. Epub 2004/07/13. doi: 10.1038/nm1079 nm1079 [pii]. . [DOI] [PubMed] [Google Scholar]
  • 43. McCormick JK, Yarwood JM, Schlievert PM. Toxic shock syndrome and bacterial superantigens: an update. Annu Rev Microbiol. 2001;55:77–104. Epub 2001/09/07. doi: 10.1146/annurev.micro.55.1.77 55/1/77 [pii]. . [DOI] [PubMed] [Google Scholar]
  • 44. Peterson ML, Ault K, Kremer MJ, Klingelhutz AJ, Davis CC, Squier CA, et al. The innate immune system is activated by stimulation of vaginal epithelial cells with Staphylococcus aureus and toxic shock syndrome toxin 1. Infect Immun. 2005;73(4):2164–74. Epub 2005/03/24. 73/4/2164 [pii] 10.1128/IAI.73.4.2164-2174.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Schaefers MM, Breshears LM, Anderson MJ, Lin YC, Grill AE, Panyam J, et al. Epithelial proinflammatory response and curcumin-mediated protection from staphylococcal toxic shock syndrome toxin-1. PLoS One. 2012;7(3):e32813. Epub 2012/03/21. doi: 10.1371/journal.pone.0032813 PONE-D-11-05991 [pii]. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Bhakdi S, Tranum-Jensen J. Alpha-toxin of Staphylococcus aureus. Microbiol Rev. 1991;55(4):733–51. Epub 1991/12/01. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Steinbakk M, Naess-Andresen CF, Lingaas E, Dale I, Brandtzaeg P, Fagerhol MK. Antimicrobial actions of calcium binding leucocyte L1 protein, calprotectin. Lancet. 1990;336(8718):763–5. Epub 1990/09/29. doi: 0140-6736(90)93237-J [pii]. . [DOI] [PubMed] [Google Scholar]
  • 48. Booth MC, Atkuri RV, Nanda SK, Iandolo JJ, Gilmore MS. Accessory gene regulator controls Staphylococcus aureus virulence in endophthalmitis. Invest Ophthalmol Vis Sci. 1995;36(9):1828–36. Epub 1995/08/01. . [PubMed] [Google Scholar]
  • 49. Kebaier C, Chamberland RR, Allen IC, Gao X, Broglie PM, Hall JD, et al. Staphylococcus aureus alpha-Hemolysin Mediates Virulence in a Murine Model of Severe Pneumonia Through Activation of the NLRP3 Inflammasome. J Infect Dis. 2012;205(5):807–17. Epub 2012/01/27. jir846 [pii] 10.1093/infdis/jir846 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. McGilligan VE, Gregory-Ksander MS, Li D, Moore JE, Hodges RR, Gilmore MS, et al. Staphylococcus aureus activates the NLRP3 inflammasome in human and rat conjunctival goblet cells. PLoS One. 2013;8(9):e74010. Epub 2013/09/17. doi: 10.1371/journal.pone.0074010 PONE-D-13-15067 [pii]. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51. Gao N, Kumar A, Yu FS. MMP13 as a target for suppressing corneal ulceration caused by Pseudomonas aeruginosa infection. J Infect Dis. 2015. Epub 2015/01/16. jiv016 [pii] 10.1093/infdis/jiv016 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52. Giebel SJ, Menicucci G, McGuire PG, Das A. Matrix metalloproteinases in early diabetic retinopathy and their role in alteration of the blood-retinal barrier. Lab Invest. 2005;85(5):597–607. Epub 2005/02/16. 3700251 [pii] 10.1038/labinvest.3700251 . [DOI] [PubMed] [Google Scholar]
  • 53. Sohnle PG, Hunter MJ, Hahn B, Chazin WJ. Zinc-reversible antimicrobial activity of recombinant calprotectin (migration inhibitory factor-related proteins 8 and 14). J Infect Dis. 2000;182(4):1272–5. Epub 2000/09/09. JID000164 [pii] 10.1086/315810 . [DOI] [PubMed] [Google Scholar]
  • 54. Ausseil J, Desmaris N, Bigou S, Attali R, Corbineau S, Vitry S, et al. Early neurodegeneration progresses independently of microglial activation by heparan sulfate in the brain of mucopolysaccharidosis IIIB mice. PLoS One. 2008;3(5):e2296 Epub 2008/05/30. 10.1371/journal.pone.0002296 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55. Foell D, Wittkowski H, Vogl T, Roth J. S100 proteins expressed in phagocytes: a novel group of damage-associated molecular pattern molecules. J Leukoc Biol. 2007;81(1):28–37. Epub 2006/09/01. jlb.0306170 [pii] 10.1189/jlb.0306170 . [DOI] [PubMed] [Google Scholar]
  • 56. Rammes A, Roth J, Goebeler M, Klempt M, Hartmann M, Sorg C. Myeloid-related protein (MRP) 8 and MRP14, calcium-binding proteins of the S100 family, are secreted by activated monocytes via a novel, tubulin-dependent pathway. J Biol Chem. 1997;272(14):9496–502. Epub 1997/04/04. . [DOI] [PubMed] [Google Scholar]
  • 57. Yang H, Wang H, Czura CJ, Tracey KJ. The cytokine activity of HMGB1. J Leukoc Biol. 2005;78(1):1–8. Epub 2005/03/01. jlb.1104648 [pii] 10.1189/jlb.1104648 . [DOI] [PubMed] [Google Scholar]
  • 58. Claudio L, Martiney JA, Brosnan CF. Ultrastructural studies of the blood-retina barrier after exposure to interleukin-1 beta or tumor necrosis factor-alpha. Lab Invest. 1994;70(6):850–61. Epub 1994/06/01. . [PubMed] [Google Scholar]
  • 59. Wiskur BJ, Robinson ML, Farrand AJ, Novosad BD, Callegan MC. Toward improving therapeutic regimens for Bacillus endophthalmitis. Invest Ophthalmol Vis Sci. 2008;49(4):1480–7. Epub 2008/04/04. 49/4/1480 [pii] 10.1167/iovs.07-1303 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 ARRIVE Guideline Checklist. Completed “The ARRIVE Guidelines Checklist” for reporting animal research experiments in this manuscript.

(PDF)

Data Availability Statement

All relevant data are within the paper.


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES