The second sentence of the final paragraph of the Introduction is incorrect. The correct sentence is: Ventral lobes of rat prostate tissues were used in determination of the relative mRNA expressions of AMR, TM and the transmembrane form of the PAcP (Quintero et al. 2007). Cellular form of PAcP in the cytosol has been suggested to down-regulate prostate cell growth in human prostate cancer cells [15].
There are errors in Table 1, “Primers used in qPCR analysis.” Please see the corrected Table 1 here.
Table 1. Primers used in qPCR analysis.
Gene symbol/ accession number | Direction | Primer sequence | Amplicon size |
---|---|---|---|
AMR NM_017123.1 | Forward | GTGCATGCCATTGCCTAGCTGA | 78 |
Reverse | TCATTTCCGGTGTGGCTTGGCA | ||
Bax NM_017059.2 | Forward | CCAGGACGCATCCACCAAGAAGC | 136 |
Reverse | TGCCACACGGAAGAAGACCTCTCG | ||
Bcl-2 NM_016993.1 | Forward | GAGGCTGGGATGCCTTTGTGGA | 89 |
Reverse | GCTGAGCAGCGTCTTCAGAGA | ||
CyD1 NM_171992.4 | Forward | ATCAAGTGTGACCCGGACTG | 216 |
Reverse | GCCACTACTTGGTGACTCCC | ||
HSF1 XM_006241890.1 | Forward | CCATGAAGCACGAGAACGAG | 117 |
Reverse | ACTGCACCAGTGAGATCAGGA | ||
PAcP NM_001134901.1 | Forward | CGGGATCCTGGTGATATTGCT | 70 |
Reverse | CCGATACACGTCTCTCTGCC | ||
p21 NM_080782.3 | Forward | ACATCTCAGGGCCGAAAACG | 78 |
Reverse | CTTGCAGAAGACCAATCGGC | ||
TM NM_031771.2 | Forward | GATCTCCATTGCCAGCCT | 140 |
Reverse | CACGTGCTGCAGTACTACCT | ||
GAPDH BC029618 | Forward | TGGAAGGACTCATGACCACA | 160 |
Reverse | TTCAGCTCAGGGATGACCTT |
The legend for Fig 1, “Relative mRNA expressions of AMR, PAcP, TM, CyD1, p21 and HSF1 in rat ventral prostate,” does not appear. Please see the complete, correct Fig 1 legend here.
Fig 1. Relative mRNA expressions of AMR, PAcP, TM, CyD1, p21 and HSF1 in rat ventral prostate.
C, control; MH1, mild hypothermia 1; MH2, mild hypothermia 2; SH1, severe hypothermia 1; SH2, severe hypothermia 2; SHW1, severe hypothermia followed by rewarming at room temperature; SHW2, severe hypothermia followed by rewarming at +28C; **p≤0.01, ***p≤0.001 compared with MH1; ††p≤0.01, †††p≤0.001 compared with MH2; ‡‡p≤0.01, ‡‡‡p≤0.001 compared with SH1; data are mean ± SEM.
The legend for Fig 2, “Bax mRNA to Bcl-2 mRNA ratios in rat ventral prostate” does not appear. Please see the complete, correct Fig 2 caption here.
Fig 2. Bax mRNA to Bcl-2 mRNA ratios in rat ventral prostate.
C, control; MH1, mild hypothermia 1; MH2, mild hypothermia 2; SH1, severe hypothermia 1; SH2, severe hypothermia 2; SHW1, severe hypothermia followed by rewarming at room temperature; SHW2, severe hypothermia followed by rewarming at +28C; **p≤0.01 compared with MH1; †p≤0.05 compared with SHW1; data are mean ± SEM.
The legend for Fig 3, “EGFR-ligand AMR protein expression and proliferative Ki-67 index in rat ventral prostate” does not appear. Please see the complete, correct Fig 3 caption here. The publisher apologizes for these errors.
Fig 3. EGFR-ligand AMR protein expression and proliferative Ki-67 index in rat ventral prostate.
Mean AMR protein expression values in rat prostate ventral lobe tissues (A); cytosolic AMR immunoreactivity in SH1 (B) and in SHW1 (C); mean Ki-67 index values in rat prostate ventral lobe tissues (D); nuclear Ki-67 immunoreactivity in SH2 (E) and in SHW2 (F). C, control; MH1, mild hypothermia 1; MH2, mild hypothermia 2; SH1, severe hypothermia 1; SH2, severe hypothermia 2; SHW1, severe hypothermia followed by rewarming at room temperature; SHW2, severe hypothermia followed by rewarming at +28C; **p≤0.01, ***p≤0.001 compared with SHW1; ††p≤0.01, †††p≤0.001 compared with C; ‡p≤0.05 compared with MH2; scale bar = 50 μm; data are mean ± SEM.
Reference
- 1. Kaija H, Pakanen L, Kortelainen M-L, Porvari K (2015) Hypothermia and Rewarming Induce Gene Expression and Multiplication of Cells in Healthy Rat Prostate Tissue. PLoS ONE 10(5): e0127854 doi: 10.1371/journal.pone.0127854 [DOI] [PMC free article] [PubMed] [Google Scholar]