Abstract
Staphylococcus aureus is a leading cause of prosthetic joint infections, which, as we recently showed, proceed with the involvement of biofilm-like clusters that cause recalcitrance to antibiotic treatment. Here we analyzed why these clusters grow extraordinarily large, reaching macroscopically visible extensions (>1 mm). We found that while specific S. aureus surface proteins are a prerequisite for agglomeration in synovial fluid, low activity of the Agr regulatory system and subsequent low production of the phenol-soluble modulin (PSM) surfactant peptides cause agglomerates to grow to exceptional dimensions. Our results indicate that PSMs function by disrupting interactions of biofilm matrix molecules, such as the polysaccharide intercellular adhesin (PIA), with the bacterial cell surface. Together, our findings support a two-step model of staphylococcal prosthetic joint infection: As we previously reported, interaction of S. aureus surface proteins with host matrix proteins such as fibrin initiates agglomeration; our present results show that, thereafter, the bacterial agglomerates grow to extremely large sizes owing to the lack of PSM expression under the specific conditions present in joints. Our findings provide a mechanistic explanation for the reported extreme resistance of joint infection to antibiotic treatment, lend support to the notions that Agr functionality and PSM production play a major role in defining different forms of S. aureus infection, and have important implications for antistaphylococcal therapeutic strategies.
INTRODUCTION
Staphylococcus aureus is a major cause of septic arthritis and orthopedic infections, in particular those developing on prosthetic joints after arthroplasty (1). In the presence of a prosthetic device, joint infection rates are at about 1 to 2% (2). Joint infections can cause prolonged disability and increased health care costs, due to prolonged antibiotic treatment, multiple surgeries, and, in difficult cases, joint fusion. If recalcitrant to treatment, these infections can cause significant morbidity, including loss of limb, systemic infection, and even death (3).
Antibiotic treatment alone is usually insufficient to eradicate joint infections. We recently showed that the pronounced recalcitrance of S. aureus joint infections to antibiotic treatment is due to exceptionally strong bacterial aggregation and biofilm formation, which renders even the high concentrations of antibiotics given prophylactically to patients ineffective (4). Biofilms are surface-attached bacterial agglomerations that frequently develop on indwelling medical devices (5). The matrix that connects cells in a biofilm consists of a variety of chemically different macromolecules, such as polymeric proteins, teichoic acids, extracellular DNA (eDNA), and polysaccharides (6). The polysaccharide intercellular adhesin (PIA; also named poly-N-acetylglucosamine [PNAG]) is the main biofilm exopolysaccharide in staphylococci (7, 8).
Using a genome-wide screen, our previous work identified specific S. aureus factors that are crucial for the establishment of biofilms and biofilm-like aggregates in synovial fluid (SF) isolated from traumatized joints (4). These included, first and foremost, surface-attached proteins that bind to human fibrin and fibronectin, which are human matrix proteins that are present in traumatized and infected joints (1, 9). S. aureus mutants defective in the fibrinogen-binding protein ClfA or ClfB, or the fibronectin-binding protein FnbA or FnbB, were unable to produce the macroscopic aggregates that the corresponding wild-type strain formed in SF.
In the present study, we analyzed the mechanistic underpinnings of the exceptionally high level of aggregate formation in SF, by testing whether this extreme phenotype is due to altered expression of distinct bacterial factors. In addition to evaluating whether altered expression of the aforementioned surface binding proteins plays a role, we analyzed whether the accessory gene regulator (Agr) and the Agr-regulated phenol-soluble modulins (PSMs) are involved. The accessory gene regulator (Agr) is a quorum-sensing system in charge of regulating virulence traits in staphylococci depending on the density of the bacterial population (10). Notably, it is a master regulator of biofilm formation (11, 12). In vitro, agr deletion mutants of S. aureus and S. epidermidis grow thicker and less structured biofilms than the isogenic wild-type strains (13–15).
PSMs are main molecular effectors of the impact that Agr has on biofilm development (13, 15). They are under strict and direct control of Agr by direct binding of the AgrA response regulator to the psm operon promoters (16). There are three loci in S. aureus that encode PSMs: the psmα locus encodes the peptides PSMα1 through PSMα4; the psmβ locus encodes PSMβ1 and PSMβ2; and RNAIII includes the gene encoding the PSM δ-toxin (17, 18). In vitro studies using TSB growth medium showed that all S. aureus PSMs impact biofilm formation in a similar way (13), i.e., they structure biofilms and lead to biofilm dispersal, which is likely due to their surfactant properties. While PSMs are important for biofilm structuring and thus biofilm development, the overall impact of PSMs on the extent of biofilm formation is negative because PSMs disperse biofilms (13, 15). Thus, these factors could not be identified in our recent work, which sought to identify factors with a generally positive impact on biofilm-like aggregation (4). Notably, the role of PSMs during S. aureus in vivo biofilm infection is not well understood. While the PSM-mediated dispersal effect has been shown to promote systemic dissemination of biofilm-associated infection, it is not known if lack of PSM production also leads to more extensive in vivo biofilm formation on indwelling devices (13).
In the present study, we show that low activity of Agr and low PSM production in SF are a major cause for the exceptionally strong aggregation behavior of S. aureus in SF. We demonstrate that PSM production has a key role in defining biofilm extension under conditions that exemplify an in vivo situation and provide evidence that contributes to our understanding of how PSMs affect biofilm dispersal.
MATERIALS AND METHODS
Ethics statement.
Human SF was drained from the joint during total knee arthroplasty in the operating room and collected with permission of the Thomas Jefferson University Institutional Review Board (IRB). A waiver for the requirement of informed written consent was obtained, because the samples were deidentified, obtained during routine procedures, and would normally have been discarded. Human serum was obtained from the blood bank of the NIH with an existing IRB protocol.
Preparation and storage of SF.
SF that was obtained as mentioned above was stored at 4°C for a period not exceeding 6 months before use. Cellularity was not recorded. All samples containing blood upon visual examination were discarded. Of note, due to the conditions of storage, white blood cells were inactive (dead) at the time of use of SF for our experiments.
Strains and growth conditions.
All experiments were performed using strain S. aureus LAC (pulsed-field type USA300), a community-associated methicillin-resistant strain, or its derivatives. The USA300 lineage is the main source of skin and prosthetic-joint infections (PJIs) in the United States (19, 20). The total Δpsm mutant (with the psmα and psmβ operons deleted and translation of δ-toxin abolished by mutation of the hld gene start codon) and the Δagr mutant of LAC were produced by sequential allelic replacement and by phage transduction from strain RN6911, respectively, and were previously described (18, 21). Of note, the LAC wild-type strain and its Δagr and Δpsm mutants do not show significant differences in growth rates and yield in SF when grown at 37°C in shaking incubators (data not shown). Strain LAC was transformed by electroporation with plasmids based on the pTXΔ plasmid background, constitutively expressing the psmα (15), psmβ (this study), hld (22), or agrA (16) gene/operon under the control of the xyl promoter. The xyl repressor gene has been removed in that plasmid series to produce a constitutive mode of expression (18). The control strain harbors the corresponding pTXΔ16 plasmid (18). Strains were grown in SF, serum, or tryptic soy broth (TSB), as indicated. Oligonucleotides used are shown in Table 1, and strains used are shown in Table 2.
TABLE 1.
Oligonucleotides used in this study
Use and primer | Sequence |
---|---|
qRT-PCR | |
RNAIII-for | GTGATGGAAAATAGTTGATGAGTTGTTT |
RNAIII-rev | GAATTTGTTCACTGTGTCGATAATCC |
RNAIII probe | TGCACAAGATATCATTTCAACAATCAGTGACTTAGTAAAA |
psmα-for | TATCAAAAGCTTAATCGAACAATTC |
psmα-rev | CCCCTTCAAATAAGATGTTCATATC |
psmα probe | AAAGACCTCCTTTGTTTGTTATGAAATCTTATTTACCAG |
agrA-for | CGTAAGCATGACCCAGTTGGT |
agrA-rev | CCATCGCTGCAACTTTGTAGAC |
agrA probe | ATTATTTTCGTTACGAGTCACAGTGAACT |
icaA-for | TGAACCGCTTGCCATGTG |
icaA-rev | CACGCGTTGCTTCCAAAGA |
icaA probe | TGGATGTTGGTTCCAGAAACATTGGGAG |
clfA-for | AGGTTCTGGTGACGGTATCGA |
clfA-rev | TCAATTTCACCAGGCTCATCAG |
clfA probe | AAACCAGTTGTTCCTGAAC |
clfB-for | TTCCAATGCGCAAGGAACTAG |
clfB-rev | CAGCATTTACTACAGGTTCAGCAACT |
clfB probe | AGACTACGTACAGCTCTCGTTCTAACACTT |
fnbA-for | TGAGCCAGAAACTCCAACAC |
fnbA-rev | TGGCAGGTGGTACTGGTTTA |
fnbA probe | CGCCAACACCAGAGGTACCAGC |
fnbB-for | AGGAATTAAGGCGGGAGATT |
fnbB-rev | TGTCGCCATAACTTGACCAT |
fnbB probe | CTCAACACTGCGTAAAGTTCCGGAGA |
rsbU-for | ACCATAACGATGGCACAATG |
rsbU -rev | TCCATAAGAATCCATGCCAA |
rsbU probe | TCCCAATGACATCTGCAACAGCA |
TRAP-for | CGTTTGTTAAGACCTGCTAAAGG |
TRAP-rev | TGTCCGCTTGAACCAAAGTA |
TRAP probe | TGCATGTCGATCAGCAAATCCG |
Luciferase reporter gene fusion construction and verification | |
luxBamHI | ATGCGGATCCTGCAGATGAAGCAAGAGGAG |
luxSalI | ATGCGTCGACGCAGCGGTATTTTTCGATCA |
P2prEco | ATGCGAATTCCTCATCAACTATTTTCCATCACATCTCTGT |
P2prBam | CAATTTTACACCACTCTCCTCACTGGGATCCCATTATACG |
P3prBam | ATGCGGATCCCTCATCAACTATTTTCCATCACATCTCTGT |
P3prEco | CAATTTTACACCACTCTCCTCACTGGAATTCCATTATACG |
psmβprSacI | GGCTTAGAAGGCCATTGCTGAGCTCAGCTGAGCTACCAGG |
psmβprBam | TATCTTTAATTGCGTTAAATAAACCTTCCATTGAAAACAGGATCCAAAA |
psmαprEco | GCCTAGACGAGACCTAACGTGGAATTCGTTTTAAAC |
psmαprBam | GATGCCAGCGATGATACCCATTAAGATTGGATCCTTGCTTAT |
scv4 | ACCCAGTTTGTAATTCCAGGAG |
scv8 | GCACATAATTGCTCACAGCCA |
scv9 | GCTGATCTAACAATCCAATCCA |
scv10 | TATACCTCGATGATGTGCATAC |
Cloning of psmβ operon | |
Psmβ1Bam | CTTCAAATGGATCCTTTAAGGAGTGTTTTCAATGGAAGG |
Psmβ2Mlu | CTGAGTGCATAACATACGCGTATGCTCACCCAGTTTATTTTAAAG |
TABLE 2.
Strains and plasmids used in this study
Strain or plasmid | Description | Reference |
---|---|---|
Strains | ||
LAC | USA300, ST8, clinical CA-MRSA clone | |
LAC Δagr | agr mutant of strain LAC, obtained by phage transduction from strain RN6911 | 18 |
LAC Δpsm | Total psm deletion mutant; psmα and psmβ operons are deleted; translation of hld is abolished by start codon mutation | 21 |
LAC P2-lux | Strain LAC containing genome-integrated luxABCDE genes under the control of the S. aureus Agr P2 promoter | This study |
LAC P3-lux | Strain LAC containing genome-integrated luxABCDE genes under the control of the S. aureus Agr P3 promoter | This study |
LAC psmα-lux | Strain LAC containing genome-integrated luxABCDE genes under the control of the S. aureus psmα promoter | This study |
LAC psmβ-lux | Strain LAC containing genome-integrated luxABCDE genes under the control of the S. aureus psmβ promoter | This study |
Plasmids | ||
pTXΔ16 | Control plasmid | 18 |
pTXΔpsmα | Tetr, psmα operon under constitutive control of the xylose promoter | 18 |
pTXΔpsmβ | Tetr, psmβ operon under constitutive control of the xylose promoter | This study |
pTXΔhld | Tetr, hld gene under constitutive control of the xylose promoter | 22 |
pTXΔagrA | Tetr, agrA gene under constitutive control of the xylose promoter | 16 |
Macroscopic determination of bacterial aggregation.
Aggregate formation was monitored by UV-fluorescent imaging of ethidium bromide (EtBr)-labeled bacteria (10 μg/ml EtBr, 10 min in the dark).
Measurement of aggregate size distribution.
Aggregate size distribution was measured using a T3 Cellometer (Nexcelom) as described previously (4). Briefly, overnight cultures were centrifuged and resuspended to a concentration of ∼1010 CFU/ml in sterile phosphate-buffered saline (PBS). One milliliter of SF, TSB, or serum was prewarmed to 37°C, 5 μl of the bacterial suspension and 20 μl of trypan blue were added, and the sample was incubated for 20 min at 37°C with agitation. The Cellometer can detect aggregates between 3 and 100 μm in size. The parameters were set to detect oddly shaped aggregates (roundness was not set as a determining factor).
qRT-PCR.
Strain LAC (initial inoculum 104 CFU/ml) was grown for 8 h in TSB, SF, or serum, in a shaking incubator at 180 rpm and 37°C. mRNA was collected using the RNeasy minikit (Qiagen), and quantitative real-time PCR (qRT-PCR) was performed as described previously (23). Oligonucleotides used are described in Table 1. All probes were labeled with 5′-carboxyfluorescein. All experiments were performed in triplicate, and data were normalized against the housekeeping gyrB gene.
Creation of luciferase reporter gene fusion constructs and luminescence measurement.
The lux operon (luxABCDE; 5.7 kb) was amplified from plasmid pXen5 (kindly given by K. Francis) (24) using the primers luxBamHI and luxSalI and cloned into plasmid pLL29 (a gift from C. Lee) (25). The P2, P3, psmα, and psmβ promoters were amplified from LAC genomic DNA and cloned into the resulting plasmid, pLL29lux, using SacI/BamHI (psmβ promoter) or EcoRI/BamHI (all other promoters) restriction sites. Then, the integration procedure protocol was performed as described previously (25). Briefly, the pLL29lux reporter fusion plasmids were electroporated into strain RN4220 carrying plasmid pLL2787, which contains the ϕ11 int gene. After selecting for clones in which the integration of the respective pLL29 plasmid into the host attB sites had occurred, the chromosome-integrated pLL29 plasmids carrying the respective lux reporter fusion were phage transduced into strain LAC. Correct integration was verified by analytical PCR. Light emitted by the luciferase gene reporter fusion constructs was measured using a Victor (Perkin-Elmer) instrument.
Immunoblotting test for PIA.
Strain LAC was inoculated at 104 CFU from a preculture grown in TSB and grown for 24 h at 37°C and 180 rpm in 1 ml of either TSB, serum, or SF. Immunodetection of polysaccharide intercellular adhesin (PIA) was then performed as described by Cramton et al. (26) to minimize cross-reactivity to protein A. In brief, all cultures were resuspended in 1 ml TSB to an optical density at 600 nm (OD600) of 10.0. Each sample was centrifuged and resuspended in 0.5 M EDTA (pH 8.0) and incubated for 5 min at 100°C. Samples were centrifuged and 40 μl of supernatant were incubated with 10 μl proteinase K (20 mg/ml) for 30 min at 37°C. A 3.5-μl portion of each sample was spotted onto nitrocellulose, dried, and blocked with 3% bovine serum albumin (BSA) for 1 h prior to the addition of anti-PIA serum (1:1,000; from rabbit). The membrane was then incubated at 4°C for 18 h. Afterwards, it was washed five times with Tris-buffered saline (TBS)–Tween (0.1%) and incubated for 2 h with Cy5-labeled goat anti-rabbit IgG (Life Technologies), followed by washing five times with TBS-Tween (0.1%). Signals were detected using a Typhoon Trio variable-mode imager (GE Healthcare).
SEM.
To prepare for scanning electron microscopy (SEM), samples were fixed with 2% paraformaldehyde in 0.1 M sodium phosphate buffer. Samples were then sent to the SEM facility at Rocky Mountain Laboratories, NIAID, where they were sputter coated using a South Bay Technology IBS/e instrument and imaged on a Hitachi SU8000 electron microscope.
Biofilm assays.
For biofilm analysis by confocal laser scanning microscopy (CLSM), strains were incubated in TSB under static conditions in an 8-well borosilicate plate for 8 h. TSB was aspirated, replaced with 200 μl of SF, and incubated for a further 24 h. Samples were then washed gently three times with sterile PBS, stained with 4 μM propidium iodide for 30 min at 37°C, and imaged using a Zeiss LSM700 confocal microscope. Total biovolume was calculated using Imaris software from three randomly chosen fields. This protocol was used for all biofilm CLSM analyses with the exception of the protocol used for the image shown in Fig. 1B, for which S. aureus (109 CFU/ml) was incubated in SF for 20 min, stained with 4 μM propidium iodide, and immediately imaged.
FIG 1.
Synovial fluid promotes multicellular aggregation of Staphylococcus aureus. (A) Biofilm formation of S. aureus strain LAC (USA300) on a titanium disk incubated for 48 h in SF from a patient who had received 2 g of cefazolin. (B and C) Formation of free-floating aggregates of strain LAC inoculated from a preculture in TSB and incubated for 20 min in SF. Aggregates were imaged using CLSM (B) and SEM (A and C). Extracellular host-derived fibrous material is pseudocolored pink; S. aureus cells are yellow. (B) CLSM was performed with staining with propidium iodide, staining cells and matrix red.
Measurement of PSMs.
After butanol extraction of PSMs, PSM production was analyzed by reversed-phase high-pressure liquid chromatography/electrospray mass spectrometry as described previously (27).
Statistics.
Statistical evaluation was performed using GraphPad Prism version 6.02, with t tests for the comparison of two and one-way ANOVA for the comparison of more than two groups. Multiple comparisons with one-way ANOVA were performed using Tukey's posttests.
RESULTS
Biofilms and free-floating aggregates form in synovial fluid isolated from patients.
In the present study, we used an ex vivo approach to study the mechanistic underpinnings of the formation of free-floating and surface-attached S. aureus agglomerates (biofilms) during prosthetic joint infection (PJI). We isolated synovial fluid (SF) from noninfected patients undergoing surgery, thus reproducing the environmental conditions the bacteria encounter when mounting a postoperative joint infection. All experiments were performed using strain LAC, representing pulsed-field type USA300, the predominant cause of PJI in the United States (19).
Even when SF was isolated from patients who had received high doses of prophylactic antibiotic, which leads to high concentrations of antibiotic in SF (28), biofilms formed on titanium disks over the course of 48 h (Fig. 1A), underscoring the notion that S. aureus PJIs are recalcitrant to antibiotic treatment due to the formation of biofilms (4, 28). Notably, extensive biofilm-like aggregates formed within minutes after incubation of the bacteria in SF and were characterized by the attachment of fibrous material (Fig. 1B and C).
Extreme agglomeration of S. aureus in SF is not due to increased expression of proteins interacting with host matrix molecules.
We first analyzed expression of the factors determined in our previous transposon bank screen to be essential for aggregation in SF (4) and asked if increased expression of these factors causes the exceptional degree of agglomeration. These factors included mostly surface binding proteins, namely, the fibrinogen-binding proteins ClfA and ClfB and the fibronectin-binding proteins FnbA and FnbB (4). We have shown that the fibrinolytic protease plasmin can degrade the agglomerates, indicating that fibrin plays a major role among the host-derived factors that contribute to agglomerate formation (4). Furthermore, fibrin binding is considered more significant than binding to fibronectin, since fibrin concentration is higher in traumatized joints (9). The fibronectin-binding proteins showed increased expression in SF over serum and TSB (FnbA, 3.9 times higher than in TSB and 3.2 times higher than in serum; FnbB, 12.1 times higher than in TSB and 7.6 times higher than in serum) (Fig. 2). However, expression of the fibrinogen-binding proteins in SF was low in comparison, in particular in the case of ClfA (0.12 times higher than in TSB and 0.17 times higher than in serum) (Fig. 2). Furthermore, absolute expression values were by far highest for ClfA among the four surface binding proteins (highest mean Qgene/QgyrB values [where Qgene is the abundance of a given transcript and QgyrB is the abundance of the gyrB transcript] achieved: ClfA, 8.3; ClfB, 1.5; FnbA, 0.5; FnbB, 0.6), which is why the pronounced differences observed for this fibrinogen-binding protein matter most in relative terms (Fig. 2). Thus, while fibrinogen- and fibronectin-binding proteins are required as a basis of aggregate formation in SF, our results indicate that, taken together, differences in their expression do not appear to contribute considerably to the strong degree of aggregation behavior in SF.
FIG 2.
Expression of genes previously identified to be required for aggregation in SF (clfA, clfB, fnbA, fnbB, trap, and rsbU) in SF, TSB, and serum. The six genes previously identified by a transposon bank screen to be required for the aggregation behavior in SF were assayed by qRT-PCR for comparative expression in SF versus human serum and TSB. Samples were taken at 8 h of suspended growth. The experiments were performed in triplicate. Error bars show standard deviations (SD). *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001.
Expression levels of the regulatory factors RsbU and TRAP also previously identified in our screen (4) were roughly equivalent in SF and serum, with a small increase over expression in TSB, indicating that these are also unlikely to be responsible for the strong aggregation phenotype (Fig. 2).
S. aureus shows low activity of Agr and low production of PSMs in SF.
As an alternative explanation, we evaluated whether low activity of the biofilm regulator Agr is responsible for the excessive formation of aggregates and biofilms in SF. To investigate this hypothesis, we constructed reporter gene fusion constructs. In these constructs, the agr P3 or P2 promoters were fused to the lux genes driving production of light-emitting luciferase. P3 drives expression of RNAIII, the intracellular regulator of most Agr targets (29), and P2 drives expression of the Agr proteins making up the Agr autoregulatory quorum-sensing circuit (30). Notably, all luciferase promoter fusions were cloned in the genome of strain LAC. In contrast to plasmid-based systems, which are often used for this purpose, genome insertion ensures that the obtained results accurately reflect natural expression and are not due to multiple, plasmid-introduced copies of the respective genes. During all stages of in vitro growth, Agr (P2 and P3) activity in human SF was extremely low, lower than in human serum and much lower than in TSB (Fig. 3A and B). This was verified using qRT-PCR with the agrA (controlled by the P2 promoter) and RNAIII (controlled by the P3 promoter) genes (Fig. 3C and D).
FIG 3.
Agr activity and PSM production are low in synovial fluid. (A and B) Activity of the Agr P3 (A) and the Agr P2 promoter (B) measured during suspended growth in SF, human serum, or TSB, using genome-integrated, single-copy luxABCDE luciferase operon reporter fusion constructs. (C and D) Expression of RNAIII (C) and agrA (D) at 8 h of growth, measured by qRT-PCR. (E and F) Expression of psmα (E) and psmβ (F) promoters during growth in SF, human serum, or TSB, using genome-integrated, single-copy luxABCDE luciferase operon reporter fusion constructs. (G) Expression of psmα operon by qRT-PCR, at 8 h of growth. (H) PSM production determined in culture filtrates after 8 h of growth. All experiments were performed in triplicate. Error bars show standard deviations (SD). *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001.
To analyze expression of the Agr-controlled PSMs in SF, we again used genome-integrated luciferase reporter gene constructs in strain LAC in addition to qRT-PCR measurements. The results confirmed our expectations, inasmuch as expression of the psmα and psmβ loci was extremely low (Fig. 3E to G), as shown above for RNAIII (Fig. 3C), which also contains the hld gene encoding the δ-toxin. Furthermore, we measured PSM production on the protein level (Fig. 3H), which confirmed the results achieved on the transcriptional level. These results demonstrate extremely low production of all PSMs in SF and suggest that low PSM production is a major reason for the marked formation of aggregates in SF.
Low production of the Agr-controlled phenol-soluble modulins is a major factor promoting bacterial aggregation and formation of biofilms in SF.
To analyze whether the observed low activity of Agr in SF and low production of the biofilm-dispersing PSMs are responsible for the aggregative phenotype in SF, we determined the extent of bacterial agglomeration of wild-type and isogenic Δagr and Δpsm mutants as visualized microscopically and using a Cellometer. In the Δpsm mutant, all psm genes have been removed or translation has been abolished (21). We found that all strains, notably including the wild-type strain, showed extensive agglomeration in SF, while in TSB, only Δagr and Δpsm mutants produced agglomerates (Fig. 4). Furthermore, the extent of agglomeration in SF was not statistically different in the wild type and the Δagr and Δpsm mutants. These results showed that low activity of Agr and suppression of the Agr-controlled PSMs cause exceptionally strong aggregate production in SF.
FIG 4.
Aggregate size distribution after incubation of S. aureus under different conditions. (A) Size distribution of aggregates, measured by a Cellometer, after 20 min incubation in the respective fluids (SF or TSB) of LAC wild-type (WT), isogenic Δagr deletion, or total Δpsm deletion strains. Aggregates between 10 and 100 μm were determined; larger aggregates cannot be measured by this method. (B) Corresponding representative microscopic pictures. Note the absence of clusters in the TSB wild-type sample in both panels. Scale bars, 50 μm.
To provide further evidence for the role of PSMs and Agr in aggregation in SF and delineate the specific role of different PSM types, we transformed the LAC wild-type strain with plasmids carrying the psmα, psmβ, hld (encoding δ-toxin), or agrA genes/operons under the control of a constitutively active promoter. In these constructs, low expression of those genes in SF is thus overcome by constitutive expression. We first analyzed the formation of macroscopic clusters during 24-h growth in microtiter plates. In SF, the LAC wild-type strain formed a large cluster, in accordance with our previous results (4); this was not the case in serum or TSB (Fig. 5). Importantly, no cluster formation was visible when the strains expressing psmα, psmβ, or hld genes/operons were incubated in SF. Similarly, no cluster formation was detected when agrA, which controls expression of all of these genes, was expressed (16). Furthermore, the Δpsm mutant, devoid of PSM production, showed large cluster formation in SF, similar to that observed with the wild-type and Δagr strain.
FIG 5.
PSM expression abolishes the formation of macroscopic cell clusters in SF. The LAC wild-type strain (WT) was inoculated into 200 μl SF, human serum, or TSB at 104 CFU and incubated under static conditions for 18 h. In addition, the LAC Δagr and Δpsm strains and derivatives of the LAC wild-type strain containing either plasmids (pTXΔ) for constitutive expression of agrA, psmα, psmβ, or hld genes or a control plasmid (pTXΔ16) were inoculated and grown under the same conditions in SF. Plasmid-containing strains received 12.5 μg/ml tetracycline for plasmid maintenance. Afterwards, cell clusters were visualized by staining with ethidium bromide. Note that large clusters formed only in the WT (when grown in SF) and SF-grown Δagr, Δpsm, and plasmid control samples (arrows), whereas expression of any of the psm loci or the PSM regulator agrA resulted in abolishment of cluster formation.
We next analyzed biofilm formation of the constitutive-expression constructs by confocal laser scanning microscopy (CLSM) with an analysis of total biovolume. Similar to the results obtained for macroscopic cluster formation, biofilm formation by the constructs expressing psmα, psmβ, hld, or agrA was significantly less pronounced than that by the wild-type strain (Fig. 6). Together, these results identify the lack of PSM production as the main cause for the extensive biofilm and aggregate formation in SF and show that all PSM types have the capacity to disrupt aggregates.
FIG 6.
PSM expression abolishes biofilm formation in SF. (A) Derivatives of the LAC wild-type strain containing plasmids (pTXΔ) for constitutive expression of agrA, psmα, psmβ, or hld genes or a control plasmid (pTXΔ16) were assayed for biofilm formation in SF under static conditions (24-h growth). Plasmid-containing strains received 12.5 μg/ml tetracycline for plasmid maintenance. Biofilms were stained with propidium iodide for CLSM. (B) The total biovolume was calculated using Imaris software using 3 randomly chosen image fields. Error bars show standard deviations (SD). ****, P < 0.0001.
PSMs work by dispersing biofilm matrix molecules such as PIA.
The surfactant characteristics of PSMs suggest that these molecules function during biofilm development by disrupting the interaction of biofilm matrix molecules with each other and the bacterial cell surface (31). However, this has not yet been examined experimentally. PIA is considered a major biofilm matrix component in staphylococci (6). We showed previously that strain LAC produces a large amount of surface-located PIA when grown in SF (4). Transcription of the ica PIA biosynthesis operon (as determined by qRT-PCR of the icaA gene) was not increased in SF (Fig. 7A). However, immunological assessment using PIA-specific antibodies revealed that (i) PIA retention on the bacterial surface was significantly higher in SF than TSB and serum (Fig. 7B) and (ii) PIA was released from the bacterial surface in a PSM-dependent manner (Fig. 7C). The latter was demonstrated by the fact that surface PIA levels were similarly high in the isogenic Δpsm mutant when it was grown in either TSB or SF and in the wild-type strain grown in SF (conditions without or with very low PSM production) but significantly higher than PIA surface levels in the wild-type strain grown in TSB (under which condition PSMs are produced) (Fig. 7C). These results suggest that PIA matrix molecules are abundant on the bacterial surface in the absence of PSMs, indicating that PSMs cause separation of the PIA matrix molecules from the bacterial surface.
FIG 7.
Growth in SF leads to increased retention of the biofilm exopolysaccharide PIA on cells. (A) Expression of PIA biosynthetic operon (measured by qRT-PCR of the icaA gene) at 8 h of growth under different conditions. (B and C) Cell-bound PIA after 12 h of growth, measured using detection by anti-PIA antiserum in immune dot blots followed by densitometry. Error bars show standard deviations (SD). *, P < 0.05; ****, P < 0.0001 (1-way ANOVA versus the SF value [B] and versus the WT SF value [C]). (D) Wild-type LAC (WT) and the PSM-free isogenic Δpsm strain were grown for 8 h in TSB, and bacterial cells were assayed by SEM. Cell clusters were not found in the wild-type strain but were found in high numbers in the Δpsm strain (also compare the results shown in Fig. 3, obtained using a Cellometer).
To provide further evidence supporting that mechanism, we compared cluster formation of the wild-type and Δpsm mutant strains using scanning electron microscopy (SEM). This was done in TSB, because (i) there is no host-derived fibrous material overshadowing bacterial exopolymers during growth in TSB and (ii) we have shown here that there is virtually no PSM production in SF. SEM showed only single cells and no cluster formation of the wild-type strain (in accordance with the results shown in Fig. 4). In contrast, the Δpsm mutant formed clusters, which had fibrous material on their surface (Fig. 7D), which—in the absence of host material such as fibrin—are strongly indicative of the deposition of bacterial biofilm matrix molecules, such as PIA, but also likely includes other biofilm matrix components, such as teichoic acids, extracellular DNA, and biofilm matrix proteins. Thus, these findings further confirmed that PSMs interfere with the deposition of matrix molecules on the bacterial surface.
DISCUSSION
In our previous study, we discovered that S. aureus proteins that connect the bacteria to the human matrix proteins fibrin and fibronectin are prerequisites for the formation of biofilms and biofilm-like aggregates during joint infections (4). In the present study, we asked which factors are responsible for the excessively strong degree of aggregate and biofilm formation in SF, which is the basis for the notorious recalcitrance of such infections to antibiotic treatment (28). We identified the low activity of Agr and consequentially low production of PSMs as major factors contributing to that phenotype. Our results support a two-step model of aggregate formation during joint infection which includes (i) bacterial attachment to fibrin and fibronectin via ClfA, ClfB, FnbA, and FnbB and (ii) extensive agglomeration of cells and bacterial matrix molecules, owing to the absence of the surfactant-like, separating effect of the Agr-controlled PSMs. It appears surprising at first glance that there is low activity of the quorum-sensing regulator Agr in cellular aggregates, despite such aggregates representing a high-cell-density situation. However, we and others have observed overall low activity of Agr activity in in vitro staphylococcal biofilms (11, 12, 32). Furthermore, there has been considerable doubt about a direct correlation of cell density and the activity of quorum-sensing systems (33). Whether the low activity of Agr in SF is due to specific factors that are present in SF, such as hyaluronic acid (34, 35), or the overall chemical composition of SF (35) awaits further investigation. One specific possibility that remains to be explored is whether the increased concentration of serum proteins in traumatized SF (36) contributes to a quorum-quenching effect due to sequestration of the Agr pheromone, as described for apolipoprotein B (37).
The significance of our results extends beyond joint infection. For the first time, we provide evidence in a system closely resembling in vivo conditions, and this evidence underscores a key role of PSM production in defining the extent of S. aureus biofilms. Specifically, we demonstrate that low PSM production causes strongly increased biofilm formation. Furthermore, we show that absence of PSMs leads to increased formation of floating aggregates, which was shown previously only for surface-attached biofilms (13, 15). Moreover, our results provide previously unavailable evidence for the mechanism by which PSMs disperse biofilms, inasmuch as we demonstrate PSM-dependent release of PIA from the bacterial surface.
Our results are of particular interest given that in vitro studies have led to two different models of how PSM production impacts S. aureus biofilm development. Our previous studies, performed using TSB, indicated that absence of PSMs leads to more extensive and compact biofilm formation, owing to a lack of PSM-mediated biofilm structuring and dispersal (13). In contrast, using a different growth medium, Schwartz et al. observed that PSMs form amyloid-like fibrils that promote (rather than decrease) biofilm formation in vitro (38). In our present study, we demonstrate that under conditions emulating the in vivo situation present during a biofilm-associated infection, absence of PSMs leads to extensive formation of biofilms, while the amyloid model of Schwartz et al. would have predicted that in the absence of PSMs, biofilms would be less pronounced. In accordance with our previous in vivo results (13), our present findings further suggest that the role of PSM amyloid fibrils in biofilm development applies only to a very specific in vitro setup.
Our results further support the notion that differences in Agr activity are associated with different types of staphylococcal infection and demonstrate the crucial role that PSMs play in that association. Mutants that are dysfunctional in Agr have been found more frequently in chronic, biofilm-associated infections (14, 39) and in cases of S. aureus bacteremia (40). In contrast, a functional Agr system and high production of Agr-regulated toxins, such as PSMs and alpha-toxin, are associated with acute forms of S. aureus infection, such as acute skin and lung infections (18, 41, 42), and osteomyelitis (43). Since there is continual developing of drugs targeting the Agr system (44), we caution that the use of Agr-blocking therapeutics should be limited to certain infection types and would be counterproductive in others.
In conclusion, the findings from our study indicate that the exceptional recalcitrance of staphylococcal PJI to antibiotic treatment (28) is due to the specific environment in joints that suppresses Agr and production of biofilm-dispersing PSMs, which together with the interaction with host-derived fibrin leads to the formation of extensive bacterial agglomerates. These results further our understanding about the role Agr and PSMs play in defining biofilm-associated S. aureus disease, which could lead to the development of antibiofilm therapeutic strategies against PJI. Our findings suggest that therapeutic strategies against staphylococcal PJI should target the host-derived and bacterial factors that contribute to agglomerate formation, such as fibrin and bacterial biofilm matrix molecules, including PIA.
ACKNOWLEDGMENTS
This study was supported by the Intramural Research Program of the National Institute of Allergy and Infectious Diseases (NIAID), U.S. National Institutes of Health (NIH) (ZIA AI000904-13, to M.O.). This study was also supported by NIH grants HD06153 and DE019901 to N.J.H., and S.S.D. was supported by a T32 NIH training grant (T32-AR-052273).
We thank Chia Lee and Kevin Francis for providing plasmids and Javad Parvizi for collecting synovial fluid. We also thank Irving M. Shapiro for thoughtful discussions.
REFERENCES
- 1.Shirtliff ME, Mader JT. 2002. Acute septic arthritis. Clin Microbiol Rev 15:527–544. doi: 10.1128/CMR.15.4.527-544.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Kurtz SM, Lau E, Watson H, Schmier JK, Parvizi J. 2012. Economic burden of periprosthetic joint infection in the United States. J Arthroplasty 27:61–65.e1. doi: 10.1016/j.arth.2012.02.022. [DOI] [PubMed] [Google Scholar]
- 3.Zimmerli W, Trampuz A, Ochsner PE. 2004. Prosthetic-joint infections. N Engl J Med 351:1645–1654. doi: 10.1056/NEJMra040181. [DOI] [PubMed] [Google Scholar]
- 4.Dastgheyb S, Parvizi J, Shapiro IM, Hickok NJ, Otto M. 2015. Effect of biofilms on recalcitrance of staphylococcal joint infection to antibiotic treatment. J Infect Dis 211:641–650. doi: 10.1093/infdis/jiu514. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Donlan RM. 2001. Biofilms and device-associated infections. Emerg Infect Dis 7:277–281. doi: 10.3201/eid0702.010226. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Otto M. 2008. Staphylococcal biofilms. Curr Top Microbiol Immunol 322:207–228. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Cramton SE, Gerke C, Schnell NF, Nichols WW, Gotz F. 1999. The intercellular adhesion (ica) locus is present in Staphylococcus aureus and is required for biofilm formation. Infect Immun 67:5427–5433. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Mack D, Fischer W, Krokotsch A, Leopold K, Hartmann R, Egge H, Laufs R. 1996. The intercellular adhesin involved in biofilm accumulation of Staphylococcus epidermidis is a linear beta-1,6-linked glucosaminoglycan: purification and structural analysis. J Bacteriol 178:175–183. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Lack CH. 1959. Chondrolysis in arthritis. J Bone Joint Surg Br 41–B:384–387. [DOI] [PubMed] [Google Scholar]
- 10.Kornblum J, Kreiswirth B, Projan SJ, Ross H, Novick RP. 1990. agr; a polycistronic locus regulating exoprotein synthesis in Staphylococcus aureus, p 373–402. In Novick RP. (ed), Molecular biology of the staphylococci. VCH Publishers, New York, NY. [Google Scholar]
- 11.Vuong C, Saenz HL, Gotz F, Otto M. 2000. Impact of the agr quorum-sensing system on adherence to polystyrene in Staphylococcus aureus. J Infect Dis 182:1688–1693. doi: 10.1086/317606. [DOI] [PubMed] [Google Scholar]
- 12.Yarwood JM, Bartels DJ, Volper EM, Greenberg EP. 2004. Quorum sensing in Staphylococcus aureus biofilms. J Bacteriol 186:1838–1850. doi: 10.1128/JB.186.6.1838-1850.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Periasamy S, Joo HS, Duong AC, Bach TH, Tan VY, Chatterjee SS, Cheung GY, Otto M. 2012. How Staphylococcus aureus biofilms develop their characteristic structure. Proc Natl Acad Sci U S A 109:1281–1286. doi: 10.1073/pnas.1115006109. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Vuong C, Kocianova S, Yao Y, Carmody AB, Otto M. 2004. Increased colonization of indwelling medical devices by quorum-sensing mutants of Staphylococcus epidermidis in vivo. J Infect Dis 190:1498–1505. doi: 10.1086/424487. [DOI] [PubMed] [Google Scholar]
- 15.Wang R, Khan BA, Cheung GY, Bach TH, Jameson-Lee M, Kong KF, Queck SY, Otto M. 2011. Staphylococcus epidermidis surfactant peptides promote biofilm maturation and dissemination of biofilm-associated infection in mice. J Clin Invest 121:238–248. doi: 10.1172/JCI42520. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Queck SY, Jameson-Lee M, Villaruz AE, Bach TH, Khan BA, Sturdevant DE, Ricklefs SM, Li M, Otto M. 2008. RNAIII-independent target gene control by the agr quorum-sensing system: insight into the evolution of virulence regulation in Staphylococcus aureus. Mol Cell 32:150–158. doi: 10.1016/j.molcel.2008.08.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Peschel A, Otto M. 2013. Phenol-soluble modulins and staphylococcal infection. Nat Rev Microbiol 11:667–673. doi: 10.1038/nrmicro3110. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Wang R, Braughton KR, Kretschmer D, Bach TH, Queck SY, Li M, Kennedy AD, Dorward DW, Klebanoff SJ, Peschel A, DeLeo FR, Otto M. 2007. Identification of novel cytolytic peptides as key virulence determinants for community-associated MRSA. Nat Med 13:1510–1514. doi: 10.1038/nm1656. [DOI] [PubMed] [Google Scholar]
- 19.Kourbatova EV, Halvosa JS, King MD, Ray SM, White N, Blumberg HM. 2005. Emergence of community-associated methicillin-resistant Staphylococcus aureus USA 300 clone as a cause of health care-associated infections among patients with prosthetic joint infections. Am J Infect Control 33:385–391. doi: 10.1016/j.ajic.2005.06.006. [DOI] [PubMed] [Google Scholar]
- 20.DeLeo FR, Otto M, Kreiswirth BN, Chambers HF. 2010. Community-associated meticillin-resistant Staphylococcus aureus. Lancet 375:1557–1568. doi: 10.1016/S0140-6736(09)61999-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Joo HS, Cheung GY, Otto M. 2011. Antimicrobial activity of community-associated methicillin-resistant Staphylococcus aureus is caused by phenol-soluble modulin derivatives. J Biol Chem 286:8933–8940. doi: 10.1074/jbc.M111.221382. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Nakamura Y, Oscherwitz J, Cease KB, Chan SM, Munoz-Planillo R, Hasegawa M, Villaruz AE, Cheung GY, McGavin MJ, Travers JB, Otto M, Inohara N, Nunez G. 2013. Staphylococcus delta-toxin induces allergic skin disease by activating mast cells. Nature 503:397–401. doi: 10.1038/nature12655. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Li M, Cha DJ, Lai Y, Villaruz AE, Sturdevant DE, Otto M. 2007. The antimicrobial peptide-sensing system aps of Staphylococcus aureus. Mol Microbiol 66:1136–1147. doi: 10.1111/j.1365-2958.2007.05986.x. [DOI] [PubMed] [Google Scholar]
- 24.Francis KP, Joh D, Bellinger-Kawahara C, Hawkinson MJ, Purchio TF, Contag PR. 2000. Monitoring bioluminescent Staphylococcus aureus infections in living mice using a novel luxABCDE construct. Infect Immun 68:3594–3600. doi: 10.1128/IAI.68.6.3594-3600.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Luong TT, Lee CY. 2007. Improved single-copy integration vectors for Staphylococcus aureus. J Microbiol Methods 70:186–190. doi: 10.1016/j.mimet.2007.04.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Cramton SE, Gerke C, Gotz F. 2001. In vitro methods to study staphylococcal biofilm formation. Methods Enzymol 336:239–255. doi: 10.1016/S0076-6879(01)36593-X. [DOI] [PubMed] [Google Scholar]
- 27.Joo HS, Otto M. 2014. The isolation and analysis of phenol-soluble modulins of Staphylococcus epidermidis. Methods Mol Biol 1106:93–100. doi: 10.1007/978-1-62703-736-5_7. [DOI] [PubMed] [Google Scholar]
- 28.Dastgheyb S, Hammoud S, Ketonis C, Liu AY, Fitzgerald K, Parvizi J, Purtill J, Ciccotti M, Shapiro IM, Otto M, Hickok NJ. 2015. Staphylococcal persistence due to biofilm formation in synovial fluid containing prophylactic cefazolin. Antimicrob Agents Chemother 59:2122–2128. doi: 10.1128/AAC.04579-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Novick RP, Ross HF, Projan SJ, Kornblum J, Kreiswirth B, Moghazeh S. 1993. Synthesis of staphylococcal virulence factors is controlled by a regulatory RNA molecule. EMBO J 12:3967–3975. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Novick RP, Projan SJ, Kornblum J, Ross HF, Ji G, Kreiswirth B, Vandenesch F, Moghazeh S. 1995. The agr P2 operon: an autocatalytic sensory transduction system in Staphylococcus aureus. Mol Gen Genet 248:446–458. doi: 10.1007/BF02191645. [DOI] [PubMed] [Google Scholar]
- 31.Hall PR, Elmore BO, Spang CH, Alexander SM, Manifold-Wheeler BC, Castleman MJ, Daly SM, Peterson MM, Sully EK, Femling JK, Otto M, Horswill AR, Timmins GS, Gresham HD. 2013. Nox2 modification of LDL is essential for optimal apolipoprotein B-mediated control of agr type III Staphylococcus aureus quorum-sensing. PLoS Pathog 9:e1003166. doi: 10.1371/journal.ppat.1003166. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Vuong C, Gerke C, Somerville GA, Fischer ER, Otto M. 2003. Quorum-sensing control of biofilm factors in Staphylococcus epidermidis. J Infect Dis 188:706–718. doi: 10.1086/377239. [DOI] [PubMed] [Google Scholar]
- 33.Redfield RJ. 2002. Is quorum sensing a side effect of diffusion sensing? Trends Microbiol 10:365–370. doi: 10.1016/S0966-842X(02)02400-9. [DOI] [PubMed] [Google Scholar]
- 34.Blau S, Janis R, Hamerman D, Sandson J. 1965. Cellular origin of hyaluronateprotein in human synovial membrane. Science 150:353–355. doi: 10.1126/science.150.3694.353. [DOI] [PubMed] [Google Scholar]
- 35.Ropes MW, Rossmeisl EC, Bauer W. 1940. The origin and nature of normal human synovial fluid. J Clin Invest 19:795–799. doi: 10.1172/JCI101182. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Kim WJ, Ahn YS, Kim SJ, Jahng JS, Hong SS. 1976. Study on the fractionation of synovial fluid protein. Yonsei Med J 17:109–114. doi: 10.3349/ymj.1976.17.2.109. [DOI] [PubMed] [Google Scholar]
- 37.Peterson MM, Mack JL, Hall PR, Alsup AA, Alexander SM, Sully EK, Sawires YS, Cheung AL, Otto M, Gresham HD. 2008. Apolipoprotein B is an innate barrier against invasive Staphylococcus aureus infection. Cell Host Microbe 4:555–566. doi: 10.1016/j.chom.2008.10.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Schwartz K, Syed AK, Stephenson RE, Rickard AH, Boles BR. 2012. Functional amyloids composed of phenol soluble modulins stabilize Staphylococcus aureus biofilms. PLoS Pathog 8:e1002744. doi: 10.1371/journal.ppat.1002744. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Traber KE, Lee E, Benson S, Corrigan R, Cantera M, Shopsin B, Novick RP. 2008. agr function in clinical Staphylococcus aureus isolates. Microbiology 154:2265–2274. doi: 10.1099/mic.0.2007/011874-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Fowler VG Jr, Sakoulas G, McIntyre LM, Meka VG, Arbeit RD, Cabell CH, Stryjewski ME, Eliopoulos GM, Reller LB, Corey GR, Jones T, Lucindo N, Yeaman MR, Bayer AS. 2004. Persistent bacteremia due to methicillin-resistant Staphylococcus aureus infection is associated with agr dysfunction and low-level in vitro resistance to thrombin-induced platelet microbicidal protein. J Infect Dis 190:1140–1149. doi: 10.1086/423145. [DOI] [PubMed] [Google Scholar]
- 41.Bubeck Wardenburg J, Bae T, Otto M, DeLeo FR, Schneewind O. 2007. Poring over pores: alpha-hemolysin and Panton-Valentine leukocidin in Staphylococcus aureus pneumonia. Nat Med 13:1405–1406. doi: 10.1038/nm1207-1405. [DOI] [PubMed] [Google Scholar]
- 42.Cheung GY, Wang R, Khan BA, Sturdevant DE, Otto M. 2011. Role of the accessory gene regulator agr in community-associated methicillin-resistant Staphylococcus aureus pathogenesis. Infect Immun 79:1927–1935. doi: 10.1128/IAI.00046-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Cassat JE, Hammer ND, Campbell JP, Benson MA, Perrien DS, Mrak LN, Smeltzer MS, Torres VJ, Skaar EP. 2013. A secreted bacterial protease tailors the Staphylococcus aureus virulence repertoire to modulate bone remodeling during osteomyelitis. Cell Host Microbe 13:759–772. doi: 10.1016/j.chom.2013.05.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Khan BA, Yeh AJ, Cheung GY, Otto M. 2015. Investigational therapies targeting quorum-sensing for the treatment of Staphylococcus aureus infections. Expert Opin Invest Drugs 24:689–704. doi: 10.1517/13543784.2015.1019062. [DOI] [PMC free article] [PubMed] [Google Scholar]