Skip to main content
Molecules and Cells logoLink to Molecules and Cells
. 2015 May 27;38(6):548–561. doi: 10.14348/molcells.2015.0044

Expression Analyses Revealed Thymic Stromal Co-Transporter/Slc46A2 Is in Stem Cell Populations and Is a Putative Tumor Suppressor

Ki Yeon Kim 1, Gwanghee Lee 2,4, Minsang Yoon 1, Eun Hye Cho 1, Chan-Sik Park 3, Moon Gyo Kim 1,*
PMCID: PMC4469913  PMID: 26013383

Abstract

By combining conventional single cell analysis with flow cytometry and public database searches with bioinformatics tools, we extended the expression profiling of thymic stromal cotransporter (TSCOT), Slc46A2/Ly110, that was shown to be expressed in bipotent precursor and cortical thymic epithelial cells. Genome scale analysis verified TSCOT expression in thymic tissue- and cell type- specific fashion and is also expressed in some other epithelial tissues including skin and lung. Coexpression profiling with genes, Foxn1 and Hoxa3, revealed the role of TSCOT during the organogenesis. TSCOT expression was detected in all thymic epithelial cells (TECs), but not in the CD31+ endothelial cell lineage in fetal thymus. In addition, ABC transporter-dependent side population and Sca-1+ fetal TEC populations both contain TSCOT-expressing cells, indicating TEC stem cells express TSCOT. TSCOT expression was identified as early as in differentiating embryonic stem cells. TSCOT expression is not under the control of Foxn1 since TSCOT is present in the thymic rudiment of nude mice. By searching variations in the expression levels, TSCOT is positively associated with Grhl3 and Irf6. Cytokines such as IL1b, IL22 and IL24 are the potential regulators of the TSCOT expression. Surprisingly, we found TSCOT expression in the lung is diminished in lung cancers, suggesting TSCOT may be involved in the suppression of lung tumor development. Based on these results, a model for TEC differentiation from the stem cells was proposed in context of multiple epithelial organ formation.

Keywords: Ly110, SLC46A2, stem cell, thymic epithelial cell, TSCOT, tumor suppressor

INTRODUCTION

Thymus produces educated T cells that can react with peptide antigen loaded on a self major histocompatibility complex (MHC) but not with self antigens. Developing thymocytes are guided and selected in the microenvironment of thymic stromal cells. Among the stromal cells, thymic epithelial cells (TECs) are major components that plays important roles of thymocyte differentiation in the separate compartments, the cortex and the medulla.

TECs also play critical roles during thymic organogenesis as shown in Foxn1 mutant mice, in which early TEC differentiation is abrogated, functional thymus lacks and, therefore, no T cell is present (Nehls et al., 1996). In mice, initial thymic structure begins to form with the TEC precursor cells originated from the third pharyngeal pouch around fetal day 10.5 (Blackburn and Manley, 2004; Gill et al., 2003; Rodewald, 2008; Su et al., 2001). At this stage, fetal thymus does not show clear medullary compartmentalization yet although the cells of medullary thymic epithelial cells (mTECs) in nature are found (Roberts et al., 2012). Fetal thymus begins to express the cortex-specific markers such as CDR1 in addition to general epithelial markers, EpCAM and MHCII (Ahn et al., 2008; Boehm, 2008; Lee et al., 2012; Yang et al., 2005). Later, thymus undergoes atrophy by aging after puberty and/or by damaging insults such as radiation or stress hormones (Blackburn et al., 2002; Cheng et al., 2010; Gill et al., 2003). However, thymus can also be rejuvenated by removing steroid sex hormones or removing organs that produce sex hormones (Berzins et al., 2002; Lynch et al., 2009; Sutherland et al., 2005). The functional thymic epithelial stem cell (sTEC) in the adult or aged animals were identified (Blackburn et al., 2002; Rodewald et al., 2001; Swann and Boehm, 2007; Ucar et al., 2014; Wong et al., 2014). It is important to identify the molecular marker present in the sTEC to understand the mechanism of thymic regeneration and to translate into the clinic for the recovery of important cellular immunity.

There has been much evidence that cortical TEC (cTEC) and mTEC are derived from the single precursor TECs (pTEC) or sTEC (Bleul et al., 2006; Rossi et al., 2006). While pTEC can be bipotent or specific lineage- committed (Park et al., 2013; Ucar et al., 2014), TEC development may be more progressive without instant commitment to a specific lineage (Alves et al., 2014). The original specific antibodies used for the identification of sTECs are MTS24 and MTS20 (Bennett et al., 2002; Gill et al., 2002). These TEC stem cells were located in the small medullary islets of very young thymus or corticomedullary junction of the adult thymus (Rodewald et al., 2001). The cytokeratin K5 and K8 are also important molecules for the identification of sTECs (Klug et al., 1998; 2002). It was also proposed that TEC stem cells reside in the MTS10+ cells in the medullary area.

It has been considered that Foxn1 might be the master key transcription factor controlling TEC differentiation (Chen et al., 2009; Cheng et al., 2010; Corbeaux et al., 2010; Manley and Condie, 2010; Nowell et al., 2011; Ucar et al., 2014). Some other transcription factors such as Pax1/9 and Hoxa3, and signaling molecules such as Shh, Wnt, Bmp and Fgf were also identified from the studies using the mouse lines with gene ablation (Hollander et al., 2006; Manley and Condie, 2010). Those molecules function from the stage of third pharyngeal pouch to the initial state of thymus formation. Foxn1 appears to be important for the survival and proliferation of committed TECs at the stage of thymic organ maintenance. Wnt4 is responsible for the expression of Foxn1 (Balciunaite et al., 2002).

However, the presence of sTEC without Foxn1 expression was recently shown by Bruno Keywisky’s group by using a new feature for stem cells to be able to form spheres in 3D culture (Ucar et al., 2014). Methods which can isolate stem cells based on their functionality will provide thrust for the studies on the initiation of thymic organogenesis at the molecular level and on the detailed processes on how it behaves. Our understanding of sTEC is still in a primitive state. One of the distinguished common features of stem cells, either from the specific organs or even from cancer cells, is called “side population” (SP) in flow cytometry (Golebiewska et al., 2011; Zhou et al., 2001). The cells in the side population emit both blue and red fluorescence from the DNA staining dye, Hoechst33342. This phenomenon is mediated by the ABC transporters and can be blocked by the inhibitor (Golebiewska et al., 2011; Zhou et al., 2001). Therefore, it is very useful to identify stem cells when no well-characterized stem cell marker is available.

TSCOT (Slc46A2/Ly110) is a gene encoding cTEC-specific membrane protein (Ahn et al., 2008; Chen et al., 2000; Kim et al., 2000; Yang et al., 2005), isolated from the cDNA library of SCID thymus and of fetal thymic stroma (Kim et al., 1998; Park, 1997). Its expression peaks at the early stage of thymic development and reduces when the thymus is more mature (Ahn et al., 2008; Kim et al., 2000; Lee et al., 2012; Yang et al., 2005). When LacZ reporter is inserted in the TSCOT locus, β-galactosidase expression was found in the whole thymus of new born but only in the cortex and corticomedullary junction of adults (Ahn et al., 2008). When hooked to the promoter fragments (9.1 kb), evolutionarily conserved sequences located in the upstream of the coding sequence, reporter EGFP expression copied the expression pattern of endogenous gene while a shorter promoter fragment (3.1 Kb) revealed unexpected expression in the medulla at the adult stage of transgenic mice (Chen et al., 2000; Lee et al., 2012). The Cre recombinase under the control of TSCOT promoters resulted in expression of EGFP and β-galactosidase in the bipotent pTEC by the deletion of loxP sequences harbored in the ROSA locus of the transgenic mouse lines (Park et al., 2013). Therefore, the unique restricted pattern of the TSCOT expression is of high value to study TEC differentiation and thymic organogenesis.

Expression of TSCOT has also been noticed in the male epididymal duct in conventional Northern blotting and immunohistochemistry (Obermann et al., 2003), and the TSCOT locus has been assigned in a susceptibility of cervical carcinoma by human genetic analyses (Engelmark et al., 2006; 2008). In the current era of bioinformatics, there has been many systemic data accumulating in the public database and available for analysis.

In this study, we took advantage of public database and bioinformatics tools and performed genetic profiling in addition to classical methodologies. We show TSCOT is expressed prior to bipotent pTEC, at the side population stage of thymic epithelial cells, and also even in differentiating ES cells. Its expression does not depend of Foxn1. TSCOT expression and its roles in other epithelial tissues like skin and lung are discussed.

MATERIALS AND METHODS

Expression profiling using public database

The data sets were obtained from Gene Expression Omnibus (http://www.ncbi.nlm.nih.gov/geo/), and the extension changed as txt files to analyze in the GENESIS program (version 1.7.6) released by Graz University of Technology Institute for Genomics and Bioinformatics. Genes and the probes used are shown in Table 1. Multiple sample data are averaged before the final analysis. The normalized data of the genes were sorted by similarity to TSCOT genes or calculated by using Hierarchical Clustering to generate heatmaps. Some of the GEO data sets are drawn as graphs and calculated P values with a two-tailed-T test in GraphPad Prism (version 6.0c).

Table 1.

List of Selected Gene Probe IDs used in the bioinformatics analyses

GPL* Gene symbol Probe ID GenBank access number
GPL570 AIRE 208090_s_at NM_000658
BMP4 211518_s_at D30751
CD248 219025_at NM_020404
CLDN18 214135_at BE551219
CLIC5 219866_at NM_016929
CRIP3 235720_at AI042209
CRTAC1 221204_s_at NM_018058
CYP4B1 1555497_a_at AY151049
EYA1 214608_s_at AJ000098
FGF7 205782_at NM_002009
FGF8 208449_s_at NM_006119
FOXG1 206018_at NM_005249
FOXN1 207683_at NM_003593
GKN2 238222_at AI821357
GRHL3 232116_at AL137763
HOXA3 208604_s_at NM_030661
HOXC13 219832_s_at NM_017410
HSD17B6 205700_at NM_003725
IL22 221165_s_at NM_020525
IL6 205207_at NM_000600
IL7 206693_at NM_000880
IRF6 1552478_a_at NM_006147
ISL1 206104_at NM_002202
LIF 205266_at NM_002309
LRRK2 229584_at AK026776
NOTCH3 203238_s_at NM_000435
OSM 230170_at AI079327
PAX1 1553492_a_at NM_006192
PAX9 207059_at NM_006194
PEBP4 227848_at AI218954
PLA2G1B 206311_s_at NM_000928
SFTPC 215454_x_at AI831055
SHH 207586_at NM_000193
SIX1 205817_at NM_005982
SLC46A2 223816_at AF242557
SOX2 228038_at AI669815
SUSD2 234310_s_at AK026431
TBX2 207662_at NM_005992
VEPH1 232122_s_at AK022666
WNT4 208606_s_at NM_030761
WNT5A 205990_s_at NM_003392
WNT5B 221029_s_at NM_030775
GPL1261 Aire 1419241_a_at NM_009646
Bcl2 1422938_at NM_009741
Bmp4 1422912_at NM_007554
CD248 1417439_at NM_054042
Crip3 1451410_a_at AF367970
Dab2 1420498_a_at NM_023118
Dkk3 1417312_at AK004853
Eya1 1421727_at NM_010164
Fgf7 1422243_at NM_008008
Fgf8 1451882_a_at U18673
FoxG1 1418357_at NM_008241
FoxN1 1450508_at NM_008238
Gas1 1416855_at BB550400
Hoxa3 1452421_at BB496114
HoxC13 1425874_at AF193796
IL6 1450297_at NM_031168
IL7 1422080_at NM_008371
Irf6 1418301_at NM_016851
Isl1 1422720_at BQ176915
Lif 1450160_at AF065917
Ly75 1449328_at NM_013825
Meis1 1443260_at BB055155
Notch3 1421964_at NM_008716
Osm 1438767_at BB237825
Pax1 1449359_at NM_008780
Pax9 1421246_at BC005794
Pbx1 1449542_at NM_008783
Psmb11 1453150_at BG069341
Shh 1436869_at AV304616
Six1 1427277_at BB137929
Six4 1456862_at AI893638
Slc46a2 1423476_at BB329435
Sox2 1416967_at U31967
Tbx1 1425779_a_at AF326960
Tert 1450254_at NM_009354
Wnt4 1450782_at NM_009523
Wnt5a 1436791_at BB067079
Wnt5b 1422602_a_at NM_009525
GPL2987 FOXN1 hCG31797.3 NM_003593.2
HOXA3 hCG1640627.4 NM_153632.1, NM_030661.3, NM_153631.1
PAX9 hCG20991.2 NM_006194.1
SLC46A2 hCG29190.4 NM_033051.2
GPL8217 FOXN1 HSG00201177 (ROSETTAGENE MODEL_ID) NM_006015
HOXA3 HSG00314123 (ROSETTAGENE MODEL_ID) NM_002309
PAX9 HSG00282340 (ROSETTAGENE MODEL_ID) NM_030775
SLC46A2 HSG00262163 (ROSETTAGENE MODEL_ID) NM_033051
*

GPL, GEO platform accession number

Mice

The mouse lines TDLacZ (Ahn et al., 2008), 3.1T-EGFP (Chen et al., 2000), and 9.1T-NE (Lee et al., 2012) were maintained in the Laboratory of Molecular and Cellular Immunology Animal Facility of Inha University, Korea. All animal studies are in compliance with the Use of Laboratory Animals under the proper protocols. The protocols were approved by the Committees on the Ethics of Animal Experiments of NIH (LCMI Protocol 8) and Inha University (Protocol LMCI-2). Fetal mice were obtained from timed mating. The presence of a vaginal plug was considered at E0.5.

For genotyping, tail samples were extracted and used for a polymerase chain reaction with primers for the TDLacZ locus: Neo primer (ACCGCTATCAGGACATAGCGTTGG), 1C12 F1 (TTACTCAAAGTGATGCTGGACTGG), 1C12 B2 (CCGAGGGTTCCTTGGTACATTC), and the EGFP locus: EGFP-F (GCCACAAGTTCAGCGTGTCC), EGFP-R (GCTTCTGTTGGGGTCTTTGC), using the red Extract-N-Amp Tissue PCR kit (Sigma).

Automatic cell counting

A fluorescence-based, automatic cell counter (Luna-FL, Logos Biosystems) was used to measure accurately the numbers of cells including thymic epithelial cells. The contamination from red blood cells could be automatically excluded because this system enumerates only nucleated cells.

Thymic stromal cell preparation

A single cell suspension was prepared as described (Lee et al., 2012). Briefly, thymic tissues or deoxyguanosine treated fetal thymic organ culture were treated with 0.25% trypsin (Invitrogen) for about 20 min, in the presence of DNase I (Sigma), and washed with phosphate buffered saline (PBS) containing 10% fetal bovine serum (FBS). For further purification of TEC, the single cell suspension was isolated using magnetic bead cell sorting after incubating with anti-Fc mAb 2.4G2 and anti-mouse CD45 microbeads (Milteny Biotec) for 20 min at 4°C.

Flow cytometry

Monoclonal antibodies used in the staining of cells include anti-MHCII (I-Ab), anti-CD45 (Ly-5), and anti-Sca-1. The antibodies were purchased from Caltag or from BD PharMingen. Anti-aminopeptidase A (CDR-1) and anti-EpCAM (G8.8) were prepared in the Custom Antibody Services Facility, NIAID, NIH. Biotinylated UEA-1 was purchased from Vector Laboratories.

Cells were washed in cold FACS buffer (PBS + 1% BSA), subsequently stained on ice with the primary and the secondary antibodies, then analyzed on FACSCalibur or FACSAriaII with two lasers in the presence of 1–2 μg/ml of propidium iodide (PI). Anti-Fc, 2.4G2 antibody was included in all flow cytometry staining to block Fc receptor. For side population analysis, a 1 × 106 dissociated single cell suspension of fetal thymic organ culture (FD14.5) were incubated for an hour at 4°C in the presence of 5 μg/ml Hoechst 33342 dissolved in Hanks balanced salt solution. For verification of the side population, verapamil 0.25 mM was included. After washing at 4°C, cells were resuspended and examined by a flow cytometer equipped with a UV laser (FACSAriaII). For multicolor staining with SP analysis, cells were prestained with selected antibodies including homemade mAb CLVE (Yang et al., 2005). Negative control of TSCOT staining was carried out with all the same combination of antibodies except mAb CLVE. Analyses were done using the FlowJo program (http://flowjo.com).

RT-PCR

Sorted 1000 cells were used for RNA preparation. cDNA was generated with Superscript III and RT-PCR was carried out with the primers for TSCOT: F84 (5-CAGTCTTCCAATAACCTGCTTTGGCCT-3) and B83 (5-CGATTCCATGTGCCCCATTG-3) to amplify a 310 bp fragment and for GAPDH (Ahn et al., 2008;Kim et al., 2000). The primers for TSCOT are located in the separate exons with one intron and RT− control sampled did not show any band in the gel.

Histostaining and microscopy

The immunofluorescence and X-gal staining the sections is described (Lee et al., 2012). An isolated thymus was washed in PBS and fixed in 1% para-formaldehyde, 0.2% glutaraldehyde, 0.02% NP-40, 1 mM MgCl2 in PBS for 1 or 2 h on ice and was embedded in Tissue Freezing Medium (Triangle Biomedical Sciences, USA). The 4 μm sections were fixed for 2 min in 1% formaldehyde, 0.2% glutaraldehyde, 0.02% NP-40 1 mM NaCl, then incubated with X-gal solution (1 part X-gal 40 μg/ml in dimethyl formamide, in 40 parts 2 mM MgCl2, 5 mM potassium ferricyanide, 5 mM potassium ferrocyanide in PBS) at 37°C for 48 h. For the detection of EGFP for fetal thymus sections, confocal microscopy was performed on the frozen sections in NIAID confocal facility (Leica SP2).

RESULTS

Gene profiling analysis verifies the tissue-specific TSCOT expression

In order to study the expression pattern of TSCOT at the genome level, we first used Google to identify any data and downloaded from the public database (http://www.ncbi.nlm.nih.gov/geo/) that shows the differential expression pattern (GSE7905). From the GEO database, the fetal tissue-specific expression was first examined (Fig. 1A). TSCOT expression was found only in the human fetal thymus, not in the fetal brain, fetal liver, nor fetal kidney. FOXN1 expression showed a similar but not an identical pattern. PAX9 and HOXA3 that are previously associated with the third pharyngeal pouch formation are even more different from the TSCOT pattern. In human adult tissues (GSE14938), TSCOT was found in the thymus and skin. In addition, it was present in lung and epididymis at lower levels (Fig. 1B). FOXN1 expression is also strongly expressed in the skin and thymus. However, it is not strongly expressed in any of the tissues that TSCOT is expressed at in the lower levels. Instead, FOXN1 is expressed in the liver, stomach and placenta. These suggest that TSCOT and FOXN1 may not be strongly associated in differentiated adult tissues.

Fig. 1.

Fig. 1.

Tissue and cell type specific TSCOT expression profiling. (A) Clustering of TSCOT with three other genes, FOXN1, PAX9, HOXA3, expression in human fetal tissues (GSE7905). (B) Expression in human adult tissues (GSE14938). (C) Gene expression during TEC development. cTEC and mTEC from adult mice are analyzed (GSE 56928). mTEC (lo): CD80lo and MHC-IIlo, mTEC (hi): CD80Hi and MHC-IIHi. Gene expression profiles are from GEO microarray data. The gene expression values are normalized as 2.0 to −2.0 in the Genesis program. High, Red; Middle, Black; Low, Green. (D) Flow cytometric analysis of 4 weeks old thymic stromal cells for the lineage TEC makers. CDR1 is for cTEC, UEA-1 is for mTEC. The left panel shows CD45− gate of whole stromal cells and the right panel shows the TSCOT+ gate.

Expression profiles of TSCOT and selected genes are investigated for the expression in the isolated mouse thymic epithelial cells (GSE56928). The genes for profiling (Table 2) are selected based on the literature which contains the information on the expression of the genes in the thymic epithelium or third pharyngeal pouch (references in Table 2). As shown in Fig. 1C, expression patterns are clustered as six different groups. A group contains TSCOT, Wnt4, Meis1, Gas1, Pax1, Isl1, Pax9, Six1, Pbx1, IL7, Bcl2, Bmp4, Dab2, FoxG1, Six4 and Hoxa3. These genes are expressed in both cTEC and mTEClo. Among them, TSCOT, Wnt4, Meis1, and Pax1 showed the strongest expression in the cTEC of the youngest mouse. Our earlier study on the expression kinetics (Kim et al., 2000) is consistent with these results. In this group, Pax1, Pax 9, Six1, Meis1 and Hoxa3 are the genes involved in the pouch stages (Manley et al., 2004). Wnt4 and Bmp4 were shown to be involved in the thymic organogenesis at the upstream of Foxn1 (Bleul and Boehm, 2005). It is interesting to note that Dab2 is a Wnt inhibitor. Gas1, Bcl2 and IL7 are the genes involved in the general cell cycle and survival. Group B contains Psmb11 (β5t) and Ly75 (NLDC202/DEC205) that are genuine cTEC-specific genes. Group C (Wint5a, Wnt5b, Eya1, Fgf8, Notch3 and Dkk3) includes genes that are expressed higher in the later stages of cTEC and mTEClo. Eya1 is known for roles in the third pharyngeal pouch (Gordon and Manley, 2011; Wei and Condie, 2011). However, its expression profile is somewhat different from the other genes involved in the same stage. Next, group D contains Foxn1 and Crip3 (TLP) that show the expression in cTEC and mTEChi. Here again, it clearly shows a deviation of expression pattern between TSCOT and Foxn1. Group E genes (Lif, Tert, and Fgf7) show the highest expression in the mTEClo or mTEChi. Given the known functions of Tert high expression in less divided cells, this result suggests that mTEClo may be found in more immature cells. The last group, group F contains HoxC13, Osm, IL6, CD248 (Endosialin), Tbx1, Aire, Shh, Sox2, and Grhl3. Those genes show the highest expression in the mTEChi population. HoxC13 regulates Foxn1 expression, and three genes, Osm, IL6, and CD248 are involved in thymic atrophy and involution. The roles of Tbx1 and Shh in mTEChi are not completely understood yet except that they are known for involvement in pouch formation.

Table 2.

List of genes used in expression profiling during organogenesis

Gene* name Full name Function Reference TSCOT expression from GEO data
AIRE Autoimmune regulator Regulate mTEC development and differentiation, Transcription factor Gordon and Manley, 2011; Sun et al., 2013
BCL2 Growth Arrest-Specific 1 Antiapoptotic gene Wong et al., 2014
BMP4 Bone morphogenic protein 4 Essential for thymus and parathyroid morphogenesis prior to Foxn1 Gordon et al., 2010; Gordon and Manley, 2011 Higher TSCOT level in BMP4 treated 10T1/2 stem cells (GDS3025/GSE5921) (P: 0.4685)
CD248 CD248 Molecule, Endosialin Required for postnatal thymic growth and regeneration following infection-dependent thymic atrophy Liu et al., 2014
CRIP3 (TLP) Cystein-Rich Protein 3 (Thymus Lim Protein) Appears to have a role in normal thymus development Kirchner et al., 2001
DAB2 Mitogen-Responsive Phosphoprotein, Homolog Wnt-inhibitors, Control proliferation and differentiation of stem cells into lineage-restricted cells Wong et al., 2014
DKK3 Dickkopf WNT Signaling Pathway Inhibitor 3 Wnt-inhibitors, Control proliferation and differentiation of stem cells into lineage-restricted cells Wong et al., 2014
EYA1 Eyes absent 1 homolog Necessary for 3rd pouch development Wei and Condie, 2011; Gordon and Manley, 2011
FGF7 (KGF) Keratinocyte growth factor Induces mature and immature TECs and promotes differentiation of immature TECs Rossi et al., 2006
FGF8 Fibroblast growth factor 8 Indirectly influence TECs by regulating neural crest cells survival and differentiation, relate to early pouch formation Gordon and Manley, 2011; Sun et al., 2013
FOXG1 Forkhead Box G1 May play a role in the regulation of TEC differentiation during fetal and postnatal stages, Transcription factor Wei and Condie, 2011
FOXN1 Forkhead Box N1 Necessary for the development of immature TEC progenitor cells into cTECs and mTECs, Transcription factor Blackburn et al., 1996; Bennett et al., 2002; Gordon and Manley, 2011; Bredenkamp et al., 2014
GAS1 Growth Arrest-Specific 1 Cell-cycle suppressor gene Wong et al., 2014
GRHL3 (Get-1) Grainyhead-Like 3 Ancient mediator of epithelial integrity, Transcription factor Yu et al., 2008; de la Garza et al., 2012 Reduced TSCOT level in Get-1 KO skin (GDS2629/GSE7381) (P: 0.0042**)
HOXA3 Homeobox A3 Early pouch patterning and initial organ formation, Transcription factor Manley and Capecchi, 1995; Su et al., 2001; Gordon and Manley, 2011
HOXC13 Homeobox C13 Mediates transcriptional regulation of Foxn1, Transcription factor Potter et al., 2010
IL22 Interleukin 22 Leads to regeneration of supporting epithelial microenvironment for enhanced thymopoiesis after thymic injury Dudakov et al., 2012 Reduced TSCOT level of IL22 treated epidermal keratinocytes (GDS2611/ GSE7216) (p < 0.0001****)
IL6 Interleukin 6 Associated with thymic involution Chinn et al., 2012
IL7 Interleukin 7 Cofactor for V(D)J rearrangement of the T cell receptor beta during early T cell development Huang and Muegge, 2001; Zamisch et al., 2005
IRF6 Interferon regulatory factor 6 Key determinant of keratinocyte proliferation-differentiation switch, Transcription factor Richardson et al., 2006 Reduced TSCOT level in IRF6 KO skin (GDS2359/GSE5800) (P< 0.0001****)
ISL1 ISL LIM Homeobox 1 May play a role in the regulation of TEC differentiation during fetal and postnatal stages, Transcription factor Wei and Condie, 2011
LIF Leukemia inhibitory factor Maintenance mouse ES cell pluripotency, Associated with thymic involution Shen and Leder, 1992; Graf et al., 2011; Chinn et al., 2012 Increased TSCOT level in murine CGR8 ES cells treated LIF (GDS3729/ GSE6689) (P: 0.1181)
LY75 (NLDC205, DEC205) Lymphocyte antigen 75 Contribute to antigen presentation, Marker of cTEC in adult thymus Jiang et al., 1995; Shakib et al., 2009
MEIS1 Myeloid ecotropic viral integration site 1 Functional and physical partners of Pbx1 and Hoxa3, Required for maintenance of the postnatal thymic microenvironment, Transcription factor Hirayama et al., 2014
NOTCH3 Notch homolog protein 3 Regulate murine T cell differentiation and leukemogenesis Bellavia et al., 2008
OSM Oncostatin M Plays an inhibitory role in normal and malignant mammary epithelial cell growth in vitro, Associated with thymic involution Liu et al., 1998; Chinn et al., 2012
PAX1 Paired Box 1 Early pouch formation and parathyroid development, minor role in thymus size, Transcription factor Wallin et al., 1996; Gordon and Manley, 2011
PAX9 Paired Box 9 Pouch and initial organ formation, TEC differentiation, Transcription factor Hetzer-Egger et al., 2002; Gordon and Manley, 2011
PBX1 Pre-B-cell leukemia homeobox Required for embryonic thymic organogenesis, Transcription factor Hirayama et al., 2014
PSMB11 (β5t) Proteasome (prosome, macropain) subunit, beta type, 11 Positive selection of CD8+ T cells, cTEC specific proteosome subunit Murata et al., 2007; Shakib et al., 2009
SHH Sonic hedgehog Regulate pharyngeal region development Moore-Scott and Manley, 2005; Gordon and Manley, 2011 Increased TSCOT level in SHH treated human fibroblasts (GDS4512/ GSE29316) (P: 0.1122)
SIX1/4 Sine oculis-related homeobox 1/4 Necessary for 3rd pouch development, Transcription factor Wei and Condie, 2011; Gordon and Manley, 2011
SOX2 SRY (sex determining region Y)-box 2 Regulate self-renewal of the mouse and human ESCs, important for the maintenance of stem cells in multiple adult tissue, establish induced pluripotent stem cells, Transcription factor Cimpean et al., 2011; Liu et al., 2013 Higher TSCOT level in SOX2+ follicle dermal cells (GDS3753/ GSE18690) (P: 0.0015**)
TBX1 T-box transcription factor Pouch formation and patterning, might establish parathyroid fate, Transcription factor Jerome and Papaioannou, 2001; Hollander et al., 2006; Gordon and Manley, 2011
TERT Telomerase Reverse Transcriptase Telomerase reverse transcriptase Wong et al., 2014
WNT4 Wingless-type MMTV integration site family, member 4 Controls thymopoiesis and thymus size by regulating TEC, thymocyte and their progenitor proliferation, regulate Foxn1 expression in TECs Sun et al., 2013
WNT5A Wingless-type MMTV integration site family, 5A Regulate the survival of αβ lineage thymocytes, regulator of cell growth in hematopoietic tissue Liang et al., 2007
WNT5B Wingless-type MMTV integration site family, 5B Produced by TECs and thymocytes, regulate Foxn1 expression in TECs Gordon and Manley, 2011; Sun et al., 2013
*

Gene names are listed in alphabetical order.

The expression of TSCOT in mTEClo is not so surprising since it was found in the corticomedullary junction of young adult thymus where precursor or stem cells for thymic epithelium resides. When 4 week old thymic stromal cells were investigated by flow cytometry, the CD45− population contains transitional cells with both cortical and medullary markers (CDR1+UEA-1+). Those cells are included in the TSCOT+ gated cells beside CDR1+UEA-1− cTECs (Fig. 1D).

From these analyses, it was concluded that TSCOT is expressed in cTEC and undifferentiated and/or precursor mTEC. These expression profiles are common among the genes involved in early thymic organogenesis.

TSCOT is expressed in all TEC-committed stromal cells in fetal thymus

Next, we investigated the expression of TSCOT and reporters at the fetal stages in the different mouse models that we have previously characterized for the postnatal stages. The β-galactosidase reporter expression in TDLacZ thymus is restricted in the thymus as two dots at FD11 (Ahn et al., 2008). Figure 2A shows the β-galactosidase expression in the thymic sections at FD14.5. Expression of β-galactosidase is evenly distributed in the whole thymus, indicating most, if not all, the thymic epithelial cells at this stage express β-galactosidase. Another reporter mouse line, 3.1T-EGFP, which expresses EGFP in all TECs at the newborn stage (Park et al., 2013), showed EGFP expression earlier during fetal stages (Fig. 2B). At FD14 and 17, EGFP expression is also evenly distributed in the whole thymus. These results are consistent with the conclusion we previously described in which TSCOT is expressed in the pTEC stage (Park et al., 2013).

Fig. 2.

Fig. 2.

TSCOT is expressed in fetal TEC committed cells. (A) LacZ expression in the FD14 thymus of TDLacZ mouse. (B) EGFP expression in the fetal 3.1T-EGFP transgenic thymus. (C) Flow cytometric analysis of fetal TEC preparation for TEC and endothelial lineages. CD31 is for endothelial cells, MHCII is for TEC cells. The histogram of negative population (gray area) is from the analysis of the same cell stained with the same sets of antibodies except mAb CLVE.

Fetal thymic stromal cells from normal C57BL/6 mouse (FD14) were analyzed for TSCOT expression with specific mAb CLVE (Yang et al., 2005). At this stage, EpCAM+ cells were all TSCOT+ (data not shown). When CD45− stromal cells were displayed for CD31 as an endothelial lineage marker along with MHCII, it became clear that TSCOT expression is present in all MHCII+ cells and CD31− MHCII− cells (Fig. 2C). Only CD31+MHCII− cells of endothelial lineage were TSCOT−. From these results, it is concluded that endothelial cells either lost TSCOT expression due to lineage commitment from the common stem cell or originated from other type of precursor cells that do not express TSCOT.

TSCOT is expressed in the side population of TEC preparation

By using the TEC preparation from the deoxyguanosine treated FTOC of FD14.5, the presence of SP was tested with Hoechst 33342. In Fig. 3A, SP, which is ABC transporter sensitive, is clearly visible. When the inhibitor Verapamil was included, SP had decreased to 0.21% from 1.45%. Side population analyses were also applied with the TEC preparation using the same type culture of fetal thymus from 9.1T-NE mouse that shows EGFP expression patterns in the same way as endogenous TSCOT (Lee et al., 2012). As shown in Fig. 3B, a portion of the SP of 9.1T-NE TECs expresses EGFP when compared with that of normal C57BL/6 TEC preparation. In contrast, the side population of 3.1T-EGFP TEC population did not show any EGFP expression (data not shown).

Fig. 3.

Fig. 3.

SP analysis of TEC preparation. (A) SP analysis of fetal TEC preparation. Verapamil was included for blocking ABC transporter function during staining with Hoechst 33342. (B) EGFP expression of SP in the fetal TEC preparation from 9.1T-NE. EGFP levels are compared with the SP from C57BL/6. (C) A multicolor analysis of SP with prestained markers. SP and MP are shown. Top panels are stained samples without mAb CLVE. Bottom panels are with mAb CLVE. (D) RT-PCR analysis of sorted SP and MP from normal fetal TEC preparation. (E) Sca-1 population expresses TSCOT. Fetal TEC preparation gated for the CD45− population and separated with EpCAM and MHCII (left). Each gate was analyzed for Sca-1 expression (middle) and for TSCOT (right). Grey histograms were obtained from the negative control sample stained without mAb CLVE.

When SP analysis was carried out along with antibody staining, TSCOT expression in SP and the major population (MP) were also clear. SP, either MHCII negative or positive, showed specific TSCOT expression with mAb CLVE. In addition, 84% of the SP cells and 95% of the MP cells were TSCOT+ (Fig. 3C). The next experiment was to verify TSCOT expression at the RNA level using a sorted side population of TECs prepared from normal C57BL/6. RT-PCR using the RNA prepared from the sorted cells clearly showed TSCOT expression in SP and in MP (Fig. 3D).

Many different types of stem cells express Sca-1 marker and a recent report mentioned that a TEC progenitor population is Sca-1+ (Golebiewska et al., 2011). We also tested expression of Sca-1 in fetal TEC preparation (Fig. 3E). Sca-1+ populations are present in both EpCAM+MHCII+ and EpCAM−MHCII− populations and most of them are TSCOT+. From these results, fetal TEC contains significant portion of sTECs that are TSCOT+.

TSCOT is expressed in differentiating embryonic stem cells

We searched the available data on TSCOT expression in the embryonic stem cell (ES) population. Two GEO sets of data (GSE14503 and GSE9440) contain an expression profile of T3 ES cell culture, embryonic body formation, and differentiating T3 ES cell into pancreatic islet-like cell clusters or fibroblasts (Fig. 4A). Expression of TSCOT is found in embryonic bodies but not in the undifferentiated ES nor in differentiated pancreatic islets and fibroblasts. TSCOT expression is clustered with FGF8, FOXN1, IL22 and FGF7. In addition, WNT5A, SHH, ISL1 and GRHL3 (Get1) are also in the neighboring group with the expression pattern that is only transiently expressed. Grhl3 is particularly interesting since knock out (KO) mouse skin show reduced TSCOT expression (see later).

Fig. 4.

Fig. 4.

Gene clustering analysis of ES and differentiating ES cells. (A) Gene expression level of pancreatic islet-like cell clusters and fibroblast-like cells derived from human T3 embryonic stem cells (GSE14503 and GSE9440). T3ES: human T3 embryonic stem cell, T3EB7d: day 7 embryonic body derived from T3ES, T3DP: Pancreatic islet-like cell clusters derived from T3ES, T3DF: fibroblast-like cells differentiated from T3ES. The replicated data are calculated to the average value. High, Red; Middle, Black; Low, Green. (B) TSCOT gene expression during J1 mouse ES cell differentiation in vitro (GSE3749). Undifferentiated J1 ES cells (J1 ES 0 h) are maintained by LIF treatment. (C) TSCOT expression of non-SP and SP in mouse mammary gland (GSE5309). Ref: universal mouse reference (Stratagene).

The expression profile of TSCOT in the data from GSE3749 shows that the J1 ES cell line transiently expresses TSCOT when it is differentiated by removing leukemia inhibitory factor (LIF) (Fig. 4B).

When the data from various side populations were specifically searched for, SP of mouse mammary gland cells showed an increased TSCOT expression in the SP at a lower significance (P = 0.0732) (Fig. 4C). In some other SPs of mammary epithelium, studies did not reveal any significant difference between SP and non SP (data not shown).

From the results above, we concluded that TSCOT expression is initiated in differentiating ES cells and remained in some tissue committed SP stem cells.

TSCOT expression is independent of FOXN1 but depend on IRF6 and GRHL3

Because FOXN1 was considered as a putative TEC key transcription factor, we searched for TSCOT expression in the remaining thymic rudiment of nude mouse. In RNA prepared from several tissues, TSCOT expression was found in the thymic rudiment of nude mice (Fig. 5A). RNA samples that were not treated with reverse transcriptase did not generate any bands (data not shown). This result is consistent with the conclusion derived from the gene profiling analyses.

Fig. 5.

Fig. 5.

Tissue specific expression of TSCOT reveals Foxn1 independency. (A) RT-PCR analysis of adult nude tissue. (B) Gene expression profiles from embryonic day 17.5 IRF6 KO and wild type mouse skin (GSE5800). Right panel: Comparison of TSCOT expression from skin between IRF6 KO mice and wild-type (P value < 0.0001****). (C) Gene expression profiles from embryonic day 18 GRHL3 KO and wild type mouse skin (GSE7381). Right panel: Comparison of TSCOT expression from skin between GRHL3 KO mice and wild-type (P value: 0.0042**). High, Red; Middle, Black; Low, Green. (D) TSCOT expression changes in human epidermal keratinocytes after treatment of KGF and various cytokines (GSE7216). Significant changes are compared to untreated cells (P < 0.0001****, P: 0.0025**, P: 0.0217*). Y axis are arbiturary units of process data.

In order to find the putative regulatory factors, differential TSCOT expressions were also examined in the skins of mouse lines with various mutations (Figs. 5B and 5C). In IRF6 KO mouse (GSE5800), TSCOT expression had reduced along with, HoxC13, Fgf7, Tbx1, and Hoxa3 while Notch3, Foxn1, Grhl3, and Wnt4 had increased. The opposite expression profiles of TSCOT and Foxn1 in IRF6 KO skin suggest that these genes are independently regulated (Fig. 5B). It is interesting to note that the binding sites of IRF6 are located in the regulatory regions of Grhl3 (Botti et al., 2011; de la Garza et al., 2012). More interestingly, TSCOT expression is also reduced in the skin of GRHL3 KO mice (GSE7381) (Fig. 5C). To investigate the actual involvement of those transcription factors will require more investigation. The effects of various cytokines for the TSCOT expression in the human epidermal keratinocytes (GSE7216) can also be visualized in Figure 5D. TSCOT expression is down regulated by IL1b, IL22 and IL24, but not by KGF, IFNγ, IL19, IL20 and IL26d (Fig. 5D) in the keratinocytes.

These results suggest a regulatory mechanism for TSCOT expression by the transcription factors, such as IRF6 and GRHL3, and by cytokines, but not by FOXN1.

Is TSCOT a tumor suppressor?

We also researched TSCOT expression in the lung development. Human fetal lungs at various stages between 54–154 days (GSE14334) are clustered in Fig. 6A. The genes that are expressed in a similar way to those of TSCOT are GRHL3, FOXN1, PAX9, and CRIP3. Those genes are known to be upregulated during the fetal lung developmental process (Kho et al., 2010). Therefore, it is likely that those transcription factors are involved in the positive regulator of TSCOT in the lung. The general patterns of IRF6, SHH, ISL1, and SOX2 are downregulated during lung development, the opposite pattern to that of TSCOT. This suggests that those genes are potentially involved in the negative regulation of TSCOT in lung development.

Fig. 6.

Fig. 6.

Coexpression patterns in human lung development and lung cancer. (A) Gene expression change during lung development of human fetus (GSE14334). The numbers on the top indicate the number of days post conception. Replicated data are calculated to the average value. (B) A gene expression comparison between normal lung tissue and various lung tumor tissues from adult human (GSE19188). The gene expression values are normalized as 3.0 to −3.0 in the GENESIS program. High, Red; Middle, Black; Low, Green.

In Fig. 6B, the cluster analysis of 20 genes coexpressed in the same fashion as TSCOT is shown in Table 3. To our surprise, TSCOT expression is clearly missing in three types of lung cancers, suggesting TSCOT may function as a tumor suppressor for lung cancer. The top genes clustered for the similar expression profiles are listed in Table III. As shown, many of the genes show possible tumor suppressor phenotypes (references in Table 3).

Table 3.

List of genes down-regulated along with TSCOT during lung cancer development

Gene name* Full name Relation with cancer Reference
CLDN18 Claudin-18 CLDN18 splice variant 2 is frequent Ectopic activation in pancreatic, Esophageal, ovarian, and lung tumors Sahin et al., 2008
CRTAC1 Cartilage acidic protein 1 Copy number alteration in CRTAC1 gene have been observed in neurofibromatosis Type 1-associated glomus tumors Brems et al., 2009
CYP4B1 Cytochrome P450, Family 4, Subfamily B, Polypeptide 1 High expression of CYP4B1 increases the risk of bladder tumor by activation of carcinogenic aromatic amines Imaoka et al., 2000
GKN2 Gastrokine-2 Gastrointestinal tract specific gene GKN2 might inhibit gastric cancer growth in a TFF1 dependent manner Chu et al., 2012
LRRK2 Leucine-rich repeat serine LRRK2 G2019S mutations are associated with an increased cancer risk in Pakinson’s disease Saunders-Pullman et al., 2010
SUSD2 Sushi domain-containing protein 2 SUSD2 increases the invasion of breast cancer cells and contributes to a potential immune evasion Watson et al., 2013
*

Gene names are listed in alphabetical order

DISCUSSION

Using bioinformatics approaches and conventional molecular and cellular methods, we showed that TSCOT expression is turned on in TEC at the stem cell stage, and even prior to commitment of TEC lineages. In addition, we identified putative regulatory transcription factors and cytokines during thymus, skin and lung development.

TSCOT expression is turned on early thymic organogenesis and some other epithelial tissues

During last several years, gene expression profiling at the genome scale are accumulated in the databases and accessible to the public. We took advantage of this advancement for the study of thymic organogenesis and TEC lineage differentiation using TSCOT as a lineage cell type specific marker and other known genes. From this approach, we learned that our previous studies are verified and we can get a lot more information than conventional experiments that are difficult to perform due to the limitation of small numbers of cells present in the actual organ.

In our previous studies, we asserted that TSCOT is TEC lineage specific and expressed in the cTEC and bipotent pTEC (Ahn et al., 2008; Kim et al., 2000; Park et al., 2013). Tissue specificity in thymus and expression in the limited TEC lineages are verified by the genome scale data analysis of expression profiling (Figs. 1, 4, and 5). Furthermore, we learned that more tissues such as skin and lung also express TSCOT. The transcription factors involved in the thymic organogenesis may be also involved in skin and lung development (Figs. 1A–1C, 5B, 5C, and 6A). In addition, kinetic profiling of expression of TSCOT during cTEC lineage development has also been verified (Fig. 1C). TSCOT expression is highest in the youngest cTEC as we described earlier (Kim et al., 2000). TSCOT expression in mTEClo provides an interpretation that transitional cells found in the postnatal TEC preparation with UEA-1+CDR1lo cells (Fig. 1D) are most likely the same kind. Earlier findings of sTECs in the medullary islet (Rodewald et al., 2001) and in the cortical medullary junction (Ahn et al., 2008) are consistent with the idea that TEC stem cells may overlap or share early mTEC features.

To further investigate cells at earlier stages than pTEC expression, we first utilized a functional SP analysis and showed that SP of fetal TEC preparation expresses TSCOT (Fig. 3). We like to call those cells sTEC for SP and stem TECs. In the SP of other type of tissues, such as mouse mammary glands, SP showed a slightly higher TSCOT expression than non SP (Fig. 4C). Our search for TSCOT expression in ES cells produced interesting results that TSCOT is induced in the differentiating embryonic bodies or ES cell cultures without LIF. TSCOT expression is off when the cells are differentiated into pancreatic epithelium or fibroblasts (Fig. 4A), and in the endothelial lineage (Fig. 2C). These results support the idea that TSCOT is expressed at the stem cell stage during certain organogenesis.

Given the concept that TSCOT is expressed in sTEC, its expressions in the skin and lung are not very surprising. They all express epithelial markers such as EpCAM and Keratins. There are cases that these cell lineages are actually interconvertible under certain circumstances. The stem cell preparation from TEC can be differentiated into skin type keratinocyte (Bonfanti et al., 2010) and thymic epithelium of nude mouse has shown to have lung epithelial morphologies (Dooley et al., 2005). This phenomenon can be interpreted as that of a reprograming of gene expression, transforming stem cells which are committed to one organ type, into another at the level of master gene expression.

A schematic model in Figure 7 summarizes the findings of the expression profile during organogenesis. TSCOT expression turned on in early uncommitted ES cells may be maintained in thymus, skin, and lung. In other organs, TSCOT expression is now turned off. The stem cell for the thymic organogenesis and the precursor TEC (pTEC) maintains TSCOT expression. The cTEC and mTEClo cells are cells that express TSCOT, and mature mTEChi cells lose TSCOT expression. In lung, TSCOT expression is turned on but tumorigenesis will turn off TSCOT expression.

Fig. 7.

Fig. 7.

Summary model of TSCOT expression profile during organogenesis. TSCOT expressions are indicated at the bottom of each text box. ES, embryonic stem cells; ESDiff, differentiating ES cells.

Modulation of TSCOT gene expression was revealed by gene expression profiling

By cluster analyses with selected transcription and soluble factors that are shown to be involved during the thymic organogenesis, we were able to identify multiple putative positive or negative regulators. IRF6 and GRHL3 are putative positive regulators for TSCOT expression in the skin (Figs. 5B and 5C). It has been reported that GRHL3 is located downstream of IRF6 in human keratinocytes (Botti et al., 2011; de la Garza et al., 2012; Malik et al., 2010). TSCOT expression potentially is regulated by IL1b, IL22, and IL24 in negative fashion (Fig. 5D). These results suggest that TSCOT is controlled by IRF6 and GRHL3, and IL1b, IL22, and IL24 in human keratinocyte. In contrast, in human fetal lung development, both TSCOT and GRHL3 expressions are upregulated together while IRF6 expression is downregulated (Fig. 6A). These phenomena suggest the complex network of expression regulation and/or cross checking regulation of genes during different epithelial tissue development.

TSCOT may be a new member of the tumor suppressors

Besides the structural features of a transporter that appeared containing primary amino acid sequences (Kim et al., 2000), it is still unclear what biological and biochemical functions that TSCOT plays. TSCOT is a member of Slc46A, and another member, Slc46A1, has been characterized as a proton coupled folate transporter (Diop-Bove et al., 2013). The heavily hydrophobic nature of the TSCOT amino acid composition and a simple twelve membrane spanning feature, with the presence of a central inner loop in the absence of ATP binding domain, suggests that TSCOT may transport small hydrophobic molecules. We proposed earlier that it may function in the survival of TECs based on the expression (Kim et al., 2000).

It is exciting to find that TSCOT expression in the lung disappear in three types of lung cancers, large lung cell carcinoma, lung adenocarcinoma, and squamous lung carcinoma (Fig. 6B). This expression strongly implies TSCOT may function as a type of tumor suppressor. This supports the fact that TSCOT also function in the same way for the genetic type of cervical cancer susceptibility proposed (Engelmark et al., 2006; 2008). In fact, the Human TSCOT locus (9q32) was mapped to the susceptibility of cervical cancer through a SNP polymorphism study (Engel mark et al., 2006; 2008). It may function as a necessary component to maintain normal epithelium. When it is missing in lung epithelium, carcinogenesis progresses without hindrance. Other genes expressed in a similar fashion (Fig. 6) also show the functionality in tumor suppressors as described in Table III.

Acknowledgments

We would like to thank Dr. Polly Matzinger for the help on finding nude thymic rudiments and also to Minchull Kim and Soo Jung Yang for technical help. This work was supported by the National Research Foundation of Korea (NRF), a grant funded by the Korean government (MSIP) (NRF-2013R1A2A2A01069080), and Inha University Research Grant.

REFERENCES

  1. Ahn S, Lee G, Yang SJ, Lee D, Lee S, Shin HS, Kim MC, Lee KN, Palmer DC, Theoret MR, et al. TSCOT+ thymic epithelial cell-mediated sensitive CD4 tolerance by direct presentation. PLos Biol. 2008;6:e191. doi: 10.1371/journal.pbio.0060191. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Alves NL, Takahama Y, Ohigashi I, Ribeiro AR, Baik S, Anderson G, Jenkinson WE. Serial progression of cortical and medullary thymic epithelial microenvironments. Eur. J. Immunol. 2014;44:16–22. doi: 10.1002/eji.201344110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Balciunaite G, Keller MP, Balciunaite E, Piali L, Zuklys S, Mathieu YD, Gill J, Boyd R, Sussman DJ, Hollander GA. Wnt glycoproteins regulate the expression of FoxN1, the gene defective in nude mice. Nat. Immunol. 2002;3:1102–1108. doi: 10.1038/ni850. [DOI] [PubMed] [Google Scholar]
  4. Bellavia D, Checquolo S, Campese AF, Felli MP, Gulino A, Screpanti I. Notch3: from subtle structural differences to functional diversity. Oncogene. 2008;27:5092–5098. doi: 10.1038/onc.2008.230. [DOI] [PubMed] [Google Scholar]
  5. Bennett AR, Farley A, Blair NF, Gordon J, Sharp L, Blackburn CC. Identification and characterization of thymic epithelial progenitor cells. Immunity. 2002;16:803–814. doi: 10.1016/s1074-7613(02)00321-7. [DOI] [PubMed] [Google Scholar]
  6. Berzins SP, Uldrich AP, Sutherland JS, Gill J. Thymic regeneration: teaching an old immune system new tricks. Trends Mol. Med. 2002;8:469–476. doi: 10.1016/s1471-4914(02)02415-2. [DOI] [PubMed] [Google Scholar]
  7. Blackburn CC, Manley NR. Developing a new paradigm for thymus organogenesis. Nat. Rev. Immunol. 2004;4:278–289. doi: 10.1038/nri1331. [DOI] [PubMed] [Google Scholar]
  8. Blackburn CC, Augustine CL, Li R, Harvey RP, Malin MA, Boyd RL, Miller JF, Morahan G. The nu gene acts cell-autonomously and is required for differentiation of thymic epithelial progenitors. Proc. Natl. Acad. Sci. 1996;93:5742–5746. doi: 10.1073/pnas.93.12.5742. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Blackburn CC, Manley NR, Palmer DB, Boyd RL, Anderson G, Ritter MA. One for all and all for one: thymic epithelial stem cells and regeneration. Trends Immunol. 2002;23:391–395. doi: 10.1016/s1471-4906(02)02265-2. [DOI] [PubMed] [Google Scholar]
  10. Bleul CC, Boehm T. BMP signaling is required for normal thymus development. J. Immunol. 2005;175:5213–5221. doi: 10.4049/jimmunol.175.8.5213. [DOI] [PubMed] [Google Scholar]
  11. Bleul CC, Corbeaux T, Reuter A, Fisch P, Monting JS, Boehm T. Formation of a functional thymus initiated by a postnatal epithelial progenitor cell. Nature. 2006;441:992–996. doi: 10.1038/nature04850. [DOI] [PubMed] [Google Scholar]
  12. Boehm T. Thymus development and function. Curr. Opin. Immunol. 2008;20:178–184. doi: 10.1016/j.coi.2008.03.001. [DOI] [PubMed] [Google Scholar]
  13. Bonfanti P, Claudinot S, Amici AW, Farley A, Blackburn CC, Barrandon Y. Microenvironmental reprogramming of thymic epithelial cells to skin multipotent stem cells. Nature. 2010;466:978–982. doi: 10.1038/nature09269. [DOI] [PubMed] [Google Scholar]
  14. Botti E, Spallone G, Moretti F, Marinari B, Pinetti V, Galanti S, De Meo PD, De Nicola F, Ganci F, Castrignanò T, et al. Developmental factor IRF6 exhibits tumor suppressor activity in squamous cell carcinomas. Proc. Natl. Acad. Sci. 2011;108:13710–13715. doi: 10.1073/pnas.1110931108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Bredenkamp N, Nowell CS, Blackburn CC. Regeneration of the aged thymus by a single transcription factor. Development. 2014;141:1627–1637. doi: 10.1242/dev.103614. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Brems H, Park C, Maertens O, Pemov A, Messiaen L, Upadhyaya M, Claes K, Beert E, Peeters K, Mautner V. Glomus tumors in neurofibromatosis type 1: genetic, functional, and clinical evidence of a novel association. Cancer Res. 2009;69:7393–7401. doi: 10.1158/0008-5472.CAN-09-1752. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Chen C, Kim MG, Soo Lyu M, Kozak CA, Schwartz RH, Flomerfelt FA. Characterization of the mouse gene, human promoter and human cDNA of TSCOT reveals strong interspecies homology. Biochim. Biophys. Acta. 2000;1493:159–169. doi: 10.1016/s0167-4781(00)00177-9. [DOI] [PubMed] [Google Scholar]
  18. Chen L, Xiao S, Manley NR. Foxn1 is required to maintain the postnatal thymic microenvironment in a dosage-sensitive manner. Blood. 2009;113:567–574. doi: 10.1182/blood-2008-05-156265. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Cheng L, Guo J, Sun L, Fu J, Barnes PF, Metzger D, Chambon P, Oshima RG, Amagai T, Su DM. Postnatal tissue-specific disruption of transcription factor FoxN1 triggers acute thymic atrophy. J. Biol. Chem. 2010;285:5836–5847. doi: 10.1074/jbc.M109.072124. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Chinn IK, Blackburn CC, Manley NR, Sempowski GD. Changes in primary lymphoid organs with aging. Semin. Immunol. 2012;24:309–320. doi: 10.1016/j.smim.2012.04.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Chu G, Qi S, Yang G, Dou K, Du J, Lu Z. Gastrointestinal tract specific gene GDDR inhibits the progression of gastric cancer in a TFF1 dependent manner. Mol. Cell. Biochem. 2012;359:369–374. doi: 10.1007/s11010-011-1030-z. [DOI] [PubMed] [Google Scholar]
  22. Cimpean AM, Encica S, Raica M, Ribatti D. SOX2 gene expression in normal human thymus and thymoma. Clin. Exp. Med. 2011;11:251–254. doi: 10.1007/s10238-010-0127-0. [DOI] [PubMed] [Google Scholar]
  23. Corbeaux T, Hess I, Swann JB, Kanzler B, Haas-Assenbaum A, Boehm T. Thymopoiesis in mice depends on a Foxn1-positive thymic epithelial cell lineage. Proc. Natl. Acad. Sci. 2010;107:16613–16618. doi: 10.1073/pnas.1004623107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. de la Garza G, Schleiffarth JR, Dunnwald M, Mankad A, Weirather JL, Bonde G, Butcher S, Mansour TA, Kousa YA, Fukazawa CF, et al. Interferon regulatory factor 6 promotes differentiation of the periderm by activating expression of grainyhead-Like 3. J. Invest. Dermatol. 2012;133:68–77. doi: 10.1038/jid.2012.269. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Diop-Bove N, Jain M, Scaglia F, Goldman ID. A novel deletion mutation in the proton-coupled folate transporter (PCFT, SLC46A1) in a Nicaraguan child with hereditary folate malabsorption. Gene. 2013;527:673–74. doi: 10.1016/j.gene.2013.06.039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Dooley J, Erickson M, Roelink H, Farr AG. Nude thymic rudiment lacking functional foxn1 resembles respiratory epithelium. Dev. Dyn. 2005;233:1605–1612. doi: 10.1002/dvdy.20495. [DOI] [PubMed] [Google Scholar]
  27. Dudakov JA, Hanash AM, Jenq RR, Young LF, Ghosh A, Singer NV, West ML, Smith OM, Holland AM, Tsai JJ, et al. Interleukin-22 drives endogenous thymic regeneration in mice. Science. 2012;336:91–95. doi: 10.1126/science.1218004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Engelmark MT, Ivansson EL, Magnusson JJ, Gustavsson IM, Beskow AH, Magnusson PKE, Gyllensten UB. Identification of susceptibility loci for cervical carcinoma by genome scan of affected sib-pairs. Hum. Mol. Genet. 2006;15:3351–3360. doi: 10.1093/hmg/ddl411. [DOI] [PubMed] [Google Scholar]
  29. Engelmark MT, Ivansson EL, Magnusson JJ, Gustavsson IM, Wyöni PI, Ingman M, Magnusson PK, Gyllensten UB. Polymorphisms in 9q32 and TSCOT are linked to cervical cancer in affected sib-pairs with high mean age at diagnosis. Hum. Genet. 2008;123:437–443. doi: 10.1007/s00439-008-0494-8. [DOI] [PubMed] [Google Scholar]
  30. Gill J, Malin M, Holländer GA, Boyd R. Generation of a complete thymic microenvironment by MTS24+ thymic epithelial cells. Nat. Immunol. 2002;3:635–642. doi: 10.1038/ni812. [DOI] [PubMed] [Google Scholar]
  31. Gill J, Malin M, Sutherland J, Gray D, Hollander G, Boyd R. Thymic generation and regeneration. Immunol. Rev. 2003;195:28–50. doi: 10.1034/j.1600-065x.2003.00077.x. [DOI] [PubMed] [Google Scholar]
  32. Golebiewska A, Brons NH, Bjerkvig R, Niclou SP. Critical appraisal of the side population assay in stem cell and cancer stem cell research. Cell Stem Cell. 2011;8:136–147. doi: 10.1016/j.stem.2011.01.007. [DOI] [PubMed] [Google Scholar]
  33. Gordon J, Manley NR. Mechanisms of thymus organogenesis and morphogenesis. Development. 2011;138:3865–3878. doi: 10.1242/dev.059998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Gordon J, Patel SR, Mishina Y, Manley NR. Evidence for an early role for BMP4 signaling in thymus and parathyroid morphogenesis. Dev. Biol. 2010;339:141–154. doi: 10.1016/j.ydbio.2009.12.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Graf U, Casanova EA, Cinelli P. The role of the leukemia inhibitory factor (LIF) — pathway in derivation and maintenance of murine pluripotent stem cells. Genes. 2011;2:280–297. doi: 10.3390/genes2010280. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Hetzer-Egger C, Schorpp M, Haas-Assenbaum A, Balling R, Peters H, Boehm T. Thymopoiesis requires Pax9 function in thymic epithelial cells. Eur. J. Immunol. 2002;32:1175–1181. doi: 10.1002/1521-4141(200204)32:4<1175::AID-IMMU1175>3.0.CO;2-U. [DOI] [PubMed] [Google Scholar]
  37. Hirayama T, Asano Y, Iida H, Watanabe T, Nakamura T, Goitsuka R. Meis1 is required for the maintenance of postnatal thymic epithelial cells. PLoS One. 2014;9:e89885. doi: 10.1371/journal.pone.0089885. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Hollander G, Gill J, Zuklys S, Iwanami N, Liu C, Takahama Y. Cellular and molecular events during early thymus development. Immunol. Rev. 2006;209:28–46. doi: 10.1111/j.0105-2896.2006.00357.x. [DOI] [PubMed] [Google Scholar]
  39. Huang J, Muegge K. Control of chromatin accessibility for V(D)J recombination by interleukin-7. J. Leukoc. Biol. 2001;69:907–911. [PubMed] [Google Scholar]
  40. Imaoka S, Yoneda Y, Sugimoto T, Hiroi T, Yamamoto K, Nakatani T, Funae Y. CYP4B1 is a possible risk factor for bladder cancer in humans. Biochem. Biophys. Res. Commun. 2000;277:776–780. doi: 10.1006/bbrc.2000.3740. [DOI] [PubMed] [Google Scholar]
  41. Jerome LA, Papaioannou VE. DiGeorge syndrome phenotype in mice mutant for the T-box gene, Tbx1. Nat. Genet. 2001;27:286–291. doi: 10.1038/85845. [DOI] [PubMed] [Google Scholar]
  42. Jiang W, Swiggard WJ, Heufler C, Peng M, Mirza A, Steinman RM, Nussenzweig MC. The receptor DEC-205 expressed by dendritic cells and thymic epithelial cells is involved in antigen processing. Nature. 1995;375:151–155. doi: 10.1038/375151a0. [DOI] [PubMed] [Google Scholar]
  43. Kho AT, Bhattacharya S, Tantisira KG, Carey VJ, Gaedigk R, Leeder JS, Kohane IS, Weiss ST, Mariani TJ. Transcriptomic analysis of human lung development. Am. J. Respir. Crit. Care Med. 2010;181:54–63. doi: 10.1164/rccm.200907-1063OC. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Kim MG, Chen C, Flomerfelt FA, Germain RN, Schwartz RH. A subtractive PCR-based cDNA library made from fetal thymic stromal cells. J. Immunol. Methods. 1998;213:169–182. doi: 10.1016/s0022-1759(98)00031-3. [DOI] [PubMed] [Google Scholar]
  45. Kim MG, Flomerfelt FA, Lee KN, Chen C, Schwartz RH. A putative 12 transmembrane domain cotransporter expressed in thymic cortical epithelial cells. J. Immunol. 2000;164:3185–3192. doi: 10.4049/jimmunol.164.6.3185. [DOI] [PubMed] [Google Scholar]
  46. Kirchner J, Forbush KA, Bevan MJ. Identification and Characterization of thymus LIM Protein: targeted disruption reduces thymus cellularity. Mol. Cell. Biol. 2001;21:8592–8604. doi: 10.1128/MCB.21.24.8592-8604.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Klug DB, Carter C, Crouch E, Roop D, Conti CJ, Richie ER. Interdependence of cortical thymic epithelial cell differentiation and T-lineage commitment. Proc. Natl. Acad. Sci. 1998;95:11822–11827. doi: 10.1073/pnas.95.20.11822. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Klug DB, Carter C, Gimenez-Conti IB, Richie ER. Cutting edge: thymocyte-independent and thymocyte-dependent phases of epithelial patterning in the fetal thymus. J. Immunol. 2002;169:2842–2845. doi: 10.4049/jimmunol.169.6.2842. [DOI] [PubMed] [Google Scholar]
  49. Lee G, Kim KY, Chang CH, Kim MG. Thymic epithelial requirement for T cell development revealed in the cell ablation transgenic system with TSCOT promoter. Mol. Cells. 2012;34:481–493. doi: 10.1007/s10059-012-0246-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Liang H, Coles AH, Zhu Z, Zayas J, Jurecic R, Kang J, Jones SN. Noncanonical Wnt signaling promotes apoptosis in thymocyte development. J. Exp. Med. 2007;204:3077–3084. doi: 10.1084/jem.20062692. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Liu J, Hadjokas N, Mosley B, Estrov Z, Spence MJ, Vestal RE. Oncostatin M-specific receptor expression and function in regulating cell proliferation of normal and malignant mammary epithelial cells. Cytokine. 1998;10:295–302. doi: 10.1006/cyto.1997.0283. [DOI] [PubMed] [Google Scholar]
  52. Liu K, Lin B, Zhao M, Yang X, Chen M, Gao A, Que J, Lan X. The multiple roles for Sox2 in stem cell maintenance and tumorigenesis. Cell. Signal. 2013;25:1264–1271. doi: 10.1016/j.cellsig.2013.02.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Liu G, Wang L, Pang T, Zhu D, Xu Y, Wang H, Cong X, Liu Y. Umbilical cord-derived mesenchymal stem cells regulate thymic epithelial cell development and function in Foxn1−/− mice. Cell. Mol. Immunol. 2014;11:275–284. doi: 10.1038/cmi.2013.69. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Lynch HE, Goldberg GL, Chidgey A, Van den Brink MR, Boyd R, Sempowski GD. Thymic involution and immune reconstitution. Trends Immunol. 2009;30:366–373. doi: 10.1016/j.it.2009.04.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Malik S, Kakar N, Hasnain S, Ahmad J, Wilcox ER, Naz S. Epidemiology of Van der Woude syndrome from mutational analyses in affected patients from Pakistan. Clin. Genet. 2010;78:247–256. doi: 10.1111/j.1399-0004.2010.01375.x. [DOI] [PubMed] [Google Scholar]
  56. Manley NR, Capecchi MR. The role of Hoxa-3 in mouse thymus and thyroid development. Development. 1995;121:1989–2003. doi: 10.1242/dev.121.7.1989. [DOI] [PubMed] [Google Scholar]
  57. Manley NR, Condie BG. Transcriptional regulation of thymus organogenesis and thymic epithelial cell differentiation. Prog. Mol. Biol. Transl. Sci. 2010;92:103–120. doi: 10.1016/S1877-1173(10)92005-X. [DOI] [PubMed] [Google Scholar]
  58. Manley NR, Selleri L, Brendolan A, Gordon J, Cleary ML. Abnormalities of caudal pharyngeal pouch development in Pbx1 knockout mice mimic loss of Hox3 paralogs. Dev. Biol. 2004;276:301–312. doi: 10.1016/j.ydbio.2004.08.030. [DOI] [PubMed] [Google Scholar]
  59. Moore-Scott BA, Manley NR. Differential expression of Sonic hedgehog along the anterior–posterior axis regulates patterning of pharyngeal pouch endoderm and pharyngeal endoderm-derived organs. Dev. Biol. 2005;278:323–335. doi: 10.1016/j.ydbio.2004.10.027. [DOI] [PubMed] [Google Scholar]
  60. Murata S, Sasaki K, Kishimoto T, Niwa S, Hayashi H, Takahama Y, Tanaka K. Regulation of CD8+ T cell development by thymus-specific proteasomes. Science. 2007;316:1349–1353. doi: 10.1126/science.1141915. [DOI] [PubMed] [Google Scholar]
  61. Nehls M, Kyewski B, Messerle M, Waldschütz R, Schüddekopf K, Smith AJ, Boehm T. Two genetically separable steps in the differentiation of thymic epithelium. Science. 1996;272:886–889. doi: 10.1126/science.272.5263.886. [DOI] [PubMed] [Google Scholar]
  62. Nowell CS, Bredenkamp N, Tetélin S, Jin X, Tischner C, Vaidya H, Sheridan JM, Stenhouse FH, Heussen R, Smith AJ, et al. Foxn1 regulates lineage progression in cortical and medullary thymic epithelial cells but Is dispensable for medullary sublineage divergence. PLoS Genet. 2011;7:e1002348. doi: 10.1371/journal.pgen.1002348. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Obermann H, Wingbermühle A, Münz S, Kirchhoff C. A putative 12-transmembrane domain cotransporter associated with apical membranes of the epididymal duct. J. Androl. 2003;24:542–556. doi: 10.1002/j.1939-4640.2003.tb02706.x. [DOI] [PubMed] [Google Scholar]
  64. Park D. Cloning, sequencing, and overexpression of SH2/SH3 adaptor protein Nck from mouse thymus. Mol. Cells. 1997;7:231–236. [PubMed] [Google Scholar]
  65. Park CS, Lee G, Yang SJ, Ahn S, Kim KY, Shin H, Kim MG. Differential lineage specification of thymic epithelial cells from bipotent precursors revealed by TSCOT promoter activities. Genes Immun. 2013;14:401–406. doi: 10.1038/gene.2013.30. [DOI] [PubMed] [Google Scholar]
  66. Potter CS, Pruett ND, Kern MJ, Baybo MA, Godwin AR, Potter KA, Peterson RL, Sundberg JP, Awgulewitsch A. The nude mutant gene Foxn1 Is a HOXC13 regulatory target during hair follicle and nail differentiation. J. Invest. Dermatol. 2010;131:828–837. doi: 10.1038/jid.2010.391. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Richardson RJ, Dixon J, Malhotra S, Hardman MJ, Knowles L, Boot-Handford RP, Shore P, Whitmarsh A, Dixon MJ. Irf6 is a key determinant of the keratinocyte proliferation-differentiation switch. Nat. Genet. 2006;38:1329–1334. doi: 10.1038/ng1894. [DOI] [PubMed] [Google Scholar]
  68. Roberts NA, White AJ, Jenkinson WE, Turchinovich G, Nakamura K, Withers DR, McConnell FM, Desanti GE, Benezech C, Parnell SM, et al. Rank signaling links the development of invariant γ δ T cell progenitors and Aire(+) medullary epithelium. Immunity. 2012;36:427–437. doi: 10.1016/j.immuni.2012.01.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Rodewald HR. Thymus organogenesis. Annu. Rev. Immunol. 2008;26:355–388. doi: 10.1146/annurev.immunol.26.021607.090408. [DOI] [PubMed] [Google Scholar]
  70. Rodewald HR, Paul S, Haller C, Bluethmann H, Blum C. Thymus medulla consisting of epithelial islets each derived from a single progenitor. Nature. 2001;414:763–768. doi: 10.1038/414763a. [DOI] [PubMed] [Google Scholar]
  71. Rossi SW, Jenkinson WE, Anderson G, Jenkinson EJ. Clonal analysis reveals a common progenitor for thymic cortical and medullary epithelium. Nature. 2006;441:988–991. doi: 10.1038/nature04813. [DOI] [PubMed] [Google Scholar]
  72. Sahin U, Koslowski M, Dhaene K, Usener D, Brandenburg G, Seitz G, Huber C, Tureci O. Claudin-18 splice variant 2 is a Pan-cancer target suitable for therapeutic antibody development. Clin. Cancer Res. 2008;14:7624–7634. doi: 10.1158/1078-0432.CCR-08-1547. [DOI] [PubMed] [Google Scholar]
  73. Saunders-Pullman R, Barrett MJ, Stanley KM, Luciano MS, Shanker V, Severt L, Hunt A, Raymond D, Ozelius LJ, Bressman SB. LRRK2G2019S mutations are associated with an increased cancer risk in Parkinson disease. Mov. Disord. 2010;25:2536–2541. doi: 10.1002/mds.23314. [DOI] [PMC free article] [PubMed] [Google Scholar]
  74. Shakib S, Desanti GE, Jenkinson WE, Parnell SM, Jenkinson EJ, Anderson G. Checkpoints in the development of thymic cortical epithelial cells. J. Immunol. 2009;182:130–137. doi: 10.4049/jimmunol.182.1.130. [DOI] [PubMed] [Google Scholar]
  75. Shen MM, Leder P. Leukemia inhibitory factor is expressed by the preimplantation uterus and selectively blocks primitive ectoderm formation in vitro. Proc. Natl. Acad. Sci. 1992;89:8240–8244. doi: 10.1073/pnas.89.17.8240. [DOI] [PMC free article] [PubMed] [Google Scholar]
  76. Su D, Ellis S, Napier A, Lee K, Manley NR. Hoxa3 and Pax1 regulate epithelial cell death and proliferation during thymus and parathyroid organogenesis. Dev. Biol. 2001;236:316–329. doi: 10.1006/dbio.2001.0342. [DOI] [PubMed] [Google Scholar]
  77. Sun L, Luo H, Li H, Zhao Y. Thymic epithelial cell development and differentiation: cellular and molecular regulation. Protein Cell. 2013;4:342–355. doi: 10.1007/s13238-013-3014-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  78. Sutherland JS, Goldberg GL, Hammett MV, Uldrich AP, Berzins SP, Heng TS, Blazar BR, Millar JL, Malin MA, Chidgey AP, et al. Activation of thymic regeneration in mice and humans following androgen blockade. J. Immunol. 2005;175:2741–2753. doi: 10.4049/jimmunol.175.4.2741. [DOI] [PubMed] [Google Scholar]
  79. Swann JB, Boehm T. Back to the beginning – the quest for thymic epithelial stem cells. Eur. J. Immunol. 2007;37:2364–2366. doi: 10.1002/eji.200737709. [DOI] [PubMed] [Google Scholar]
  80. Ucar A, Ucar O, Klug P, Matt S, Brunk F, Hofmann TG, Kyewski B. Adult thymus Contains FoxN1− epithelial stem cells that are bipotent for medullary and cortical thymic epithelial lineages. Immunity. 2014;41:257–269. doi: 10.1016/j.immuni.2014.07.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  81. Wallin J, Eibel H, Neubüser A, Wilting J, Koseki H, Balling R. Pax1 is expressed during development of the thymus epithelium and is required for normal T-cell maturation. Development. 1996;122:23–30. doi: 10.1242/dev.122.1.23. [DOI] [PubMed] [Google Scholar]
  82. Watson AP, Evans RL, Egland KA. Multiple functions of sushi domain containing 2 (SUSD2) in breast tumorigenesis. Mol. Cancer Res. 2013;11:74–85. doi: 10.1158/1541-7786.MCR-12-0501-T. [DOI] [PMC free article] [PubMed] [Google Scholar]
  83. Wei Q, Condie BG. A focused in situ hybridization screen identifies candidate transcriptional regulators of thymic epithelial cell development and function. PLoS One. 2011;6:e26795. doi: 10.1371/journal.pone.0026795. [DOI] [PMC free article] [PubMed] [Google Scholar]
  84. Wong K, Lister NL, Barsanti M, Lim JM, Hammett MV, Khong DM, Siatskas C, Gray DH, Boyd RL, Chidgey AP. Multilineage potential and self-renewal define an epithelial progenitor cell population in the adult thymus. Cell Rep. 2014;8:1198–1209. doi: 10.1016/j.celrep.2014.07.029. [DOI] [PubMed] [Google Scholar]
  85. Yang SJ, Ahn S, Park CS, Choi S, Kim MG. Identifying subpopulations of thymic epithelial cells by flow cytometry using a new specific thymic epithelial marker, Ly110. J. Immunol. Methods. 2005;297:265–270. doi: 10.1016/j.jim.2004.12.021. [DOI] [PubMed] [Google Scholar]
  86. Yu Z, Bhandari A, Mannik J, Pham T, Xu X, Andersen B. Grainyhead-like factor Get1/Grhl3 regulates formation of the epidermal leading edge during eyelid closure. Dev. Biol. 2008;319:56–67. doi: 10.1016/j.ydbio.2008.04.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  87. Zamisch M, Moore-Scott B, Su DM, Lucas PJ, Manley N, Richie ER. Ontogeny and regulation of IL-7-expressing thymic epithelial cells. J. Immunol. 2005;174:60–67. doi: 10.4049/jimmunol.174.1.60. [DOI] [PubMed] [Google Scholar]
  88. Zhou S, Schuetz JD, Bunting KD, Colapietro AM, Sampath J, Morris JJ, Lagutina I, Grosveld GC, Osawa M, Nakauchi H, et al. The ABC transporter Bcrp1/ABCG2 is expressed in a wide variety of stem cells and is a molecular determinant of the side-population phenotype. Nat. Med. 2001;7:1028–1034. doi: 10.1038/nm0901-1028. [DOI] [PubMed] [Google Scholar]

Articles from Molecules and Cells are provided here courtesy of Korean Society for Molecular and Cellular Biology

RESOURCES