Abstract
The effects of crude protein (CP) levels in the diet on the mRNA expression of amino acid (AA) transporters were studied in a 45-d trial. Eighteen piglets with an initial body weight (BW) of 9.57 kg were assigned to three groups (14%, 17%, and 20% CP in the diet) in a completely randomized design (six replicates per treatment). Diets were supplemented with crystalline AA to achieve equal standardized ileal digestible contents of Lys, Met plus Cys, Thr, and Trp, and were provided ad libitum. After 45 d, all piglets were slaughtered to collect small intestine samples. Compared with the values in the 14% CP group, the expressions of ASCT2, 4F2hc, and ATB0 mRNA in the jejunum were increased by 23.00%, 12.00%, 6.00% and 48.00%, 47.00%, 56.00% in the 17% and 20% CP groups, respectively. These results indicate that a 14% CP diet supplemented with crystalline AA may not transport enough AA into the body and maintain growth performance of piglets. However, a reduction of dietary 17% CP may reduce the excretion of nitrogen into the environment while supporting the development of piglets. Therefore, the 17% CP level is more suitable than 14% CP level.
Keywords: Crude protein, Amino acid balance, Amino acid transporters
1. Introduction
It has been well documented that low crude protein (CP), amino acid (AA)-supplemented diets may reduce feed costs and nitrogen excretion (Kerr et al., 2003; Zarate et al., 2003; Fairbrother et al., 2005; Deng et al., 2007a; 2007b; Lallès et al., 2007; Hou et al., 2008; Kang et al., 2008; Yue and Qiao, 2008; Deng et al., 2009; Opapeju et al., 2009; Gallo et al., 2014; Gloaguen et al., 2014; Liu et al., 2014; Recktenwald et al., 2014). Therefore, the CP level in the diet of weaned pigs has been suggested to be one of the main factors that affect their growth performance (Gallo et al., 2014), feed efficiency, and gastrointestinal health (Yin and Tan, 2010; Acciaioli et al., 2011). An increase in the entry of nutrients (e.g. dipeptides, tripeptides, arginine, lysine, and histidine) from the lumen of the small intestine into the enterocyte can enhance tissue protein synthesis and improve the efficiency of utilization of dietary nutrients, and it can selectively modulate the gene expression of AA transporters in intestinal cells (Wang et al., 2009). Some studies have reported that improving the efficiency of protein use and maintaining performance can be achieved by reducing the CP content of the diet while ensuring the AA balance (Kerr and Easter, 1995; Le Bellego and Noblet, 2002; Kerr et al., 2003; Opapeju et al., 2008; Gloaguen et al., 2014). However, Nyachoti et al. (2006) demonstrated that piglet performance may be impaired when dietary CP levels are reduced from 230 to 190 or 170 g/kg, as the AA deficiency may change the efficiency of AA absorption and transportation (Tuitoek et al., 1997; Tan et al., 2009; 2011; Gallo et al., 2014). The present study investigated the effects of reducing dietary CP while supplementing with essential AA on the gene expression of AA transporters in weaned piglets.
2. Materials and methods
2.1. Animals and experimental treatment
The experimental protocol was approved by the Protocol Management and Review Committee of the Institute of Subtropical Agriculture, Chinese Academy of Sciences (CAS). Pigs were cared for according to the guidelines of the Institute of Subtropical Agriculture on Animal Care, CAS.
Eighteen piglets (Duroc×Landrace×Yorkshire, female), from the experimental field of the animal observation station in southern center of China, were weaned at 28 d of age, but the experiment started after a 7-d adaptation period when the piglets were weighed to determine an initial mean body weight (BW; mean±standard deviation (SD), (9.57±0.64) kg), and randomly assigned to three different groups (six pigs per group). Each of the groups was fed diets with different levels of CP (14%, 17%, and 20%), respectively. Their ingredients are shown in Tables 1 and 2. The dietary treatment met the National Research Council (NRC; 2012) nutrient specifications for 11 to 20 kg BW pigs. All of the animals were housed individually in cages, and had free access to feed and drinking water at all times throughout the experimental period.
Table 1.
Composition and nutrient levels of dietsa
| Component | Content (%)b
|
||
| 14% CP | 17% CP | 20% CP | |
| Ingredient | |||
| Corn | 71.80 | 66.50 | 63.70 |
| Soybean meal | 13.40 | 18.80 | 19.80 |
| Whey powder | 4.40 | 4.30 | 4.30 |
| Fish meal | 1.50 | 4.00 | 9.00 |
| Soybean oil | 4.10 | 2.60 | 0.80 |
| Lys | 0.88 | 0.62 | 0.38 |
| Met | 0.27 | 0.19 | 0.10 |
| Thr | 0.33 | 0.21 | 0.09 |
| Trp | 0.08 | 0.04 | 0.01 |
| Calcium hydrophosphate | 1.15 | 0.74 | 0.00 |
| Limestone | 0.79 | 0.70 | 0.52 |
| Salt | 0.30 | 0.30 | 0.30 |
| 1% premix compoundc | 1.00 | 1.00 | 1.00 |
| Total | 100.00 | 100.00 | 100.00 |
| Calculated nutrient content | |||
| DE (MJ/kg) | 14.60 | 14.60 | 14.60 |
| CP | 14.00 | 17.00 | 20.00 |
| Total Ca | 0.70 | 0.71 | 0.69 |
| Total P | 0.53 | 0.55 | 0.57 |
| Arg | 0.75 | 0.91 | 1.09 |
| His | 0.34 | 0.40 | 0.46 |
| Ile | 0.49 | 0.60 | 0.70 |
| Leu | 1.15 | 1.32 | 1.49 |
| Lys | 1.23 | 1.23 | 1.23 |
| Met+Cys | 0.68 | 0.68 | 0.68 |
| Phe | 0.59 | 0.69 | 0.80 |
| Thr | 0.73 | 0.73 | 0.73 |
| Trp | 0.20 | 0.20 | 0.20 |
| Val | 0.53 | 0.65 | 0.77 |
| EAA/NEAA | 0.90 | 0.80 | 0.70 |
| Recommendation rate of NRC (2012) | 0.80 | 0.80 | 0.80 |
Diets contain 14%, 17%, and 20% CP, respectively, with appropriate crystalline AA supplementation
The values are expressed as percentage (%), except for digestible energy (DE; MJ/kg), essential AA (EAA)/nonessential AA (NEAA), and recommendation rate of NRC (2012)
Premix provided these amounts of vitamins and minerals per kilogram on an as-fed basis: vitamin A, 10 800 IU; vitamin D3, 4000 IU; vitamin E, 40 IU; vitamin K3, 4 mg; vitamin B1, 6 mg; vitamin B2, 12 mg; vitamin B6, 6 mg; vitamin B12, 0.05 mg; biotin, 0.2 mg; folic acid, 2 mg; niacin, 50 mg; D-calcium pantothenate, 25 mg; Fe, 100 mg as ferrous sulfate; Cu, 150 mg as copper sulphate; Mn, 40 mg as manganese oxide; Zn, 100 mg as zinc oxide; I, 0.5 mg as potassium iodide; and Se, 0.3 mg as sodium selenite
Table 2.
CP content and AA composition of feed ingredients used in formulating the experiment dietsa
| Component | Content (%)b
|
||
| 14% CP | 17% CP | 20% CP | |
| CP | 14.14 | 17.32 | 20.27 |
| EAA | |||
| Arg | 0.71 | 0.93 | 1.09 |
| His | 0.30 | 0.37 | 0.44 |
| Ile | 0.46 | 0.60 | 0.71 |
| Leu | 1.11 | 1.32 | 1.52 |
| Lys | 1.26 | 1.25 | 1.26 |
| Met | 0.41 | 0.42 | 0.40 |
| Met+Cys | 0.63 | 0.65 | 0.62 |
| Phe | 0.56 | 0.70 | 0.81 |
| Thr | 0.76 | 0.75 | 0.76 |
| Trp | 0.20 | 0.20 | 0.20 |
| Tyr | 0.41 | 0.50 | 0.59 |
| Val | 0.54 | 0.64 | 0.72 |
| NEAA | |||
| Ala | 0.75 | 0.90 | 1.07 |
| Asp | 1.15 | 1.49 | 1.76 |
| Cys | 0.22 | 0.23 | 0.22 |
| Glu | 2.28 | 2.78 | 3.15 |
| Gly | 0.53 | 0.71 | 0.92 |
| Pro | 0.90 | 1.04 | 1.17 |
| Ser | 0.60 | 0.74 | 0.85 |
| EAA | 6.29 | 7.18 | 7.91 |
| NEAA | 6.84 | 8.40 | 9.74 |
| EAA/NEAA | 0.92 | 0.85 | 0.81 |
Diet contain 14%, 17%, and 20% CP, respectively, with appropriate crystalline AA supplementation
The values are expressed as percentage (%), except for essential AA (EAA)/nonessential AA (NEAA)
2.2. Relative quantification of mRNA expression of AA transporters
Primers for the selected genes (Table 3) were designed using Oligo 6.0 software (Molecular Biology Insights, CO, USA). After the quantity of complementary DNA (cDNA) was determined by a NanoDrop® ND-1000 (NanoDrop Technologies, Rockland, DE, USA), real-time quantitative polymerase chain reaction (PCR) analyses were performed on an ABI 7900HT Fast Real-Time PCR System (Applied Biosystems, CA, USA) with a total volume of 10 μl containing 5 ng of cDNA, 5 μl SYBR Green mix, 0.2 μl ROX Reference Dye (50×), and 0.2 μl each of the forward and reverse primers (Yao et al., 2012). The following protocol was used: (1) pre-denaturation (30 s at 95 °C); (2) amplification and quantification, repeated 40 cycles (5 s at 95 °C, 30 s at 60 °C); and (3) a melting curve program (extension at 72 °C). β-Actin was used as an internal reference gene to normalize target gene transcript levels. The efficiency of the real-time reverse-transcription PCR was determined by the amplification of a dilution series of cDNA according to the equation 10(−1/slope). Target mRNA and β-actin mRNA were amplified with comparable efficiencies (Wang et al., 2009; He et al., 2013). Negative controls, in which cDNA was replaced by water, were also tested (Liu et al., 2012).
Table 3.
Primers used for real-time PCR analysis
| Gene | Primer sequence (5'→3') | Length (bp) | Accession No. |
| ASCT2 | F: GCTTCCGAGAGCCAAGAACT | 152 | XM_003127238.3 |
| R: TCCTTAACGCCTGGAAGCTG | |||
| EAAC1 | F: GCTTCCTTCTTCCAGGGTCC | 148 | NM_001164649.1 |
| R: CTGGCCAATGTGGCTTGTTC | |||
| B0+AT | F: GAGAGGTTTGGTCTTACTGCG | 96 | XM_003353809.2 |
| R: GCTATGACCAAGACGGAGCG | |||
| y+LAT1 | F: TTTGTCTGACCGGCTCTTCC | 286 | XM_005666262.1 |
| R: GAGATCTCCTGCTGTCCTGG | |||
| 4F2hc | F: CTCGAACCCACCAAGGAC | 174 | NM_001110171.1 |
| R: GAGGTGAGACGGCACAGAG | |||
| ATB0 | F: TGGGGCATTTTGATTGCAGC | 238 | NM_001166042.1 |
| R: CTCCCCAGTCAGGGTATGGA | |||
| β-Actin | F: GGATGCAGAAGGAGATCACG | 130 | DQ845171 |
| R: ATCTGCTGGAAGGTGGACAG |
F: forward; R: reverse
2.3. Statistical analysis
All data were subjected to a one-way analysis of variance (ANOVA; SAS Version 9.2) and data were presented as mean±standard error of the mean (SEM). Differences with P values of <0.05 were considered to be statistically significant.
3. Results
3.1. Growth performance of piglets fed diets with different levels of CP (internal data)
The growth performance of weaned piglets fed diets with different CP levels is unpublished data. After the animals were fed different diets for 45 d, significant differences were noted in the average daily gain (ADG) among the three groups (P<0.01), and the 20% CP group had a significantly higher ADG than the other groups (P<0.01). Average daily feed intake (ADFI) showed the same trend as ADG: the 20% CP group had the highest ADFI and ADG, and 14% CP group had the lowest ADFI and ADG. However, there was no significant difference in ADFI between the 17% and 20% CP groups. While the 20% CP group had the lowest feed to gain (F/G) ratio, there were no significant differences between the 14% and 17% CP groups.
3.2. mRNA expression of AA transporters
Changes in the abundance of ASCT2, EAAC1, B0+AT, y+LAT1, 4F2hc, and ATB0 mRNA in the jejunum of the piglets are shown in Table 4. While the abundance of ASCT2, EAAC1, B0+AT, and ATB0 mRNA significantly differed among the three groups (P<0.05), there were no differences in the expression of y+LAT1 and 4F2hc mRNA (P>0.05). Compared with the values in the 14% CP group, the expression of ASCT2, 4F2hc, and ATB0 mRNA in the jejunum was increased by 23.00%, 12.00%, 6.00% and 48.00%, 47.00%, 56.00% in the 17% and 20% CP groups, respectively. The 17% CP group showed the lowest expression of EAAC1 mRNA, and the highest expression of B0+AT mRNA. Furthermore, while the expression of y+LAT1 in the 17% and 20% CP groups was decreased by 13.00% and 8.00%, respectively, compared with that in the 14% CP group, there were no significant differences among the three groups (P>0.05).
Table 4.
Effects of diets with different levels of CP on jejunal intestinal ASCT2, EAAC1, B0+AT, y+LAT1, 4F2hc, and ATB0 mRNA relative abundance in weaned piglets (n=6)
| mRNA | Relative abundance |
SEM | P-value | ||
| 14% CP | 17% CP | 20% CP | |||
| ASCT2 | 1.00 | 1.23 | 1.48 | 0.14 | 0.0340 |
| EAAC1 | 1.00 | 0.94 | 1.41 | 0.15 | 0.0270 |
| B0+AT | 1.00 | 1.49 | 1.44 | 0.16 | 0.0160 |
| y+LAT1 | 1.00 | 0.87 | 0.92 | 0.04 | 0.7369 |
| 4F2hc | 1.00 | 1.12 | 1.47 | 0.14 | 0.0846 |
| ATB0 | 1.00 | 1.06 | 1.56 | 0.18 | 0.0142 |
Diets contain 14%, 17%, and 20% CP, respectively, with appropriate crystalline AA supplementation
4. Discussion
AAs regulate key metabolic pathways that are crucial for the maintenance, health, and growth of animals (Wu, 1998; Hu et al., 2008). The absorption of AA requires many transporter systems that differ with respect to their substrate specificity and driving force (Wang et al., 2009). It has been reported that some genes (such as ASCT2, EAAC1, B0+AT, y+LAT1, 4F2hc, and ATB0) that are involved in the control of growth or AA metabolism are regulated by AA availability (Wu, 1998; Lallès et al., 2007; Zhang et al., 2012; Abdulhussein and Wallace, 2014). In our study, we found that, with an increase in the dietary CP level, the expression of AA transporter genes (ASCT2, EAAC1, B0+AT, 4F2hc, and ATB0) tended to increase, while an opposite trend was seen related to the abundance of y+LAT1 mRNA. A possible reason was that y+LAT1 and EAAC1 have differential expression in our study because the diets with different CP levels related with absorption in piglets. The transport of AA in the small intestine is critical for the supply of AA to all tissues and the homeostasis of serum AA levels (Zhang et al., 2012). Since dietary CP can provide an ideal AA level, the genes of AA transporters that regulate protein metabolism in piglets should be more activated. The present results indicate that the expression of ASCT2, EAAC1, B0+AT, and ATB0 mRNA in the jejunum was influenced by dietary CP levels. Our results regarding the expression of y+LAT1 mRNA were similar to those of He et al. (2013). Under conditions of nutritional stress, the expression of some AA transporters (y+LAT1) may be increased to maintain normal growth of animals under adverse conditions (He et al., 2013). Skalli et al. (2014) suggest that dietary protein levels regulate the expression of AA transporter genes by a complex regulatory system, which may also affect the energy balance and endocrine system. AAs and hormones can play an important role in the regulation of gene expression. Overall, the use of low-CP (14%) AA-supplemented diets in piglets may decrease the transport capacity of AA in the small intestine. However, the absorption and transport of AA is a complex physiological process that is influenced by many factors (Wang et al., 2009; He et al., 2013; Zhang et al., 2013; Chen et al., 2014), including the dietary CP level and the AA balance. Thus, the transport of these nutrients is a key regulatory step in the use of dietary protein by weaned piglets. An excess decrease in dietary CP with AA supplementation resulted in significant reductions in the expression of AA transporter genes in the jejunum. This result suggests that there is an appropriate range within which CP in the diet may be reduced, and any further decrease may dramatically reduce the efficiency of energy and AA utilization in the small intestine (Jensen, 1998). This understanding may also make it possible to increase productivity and reduce the impact of livestock on the environment (Franklin et al., 2002). While this finding has important practical implications, further research will be required to elucidate the underlying mechanisms.
Acknowledgments
We apologize to colleagues whose work was not cited here due to our oversight.
Footnotes
Project supported by the National Basic Research Program (973) of China (No. 2013CB127301), the Natural Science Foundation of Hunan Province, China (No. 12JJ2014), and the National Natural Science Foundation of China (No. 31402088)
Compliance with ethics guidelines: Li WU, Liu-qin HE, Zhi-jie CUI, Gang LIU, Kang YAO, Fei WU, Jun LI, and Tie-jun LI declare that they have no conflict of interest.
All institutional and national guidelines for the care and use of laboratory animals were followed.
References
- 1.Abdulhussein AA, Wallace HM. Polyamines and membrane transporters. Amino Acids. 2014;46(3):655–660. doi: 10.1007/s00726-013-1553-6. [DOI] [PubMed] [Google Scholar]
- 2.Acciaioli A, Sirtori F, Pianaccioli L, et al. Comparison of total tract digestibility and nitrogen balance between Cinta Senese and Large White pigs fed on different levels of dietary crude protein. Anim Feed Sci Tech. 2011;169(1-2):134–139. doi: 10.1016/j.anifeedsci.2011.05.009. [DOI] [Google Scholar]
- 3.Chen G, Zhang J, Zhang YZ, et al. Oral MSG administration alters hepatic expression of genes for lipid and nitrogen metabolism in suckling piglets. Amino Acids. 2014;46(1):245–250. doi: 10.1007/s00726-013-1615-9. [DOI] [PubMed] [Google Scholar]
- 4.Deng D, Li AK, Chu WY, et al. Growth performance and metabolic responses in barrows fed low-protein diets supplemented with essential amino acids. Livest Sci. 2007;109(1-3):224–227. doi: 10.1016/j.livsci.2007.01.104. [DOI] [Google Scholar]
- 5.Deng D, Huang RL, Li TJ, et al. Nitrogen balance in barrows fed low-protein diets supplemented with essential amino acids. Livest Sci. 2007;109(1-3):220–223. doi: 10.1016/j.livsci.2007.01.122. [DOI] [Google Scholar]
- 6.Deng D, Yao K, Chu WY, et al. Impaired translation initiation activation and reduced protein synthesis in weaned piglets fed a low-protein diet. J Nutr Biochem. 2009;20(7):544–552. doi: 10.1016/j.jnutbio.2008.05.014. [DOI] [PubMed] [Google Scholar]
- 7.Fairbrother JM, Nadeau E, Gyles CL. Escherichia coli in postweaning diarrhea in pigs: an update on bacterial types, pathogenesis, and prevention strategies. Anim Health Res Rev. 2005;6(1):17–39. doi: 10.1079/AHR2005105. [DOI] [PubMed] [Google Scholar]
- 8.Franklin MA, Mathew AG, Vickers JR, et al. Characterization of microbial populations and volatile fatty acid concentrations in the jejunum, ileum, and cecum of pigs weaned at 17 vs 24 days of age. J Anim Sci. 2002;80(11):2904–2910. doi: 10.2527/2002.80112904x. [DOI] [PubMed] [Google Scholar]
- 9.Gallo L, Monta GD, Carraro L, et al. Growth performance of heavy pigs fed restrictively diets with decreasing crude protein and indispensable amino acids content. Livest Sci. 2014;161:130–138. doi: 10.1016/j.livsci.2013.12.027. [DOI] [Google Scholar]
- 10.Gloaguen M, Le Floc'h N, Corrent E, et al. The use of free amino acids allows formulating very low crude protein diets for piglets. J Anim Sci. 2014;92(2):637–644. doi: 10.2527/jas.2013-6514. [DOI] [PubMed] [Google Scholar]
- 11.He LQ, Yang HS, Hou YQ, et al. Effects of dietary L-lysine intake on the intestinal mucosa and expression of cat genes in weaned piglets. Amino Acids. 2013;45(2):383–391. doi: 10.1007/s00726-013-1514-0. [DOI] [PubMed] [Google Scholar]
- 12.Hou ZP, Yin YL, Huang RL, et al. Rice protein concentrate partially replaces dried whey in the diet for early-weaned piglets and improves their growth performance. J Sci Food Agric. 2008;88(7):1187–1193. doi: 10.1002/jsfa.3196. [DOI] [Google Scholar]
- 13.Hu CA, Khalil S, Zhaorigetu S, et al. Human ∆1-pyrroline-5-carboxylate synthase: function and regulation. Amino Acids. 2008;35(4):665–672. doi: 10.1007/s00726-008-0075-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Jensen BB. The impact of feed additives on the microbial ecology of the gut in young pigs. J Anim Feed Sci. 1998;7:45–64. [Google Scholar]
- 15.Kang P, Yin YL, Ruan Z, et al. Effect of replacement of lactose with partially hydrolysed rice syrup on small intestine development in weaned pigs from 7 to 21 days. J Sci Food Agric. 2008;88(11):1932–1938. doi: 10.1002/jsfa.3298. [DOI] [Google Scholar]
- 16.Kerr BJ, Easter RA. Effects of feeding reduced protein, amino acid-supplemented diets on nitrogen and energy-balance in grower pigs. J Anim Sci. 1995;73(10):3000–3008. doi: 10.2527/1995.73103000x. [DOI] [PubMed] [Google Scholar]
- 17.Kerr BJ, Southern LL, Bidner TD, et al. Influence of dietary protein level, amino acid supplementation, and dietary energy levels on growing-finishing pig performance and carcass composition. J Anim Sci. 2003;81(12):3075–3087. doi: 10.2527/2003.81123075x. [DOI] [PubMed] [Google Scholar]
- 18.Lallès JP, Bosi P, Smidt H, et al. Nutritional management of gut health in pigs around weaning. Proc Nutr Soc. 2007;66(2):260–268. doi: 10.1017/S0029665107005484. [DOI] [PubMed] [Google Scholar]
- 19.Le Bellego L, Noblet J. Performance and utilization of dietary energy and amino acids in piglets fed low protein diets. Livest Prod Sci. 2002;76(1-2):45–58. doi: 10.1016/S0301-6226(02)00008-8. [DOI] [Google Scholar]
- 20.Liu MB, Li XL, Liu Y, et al. Detection of crude protein, crude starch, and amylose for rice by hyperspectral reflectance. Spectrosc Lett. 2014;47(2):101–106. doi: 10.1080/00387010.2013.779283. [DOI] [Google Scholar]
- 21.Liu XD, Wu X, Yin YL, et al. Effects of dietary L-arginine or N-carbamylglutamate supplementation during late gestation of sows on the miR-15b/16, miR-221/222, VEGFA and eNOS expression in umbilical vein. Amino Acids. 2012;42(6):2111–2119. doi: 10.1007/s00726-011-0948-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Nyachoti CM, Omogbenigun FO, Rademacher M, et al. Performance responses and indicators of gastrointestinal health in early-weaned pigs fed low-protein amino acid-supplemented diets. J Anim Sci. 2006;84(1):125–134. doi: 10.2527/2006.841125x. [DOI] [PubMed] [Google Scholar]
- 23.Opapeju FO, Rademacher M, Blank G, et al. Effect of low-protein amino acid-supplemented diets on the growth performance, gut morphology, organ weights and digesta characteristics of weaned pigs. Animal. 2008;2(10):1457–1464. doi: 10.1017/S175173110800270X. [DOI] [PubMed] [Google Scholar]
- 24.Opapeju FO, Rademacher M, Nyachoti CM. Effect of dietary crude protein level on jejunal brush border enzyme activities in weaned pigs. Arch Anim Nutr. 2009;63(6):455–466. doi: 10.1080/17450390903299133. [DOI] [PubMed] [Google Scholar]
- 25.Recktenwald EB, Ross DA, Fessenden SW, et al. Urea-N recycling in lactating dairy cows fed diets with 2 different levels of dietary crude protein and starch with or without monensin. J Dairy Sci. 2014;97(3):1611–1622. doi: 10.3168/jds.2013-7162. [DOI] [PubMed] [Google Scholar]
- 26.Skalli A, Zambonino-Infante JL, Kotzamanis Y, et al. Peptide molecular weight, distribution of soluble protein fraction affects growth performance and quality in European sea bass (Dicentracrchus labrax) larvae. Aquacul Nutr. 2014;20(2):118–131. doi: 10.1111/anu.12058. [DOI] [Google Scholar]
- 27.Tan B, Yin Y, Liu Z, et al. Dietary L-arginine supplementation increases muscle gain and reduces body fat mass in growing-finishing pigs. Amino Acids. 2009;37(1):169–175. doi: 10.1007/s00726-008-0148-0. [DOI] [PubMed] [Google Scholar]
- 28.Tan B, Yin Y, Liu Z, et al. Dietary L-arginine supplementation differentially regulates expression of lipid-metabolic genes in porcine adipose tissue and skeletal muscle. J Nutr Biochem. 2011;22(5):441–445. doi: 10.1016/j.jnutbio.2010.03.012. [DOI] [PubMed] [Google Scholar]
- 29.Tuitoek K, Young LG, de Lange CF, et al. The effect of reducing excess dietary amino acids on growing-finishing pig performance: an elevation of the ideal protein concept. J Anim Sci. 1997;75(6):1575–1583. doi: 10.2527/1997.7561575x. [DOI] [PubMed] [Google Scholar]
- 30.Wang W, Gu W, Tang X, et al. Molecular cloning, tissue distribution and ontogenetic expression of the amino acid transporter b0,+ cDNA in the small intestine of Tibetan suckling piglets. Comp Biochem Physiol B Biochem Mol Biol. 2009;154(1):157–164. doi: 10.1016/j.cbpb.2009.05.014. [DOI] [PubMed] [Google Scholar]
- 31.Wu G. Intestinal mucosal amino acid catabolism. J Nutr. 1998;128(8):1249–1252. doi: 10.1093/jn/128.8.1249. [DOI] [PubMed] [Google Scholar]
- 32.Yao K, Yin Y, Li X, et al. Alpha-ketoglutarate inhibits glutamine degradation and enhances protein synthesis in intestinal porcine epithelial cells. Amino Acids. 2012;42(6):2491–2500. doi: 10.1007/s00726-011-1060-6. [DOI] [PubMed] [Google Scholar]
- 33.Yin YL, Tan B. Manipulation of dietary nitrogen, amino acids and phosphorus to reduce environmental impact of swine production and enhance animal health. J Food Agric Environ. 2010;8(3-4):447–462. [Google Scholar]
- 34.Yue LY, Qiao SY. Effects of low-protein diets supplemented with crystalline amino acids on performance and intestinal development in piglets over the first 2 weeks after weaning. Livest Sci. 2008;115(2-3):144–152. doi: 10.1016/j.livsci.2007.06.018. [DOI] [Google Scholar]
- 35.Zarate AJ, Moran ET, Burnham DJ. Reducing crude protein and increasing limiting essential amino acid levels with summer-reared, slow- and fast-feathering broilers. J Appl Poultry Res. 2003;12(2):160–168. doi: 10.1093/japr/12.2.160. [DOI] [Google Scholar]
- 36.Zhang J, Yin YL, He QH, et al. Effects of MSG supplementation on free amino acids in plasma of growing-finishing pigs. J Food Agric Environ. 2012;10(3-4):600–605. [Google Scholar]
- 37.Zhang J, Yin YL, Shu XG, et al. Oral administration of MSG increases expression of glutamate receptors and transporters in the gastrointestinal tract of young piglets. Amino Acids. 2013;45(5):1169–1177. doi: 10.1007/s00726-013-1573-2. [DOI] [PubMed] [Google Scholar]