Skip to main content
Medical Science Monitor: International Medical Journal of Experimental and Clinical Research logoLink to Medical Science Monitor: International Medical Journal of Experimental and Clinical Research
. 2015 Jun 12;21:1707–1715. doi: 10.12659/MSM.893471

Polymorphisms in NFKB1 and NFKBIA Genes Modulate the Risk of Developing Prostate Cancer among Han Chinese

Xiao Han 1,B,C,E,G, Jia-jun Zhang 2,B,C,D,G, Nan Yao 3,B,C,F,G, Gang Wang 4,A,F,G, Juan Mei 5,E,F,G, Bo Li 6,B,C,E,G, Chao Li 7,C,D,G, Zi-an Wang 1,A,E,G,✉
PMCID: PMC4473804  PMID: 26068031

Abstract

Background

Nuclear factor kappa B (NF-κB) pathway proteins play an important role in modulating inflammation and other carcinogenic processes. Polymorphisms within NF-κB pathway genes may influence cancer risk. This study aimed to examine the association between NFKB19-4 ATTG ins→del, NFKBIA 3′ UTR A→G, -826CT and -881AG polymorphisms and prostate cancer risk among Chinese.

Material/Methods

The polymorphisms were genotyped via PCR-RFLP technique on 936 prostate cancer patients and 936 population-based healthy controls. Logistic regression model was used to measure the risk association present.

Results

With the exception of NFKBIA 3′ UTR polymorphism, the heterozygous and mutant genotypes of the other polymorphisms were significantly associated with prostate cancer risk. For NFKB1 polymorphism, a decreased risk was observed, with adjusted OR: 0.69; 95% CI: 0.44, 0.98; P=0.01 (heterozygous) and adjusted OR: 0.60; 95% CI: 0.37, 0.91; P=0.02 (mutant). NFKBIA -826CT and -881AG polymorphisms were in complete linkage disequilibrium and shared the same risk association, with adjusted OR: 1.34; 95% CI: 1.09, 1.62; P=0.02 (heterozygous) and adjusted OR: 2.83; 95% CI: 1.79, 4.50; P=0.01 (mutants). Interestingly, the impact of the NFKB1 polymorphism was not present in nonsmokers and younger (<60 years) subjects (P<0.05).

Conclusions

In conclusion, polymorphisms in NFKB1 and NFKBIA genes may modulate the risk of developing prostate cancer among Chinese.

Keywords: Asian Continental Ancestry Group; Association; Genetic Association Studies; Genotype; Polymorphism, Genetic

Background

Prostate cancer is a common type of cancer in men, with an estimated annual incidence of 238,590 cases [1]. Although most of the prostate cancer cases happen in the developed countries, recent years have witnessed the rapid increase in prostate cancer incidence in developing populations, including China [2]. Prostate cancer is also one of the leading causes of cancer-related mortality, accounting for 10% of all male cancer-related deaths, in both Western and Asian populations [3]. Considering the significance of the disease, there is a pressing need for identifying risk factors of prostate cancer, so that the disease can be detected at an early stage, which facilitates prostate cancer treatment and management.

The mechanism of prostate carcinogenesis is extremely complicated. However, it has been generally accepted that the etiology of prostate cancer is influenced by several factors such as smoking habits, age, ethnicity, and, importantly, genetic factors [4–6]. It has been shown previously that the latter could contribute to up to 42% of prostate cancer risk [6]. Candidate gene association study (CGAS) is an established method for identifying genetic variants associated with a disease [7]. The approach focuses only on genes that could be of relevance to the mechanism of the disease of interest [7,8]. The specific polymorphisms that could either affect gene expression or the protein product of the chosen candidate genes were then selected. Subsequently, the frequencies of the polymorphic genotypes were compared between subjects with and without the disease, and statistical models were used to determine risk association [7,8].

Many studies on prostate carcinogenesis have focused on the role of genetic factors that mediate inflammatory response [9–12], as inflammation has been extensively linked to the etiology of prostate cancer, although other mechanisms such as cell adhesion also plays an important role [13,14]. Given the important role of inflammation in carcinogenesis, the present candidate gene association study focused on genes relevant to inflammation. Among all the proteins involved in inflammatory response, the nuclear factor-kappa B (NF-κB) pathway proteins, notably p50 (NF-κB1) and its critical inhibitor, IκBα, appeared to have the most important function. NF-κB activation can lead to the synthesis of several enzymes, including inducible nitric oxide synthase (iNOS) and cyclooxygenase-2, which catalyze the release of reactive oxygen species that damages adjacent cells. The NF-κB pathway has also been shown to regulate the production of many pro-inflammatory cytokines, such as TGF-β, TNF-α, IL-6, and IL-8, which further supports the role of NF-κB in inflammation. Inflammation causes various genomic lesions to the cells, which facilitates cancer development. Additionally, improper activation of NF-κB1 can cause enhanced cell proliferation and evasion of apoptosis, which are 2 of the cancer hallmarks. Therefore, under normal conditions, NF-κB1 is bound to IκBα inhibitor when its expression is not needed.

NF-κB1 and IκBα are encoded by NFKB1 and NFKBIA genes, respectively. The impact of polymorphisms within the NFKB1 and NFKBIA genes on cancer risk has been extensively investigated in a number of cancers [15–21], but surprisingly few studies have been performed on prostate cancer [22,23]. The risk modulation effects of the polymorphisms were inconsistent in different studies, which could be because of the small sample sizes recruited and the ethnic background differences of subjects in different studies. The present study aimed to examine the association of NFKB19-4 ATTG ins→del, NFKBIA 3′ untranslated region (UTR) A→G, -826CT and -881AG polymorphisms with risk of developing prostate cancer among Chinese in a large sample size.

Material and Methods

Subjects

Between September 2008 and June 2014, 936 newly diagnosed, histopathologically confirmed sporadic prostate cancer patients were randomly recruited from the First Affiliated Hospital of Bengbu Medical College, Bengbu Third People’s Hospital, the Second Affiliated Hospital of Bengbu Medical College, the People’s Liberation Army 123rd Hospital China and Bengbu First People’s Hospital. Based on medical records, patients who had family history of prostate cancer and those who suffered from malignancies other than prostate cancer were excluded. Healthy males (N=936) were randomly recruited from the general population as controls. Controls were matched with patients by age (±5 years). The age of the patients recruited ranged from 50 to 76 years old, with a mean of 62.0±6.89 years. The controls’ ages ranged from 48 to 73 years old, with a mean of 61.4±7.11. Based on our previous preliminary findings (data not shown), the peak age of prostate cancer incidence in our population occurred at 60 years old. Therefore, subjects below 60 years old were categorized as “young”, while those 60 years or above were categorized as “old” in our analysis. 442 of the patients and 389 of the controls were smokers, while the rest were nonsmokers. Information on the subjects’ age was collected based on the medical registration form (which was in turn based on the official identity card of the People’s Republic of China). On the other hand, information on the smoking habits was obtained from an interview with subjects on recruitment. All subjects were self-described ethnic Han Chinese. They were asked to sign a written informed consent before donating 3 ml blood for genetic analysis. The study was approved by the Medical Ethics Board (MEB) of Bengbu Medical College (approval no. BMC/1/IMO/2008.0415504).

Genotyping of polymorphisms

DNA was extracted from blood samples by using the TIANGEN DNA Purification Kit. All polymorphisms were genotyped by previously described PCR-RFLP technique (NFKB1, [15]; NFKBIA 3′ UTR [21], NFKBIA -826CT, and -881AG [19]), with the researchers blinded to the case/control status of the samples. For NFKB1 polymorphism, the PCR primers were TGGGCACAAGTCGTTTATGA (forward) and CTGGAGCCGGTAGGGAAG (reverse), while the restriction enzyme used was PflMI (Van91I). For NFKBIA 3′ UTR polymorphism, the PCR primers were GGCTGAAAGAACATGGACTTG (forward) and GTACACCATTTACAGGAGGG (reverse), while HaeIII was used for the digesting the PCR products. NFKBIA -826CT and -881AG polymorphisms were amplified simultaneously by using GGTCCTTAAGGTCCAATCG (forward) and GTTGTGGATACCTTGCACTA (reverse). NFKBIA -826CT polymorphism was digested by using BfaI, and NFKBIA -881AG polymorphism was digested by using TspRI. Approximately 10% of randomly selected samples were sequenced to confirm the genotypes.

Statistical analysis

All analyses were performed by using SPSS version 17.0. Continuous variables were assessed by using the independent samples t-test and are presented as mean ±SD. Categorical variables were tested by using the chi-square test. The Hardy-Weinberg equilibrium was analyzed by using a goodness-of-fit chi-square test. An unconditional logistic regression model was performed to calculate the odds ratios (ORs) and their corresponding 95% confidence intervals (95% CI) to assess the association of the polymorphisms with prostate cancer risk. The overall ORs were also adjusted to age and smoking status of the subjects. A p-value <0.05 was statistically significant.

Results

Frequency of NFKB1 and NFKBIA genotypes

The frequency of NFKB1 and NFKBIA genotypes in the 936 patients and 936 controls are shown in Table 1. Significant differences in genotype frequency were observed between patients and controls for the NFKB19-4 ATTG polymorphism (P=0.03), NFKBIA -826CT polymorphism (P<0.01), and NFKBIA -881AG polymorphism (P<0.01). The frequency for NFKBIA -826CT and -881AG polymorphisms was identical, indicating the presence of linkage disequilibrium (LD). In addition, the genotype frequency for all the polymorphisms followed Hardy-Weinberg Equilibrium (Table 1).

Table 1.

Frequency of NFKB1 and NFKBIA genotypes.

SNP/genotype Patient Control P value HWE P value (case + control)*
NFKB1 0.03** 0.94
 Ins/ins 63 38
 Ins/Del 339 331
 Del/del 534 567
NFKBIA 3′ UTR 0.58 0.55
 AA 173 165
 AG 442 458
 GG 321 313
NFKBIA -826CT <0.01** 0.78
 CC 508 586
 CT 356 321
 TT 72 29
NFKBIA -881AG <0.01** 0.78
 AA 508 586
 AG 356 321
 GG 72 29
*

HWE – Hardy-Weinberg Equilibrium;

**

significant at P<0.05.

Association of the SNPs and prostate cancer risk

Table 2 showed the association of the SNPs and prostate cancer risk. Significant association was found for NFKB19-4 ATTG, NFKBIA -826CT and -881AG polymorphisms, but not the NFKBIA 3′ UTR polymorphism. For NFKB19-4 ATTG polymorphism, the ins/del genotype and del/del genotype were associated with a lower prostate cancer risk, with adjusted OR: 0.69; 95% CI: 0.44, 0.98; P=0.01 and adjusted OR: 0.60; 95% CI: 0.37, 0.91; P=0.02 respectively. For NFKBIA -826CT and -881AG polymorphisms, a higher prostate cancer risk association was observed. Since both polymorphisms were in LD, they had an identical risk value, with adjusted OR: 1.34; 95% CI: 1.09, 1.62; P=0.02 for heterozygotes and adjusted OR: 2.83; 95% CI: 1.79, 4.50; P=0.01 for mutants.

Table 2.

Association of the SNPs and prostate cancer risk.

SNP/Genotype Patient Control Odds ratio (95% CI)* P value
NFKB1
 Ins/ins 63 38 – –
 Ins/Del 339 331 0.69 (0.44–0.98) 0.01**
 Del/del 534 567 0.60 (0.37–0.91) 0.02**
NFKBIA 3′ UTR
 AA 173 165 – –
 AG 442 458 0.90 (0.69–1.22) 0.61
 GG 321 313 0.94 (0.68–1.32) 0.84
NFKBIA -826CT
 CC 508 586 – –
 CT 356 321 1.34 (1.09–1.62) 0.02**
 TT 72 29 2.83 (1.79–4.50) 0.01**
NFKBIA -881AG
 AA 508 586 – –
 AG 356 321 1.34 (1.09–1.62) 0.02**
 GG 72 29 2.83 (1.79–4.50) 0.01**
*

Adjusted to age and smoking status;

**

significant at P<0.05.

Combined effect of NFKB1 and NFKBIA polymorphisms

Significant polymorphisms were evaluated for their combined effect on prostate cancer risk. The results are shown in Table 3. With the exceptions of NFKB19–4 ATTG ins/ins + NFKBIA mutant and NFKB19-4 ATTG ins/del + NFKBIA mutant combinative genotypes, all other genotypes were significantly associated with a lower prostate cancer risk (OR<1.00) (Table 3).

Table 3.

Combined effect of the SNPs and prostate cancer risk.

SNP/genotype* Patient Control Odds ratio (95% CI) P value
NFKB1 + NFKBIA
 Ins/ins + WT 35 16 – –
 Ins/Del + WT 186 186 0.46 (0.24–0.85) 0.01**
 Del/del + WT 285 306 0.42 (0.23–0.79) 0.01**
 Ins/ins + Het 22 28 0.36 (0.16–0.81) 0.01**
 Ins/Del + Het 127 119 0.49 (0.26–0.93) 0.03**
 Del/del + Het 207 219 0.43 (0.23–0.80) 0.01**
 Ins/ins + Mut 6 4 0.69 (0.17–2.77) 0.60
 Ins/Del + Mut 26 26 0.46 (0.20–1.02) 0.06
 Del/del + Mut 40 42 0.44 (0.21–0.91) 0.03**
*

WT – CC for -826 polymorphism, AA for -881 polymorphism; Het – CT for -826 polymorphism, AG for -881 polymorphism; Mut – TT for -826 polymorphism, GG for -881 polymorphism;

**

significant at P<0.05.

Association of the SNPs and prostate cancer risk in people with different smoking status

The association above was analyzed separately for smokers and nonsmokers. The result is shown in Table 4. For smokers, similar to the overall findings described above, significant association with prostate cancer risk was observed for NFKB19-4 ATTG, NFKBIA -826CT, and -881AG polymorphisms. However, for nonsmokers, the association of NFKB1 polymorphism was absent, and only NFKBIA -826CT and -881AG polymorphisms showed risk association.

Table 4.

Association of the SNPs and prostate cancer risk in people with different smoking status.

Smoking status SNP/genotype Patient Control Odds ratio (95% CI) P value
Smokers NFKB1
 Ins/ins 31 14 – –
 Ins/Del 155 130 0.54 (0.27–1.06) 0.07
 Del/del 226 245 0.42 (0.22–0.80) <0.01*
NFKBIA 3′ UTR
 AA 68 77 – –
 AG 207 184 1.27 (0.89–1.87) 0.21
 GG 137 128 1.21 (0.81–1.82) 0.35
NFKBIA -826CT
 CC 213 237 – –
 CT 164 138 1.32 (0.99–1.77) 0.06
 TT 35 14 2.78 (1.46–5.31) <0.01*
NFKBIA -881AG
 AA 213 237 – –
 AG 164 138 1.32 (0.99–1.77) 0.06
 GG 35 14 2.78 (1.46–5.31) <0.01*
Nonsmokers NFKB1
 Ins/ins 32 24 – –
 Ins/Del 184 201 0.69 (0.40–1.21) 0.19
 Del/del 308 322 0.72 (0.41–1.25) 0.24
NFKBIA 3′ UTR
 AA 105 88 – –
 AG 235 274 0.72 (0.52–1.01) 0.05
 GG 184 185 0.83 (0.59–1.18) 0.31
NFKBIA -826CT
 CC 295 388 – –
 CT 192 183 1.38 (1.07–1.78) 0.01*
 TT 37 15 3.24 (1.75–6.02) <0.01*
NFKBIA -881AG
 AA 295 388 – –
 AG 192 183 1.38 (1.07–1.78) 0.01*
 GG 37 15 3.24 (1.75–6.02) <0.01*
*

Significant at P<0.05.

For smokers, the del/del genotype of NFKB19-4 ATTG polymorphism was associated with a lower prostate cancer risk, with OR: 0.42; 95% CI: 0.22, 0.80; P<0.01, while the mutant genotypes of the NFKBIA -826CT and -881AG polymorphisms were associated with a higher prostate cancer risk, with OR: 2.78; 95% CI: 1.46, 5.31; P<0.01. For nonsmokers, NFKBIA -826CT and -881AG polymorphisms showed a higher risk association for prostate cancer in heterozygotes and mutants, with OR: 1.38; 95% CI: 1.07, 1.78; P=0.01 for heterozygotes and OR: 3.24; 95% CI: 1.75, 6.02; P<0.01 for mutants.

Association of the SNPs and prostate cancer risk in older and younger subjects

We also analyzed the association based on the age of the subjects (old vs. young). Table 5 shows the association of the SNPs and prostate cancer risk in older and younger subjects. The finding based on age was similar to the finding based on the smoking status above, such that for older subjects, an association was observed for NFKB19-4 ATTG, NFKBIA -826CT, and -881AG polymorphisms, but for younger subjects the NFKB19-4 ATTG association was lost.

Table 5.

Association of the SNPs and prostate cancer risk in older and younger subjects.

Smoking status SNP/genotype Patient Control Odds ratio (95% CI) P value
Old NFKB1
 Ins/ins 36 21 – –
 Ins/Del 186 184 0.59 (0.33–1.05) 0.07
 Del/del 302 311 0.57 (0.32–0.99) 0.05*
NFKBIA 3′ UTR
 AA 100 88 – –
 AG 224 256 0.77 (0.55–1.08) 0.13
 GG 180 172 0.92 (0.65–1.31) 0.65
NFKBIA -826CT
 CC 288 332 – –
 CT 192 167 1.33 (1.02–1.72) 0.03*
 TT 44 17 2.98 (1.67–5.33) <0.01*
NFKBIA -881AG
 AA 288 332 – –
 AG 192 167 1.33 (1.02–1.72) 0.03*
 GG 44 17 2.98 (1.67–5.33) <0.01*
Young NFKB1
 Ins/ins 25 17 – –
 Ins/Del6 155 147 0.72 (0.37–1.38) 0.32
 Del/del 232 256 0.62 (0.32–1.17) 0.14
NFKBIA 3′ UTR
 AA 73 77 – –
 AG 198 202 1.03 (0.71–1.50) 0.86
 GG 141 141 1.05 (0.71–1.57) 0.79
NFKBIA -826CT
 CC 220 254 – –
 CT 164 154 1.23 (0.93–1.63) 0.15
 TT 28 12 2.69 (1.34–5.42) 0.01*
NFKBIA -881AG
 AA 220 254 – –
 AG 164 154 1.23 (0.93–1.63) 0.15
 GG 28 12 2.69 (1.34–5.42) 0.01*
*

Significant at P<0.05.

For older subjects, the del/del genotype of NFKB19-4 ATTG polymorphism was associated with a lower prostate cancer risk, with OR: 0.57; 95% CI: 0.32, 0.99; P=0.05. In contrast, NFKBIA -826CT and -881AG polymorphisms showed a higher risk association for prostate cancer in heterozygotes and mutants, with OR: 1.33; 95% CI: 1.02, 1.72; P=0.03 for heterozygotes and OR: 2.98; 95% CI: 1.67, 5.33; P<0.01 for mutants. However, in younger subjects, only the mutant genotypes of NFKBIA -826CT and -881AG polymorphisms were associated with prostate cancer risk, with OR: 2.69; 95% CI: 1.34, 5.42; P=0.01.

Discussion

NF-κB pathway proteins play an important role in modulating inflammation and other related cellular processes. Among the many NF-κB pathway proteins, the most abundant p50 (NF-κB1) has been thought to have the most important function in these cellular processes [24–26]. Regulation of p50 (NF-κB1) by its natural inhibitor, IκBα, is necessary for the former to carry out its cellular functions. The p50 (NF-κB1) and IκBα proteins were encoded by NFKB1 and NFKBIA genes, respectively. Polymorphisms within these genes may alter their protein products in several ways, which in turn lead to differential cancer risk. Many studies have been performed to investigate the association of NFKB19-4 ATTG ins→del, NFKBIA 3′ UTR A→G, -826CT and -881AG polymorphisms and risk of various cancers [15–21]. However, surprisingly little research was performed on prostate cancers. Only 2 previous studies reported on the association of NFKB19-4 ATTG ins→del polymorphism and prostate cancer risk [22,23], and no study has focused on NFKBIA polymorphisms. Moreover, the results from the 2 NFKB1 reports contradicted one another. It is generally accepted that polymorphisms present different risk in people with different ethnic background, and that small sample sizes may cause misleading interpretation of results. These factors motivated us to perform the present study in a large sample size among Han Chinese. In this study, we excluded patients who had family history of prostate cancer because familial cancers are usually (but not always) caused by mutations in high-penetrance genes, which are rare in the general population. The present study aimed to identify low-penetrance susceptibility alleles, which, despite having modest risk modification effect, are very common in the general population. Patients who had malignancies other than prostate cancer were also excluded to prevent misidentification of susceptibility alleles associated with other cancers.

It has been well-established that many inflammatory-related cytokines, such as TGF-β, TNF-α, IL-6, and IL-8, mediate inflammation in the prostate through the NF-κB pathway [22,27–30]. Therefore, genes in the NF-κB pathway, notably NFKB1 and NFKBIA, potentially play a role in prostate carcinogenesis. We showed that NFKB19-4 ATTG ins→del, and NFKBIA -826CT and -881AG polymorphisms were associated with prostate cancer risk. We postulate that the polymorphisms modulate prostate cancer risk in our subjects by altering the transcription of the genes, since the polymorphisms were all located in the promoter region. For NFKB19-4 ATTG polymorphism, the del allele was associated with a reduced prostate cancer risk. In vitro functional assay has shown that the del allele could decrease the level of transcription by approximately 2-fold [31]. This in turn reduces the protein translation, resulting in a lower production of p50 (NF-κB1) (Figure 1). Since p50 (NF-κB1) plays a role in inflammation, subjects who had less of the protein (i.e., those who carried the del allele) had a reduced level of inflammation. Considering that inflammation is positively linked to prostate carcinogenesis [9–12], subjects having the del allele were associated with a decreased prostate cancer risk, which explains our observation in this study. On the other hand, for the NFKBIA polymorphisms, we showed that the mutant allele was associated with an increased prostate cancer risk. It has been shown previously that the mutant allele can retard the transcription of the gene [32]. This retardation could lead to aberrant NFKB1 expression, which results in an increased prostate cancer risk, as observed in our study (Figure 1).

Figure 1.

Figure 1

Potential mechanism by which NFKB1 and NFKBIA polymorphisms mediate risk of prostate cancer.

We also found that all combinative genotypes of NFKB19-4 ATTG ins→del and NFKBIA -881/-826 polymorphisms were significantly associated with prostate cancer risk, except the NFKB19-4 ATTG ins/ins + NFKBIA mutant and NFKB19-4 ATTG ins/del + NFKBIA mutant genotypes. The lack of significance of these 2 combinative genotypes could be caused by the small sample size included. It is interesting to note that all other combinative genotypes led to a reduced prostate cancer risk, which is in accordance to the effect of NFKB19-4 ATTG polymorphism but not the NFKBIA polymorphisms. This suggests that the effect of NFKB19-4 ATTG polymorphism was stronger than that of the NFKBIA polymorphisms. This observation was not unexpected, since the product of NFKB1 plays a direct role in mediating inflammation, whereas that of NFKBIA plays an indirect role by regulating NFKB1 expression.

There were several strengths and limitations in this study. The greatest strength was the large sample size. The combined sample size of the only 2 available studies on NF-κB pathway gene polymorphism was 487 prostate cancer patients and 513 controls [22,23]. The present study alone involved 936 prostate cancer patients and 936 controls, which had a much higher statistical power than the other 2 studies combined. Another strength of this study was that we analyzed not only the overall effect of the polymorphism on prostate cancer risk, but also the effect in smokers vs. nonsmokers and older vs. younger subjects. Both smoking habits and age have been established as strong risk factors for prostate cancer [4,5]. Therefore, separate analysis of the effect of the polymorphisms on subjects with different smoking habits and age was important to control the potential confounding factors. However, our study also had a limitation. We analyzed only a few polymorphisms in the NF-κB pathway. There are several other polymorphisms that could potentially modulate prostate cancer risk. However, only 4 were included in our study because we anticipated the significance of these 4 polymorphisms based on our literature review.

Conclusions

The del allele of the NFKB19-4 ATTG polymorphism was associated with a decreased prostate cancer risk, while the mutant allele of NFKBIA -826CT and -881AG polymorphisms was associated with an increased prostate cancer risk. There have been very few studies investigating the association of NF-κB pathway gene polymorphism and prostate cancer risk. Therefore, this study adds valuable information to the currently available literature on the role of these polymorphisms on prostate cancer risk.

Acknowledgements

We thank the staff of the Medical Record Departments of Bengbu Medical College, Bengbu Third People’s Hospital, the People’s Liberation Army 123rd Hospital China and Bengbu First People’s Hospital for sorting patients’ medical records for our use.

Footnotes

Source of support: This study was supported by the private funds of all the authors

Statement

This study was not supported by any grant; rather, it was supported by the private funds of all the authors.

References

  • 1.Siegel R, Naishadham D, Jemal A. Cancer statistics, 2013. Cancer J Clin. 2013;63(1):11–30. doi: 10.3322/caac.21166. [DOI] [PubMed] [Google Scholar]
  • 2.McCracken M, Olsen M, Chen MS, Jr, et al. Cancer incidence, mortality, and associated risk factors among Asian Americans of Chinese, Filipino, Vietnamese, Korean, and Japanese ethnicities. Cancer J Clin. 2007;57(4):190–205. doi: 10.3322/canjclin.57.4.190. [DOI] [PubMed] [Google Scholar]
  • 3.Ferlay J, Soerjomataram I, Ervik M, et al. GLOBOCAN 2012 v1.0, cancer incidence and mortality worldwide: IARC CancerBase No. 11 [Internet] Lyon, France: International Agency for Research on Cancer; 2013. Available from: http://globocan.iarc.fr. [Google Scholar]
  • 4.Murphy AB, Akereyeni F, Nyame YA, et al. Smoking and prostate cancer in a multi-ethnic cohort. Prostate. 2013;73(14):1518–28. doi: 10.1002/pros.22699. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Leitzmann MF, Rohrmann S. Risk factors for the onset of prostatic cancer: age, location, and behavioral correlates. Clin Epidemiol. 2012;4:1–11. doi: 10.2147/CLEP.S16747. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Lichtenstein P, Holm NV, Verkasalo PK, et al. Environmental and heritable factors in the causation of cancer – analyses of cohorts of twins from Sweden, Denmark, and Finland. N Engl J Med. 2000;343(2):78–85. doi: 10.1056/NEJM200007133430201. [DOI] [PubMed] [Google Scholar]
  • 7.Patnala R, Clements J, Batra J. Candidate gene association studies: a comprehensive guide to useful in silico tools. BMC Genetics. 2013;14:39. doi: 10.1186/1471-2156-14-39. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Kwon JM, Goate AM. The candidate gene approach. Alcohol Res Health. 2000;24(3):164–68. [PMC free article] [PubMed] [Google Scholar]
  • 9.Kryvenko ON, Jankowski M, Chitale DA, et al. Inflammation and preneoplastic lesions in benign prostate as risk factors for prostate cancer. Mod Pathol. 2012;25(7):1023–32. doi: 10.1038/modpathol.2012.51. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Sfanos KS, Isaacs WB, De Marzo AM. Infections and inflammation in prostate cancer. Am J Clin Exp Urol. 2013;1(1):3–11. [PMC free article] [PubMed] [Google Scholar]
  • 11.Sfanos KS, Hempel HA, De Marzo AM. The role of inflammation in prostate cancer. Adv Exp Med Biol. 2014;816:153–81. doi: 10.1007/978-3-0348-0837-8_7. [DOI] [PubMed] [Google Scholar]
  • 12.Sfanos KS, De Marzo AM. Prostate cancer and inflammation: the evidence. Histopathology. 2012;60(1):199–215. doi: 10.1111/j.1365-2559.2011.04033.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Wang L, Xie PG, Lin YL, et al. Aberrant methylation of PCDH10 predicts worse biochemical recurrence-free survival in patients with prostate cancer after radical prostatectomy. Med Sci Monit. 2014;20:1363–68. doi: 10.12659/MSM.891241. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Lin YL, Xie PG, Wang L, Ma JG. Aberrant methylation of protocadherin 17 and its clinical significance in patients with prostate cancer after radical prostatectomy. Med Sci Monit. 2014;20:1376–82. doi: 10.12659/MSM.891247. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Mohd Suzairi MS, Tan SC, Ahmad Aizat AA, et al. The functional -94 insertion/deletion ATTG polymorphism in the promoter region of NFKB1 gene increases the risk of sporadic colorectal cancer. Cancer Epidemiol. 2013;37(5):634–38. doi: 10.1016/j.canep.2013.05.007. [DOI] [PubMed] [Google Scholar]
  • 16.Shiels MS, Engels EA, Shi J, et al. Genetic variation in innate immunity and inflammation pathways associated with lung cancer risk. Cancer. 2012;118(22):5630–36. doi: 10.1002/cncr.27605. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Cheng CW, Su JL, Lin CW, et al. Effects of NFKB1 and NFKBIA gene polymorphisms on hepatocellular carcinoma susceptibility and clinicopathological features. PLoS One. 2013;8(2):e56130. doi: 10.1371/journal.pone.0056130. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Curran JE, Weinstein SR, Griffiths LR. Polymorphic variants of NFKB1 and its inhibitory protein NFKBIA, and their involvement in sporadic breast cancer. Cancer Lett. 2002;188(1–2):103–7. doi: 10.1016/s0304-3835(02)00460-3. [DOI] [PubMed] [Google Scholar]
  • 19.Tan SC, Suzairi MS, Aizat AA, et al. Gender-specific association of NFKBIA promoter polymorphisms with the risk of sporadic colorectal cancer. Med Oncol. 2013;30(4):693. doi: 10.1007/s12032-013-0693-6. [DOI] [PubMed] [Google Scholar]
  • 20.White KL, Vierkant RA, Phelan CM, et al. Polymorphisms in NF-kappaB inhibitors and risk of epithelial ovarian cancer. BMC Cancer. 2009;9:170. doi: 10.1186/1471-2407-9-170. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Shafi’i MSM, Shahpudin SNM, Mustapha MA, et al. The genetic variation A>G at 3′ UTR of nuclear factor kappa B 1 A (NFκB1A) influences susceptibility of sporadic colorectal cancer in Malaysian population. Int Med J. 2012;19(2):98–101. [Google Scholar]
  • 22.Zhang P, Wei Q, Li X, et al. A functional insertion/deletion polymorphism in the promoter region of the NFKB1 gene increases susceptibility for prostate cancer. Cancer Genet Cytogenet. 2009;191(2):73–77. doi: 10.1016/j.cancergencyto.2009.01.017. [DOI] [PubMed] [Google Scholar]
  • 23.Kopp TI, Friis S, Christensen J, et al. Polymorphisms in genes related to inflammation, NSAID use, and the risk of prostate cancer among Danish men. Cancer Genet. 2013;206(7–8):266–78. doi: 10.1016/j.cancergen.2013.06.001. [DOI] [PubMed] [Google Scholar]
  • 24.Oeckinghaus A, Ghosh S. The NF-kappaB family of transcription factors and its regulation. Cold Spring Harb Perspect Biol. 2009;1(4):a000034. doi: 10.1101/cshperspect.a000034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Tak PP, Firestein GS. NF-kappaB: a key role in inflammatory diseases. J Clin Invest. 2001;107(1):7–11. doi: 10.1172/JCI11830. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Naugler WE, Karin M. NF-kappaB and cancer-identifying targets and mechanisms. Curr Opin Genet Dev. 2008;18(1):19–26. doi: 10.1016/j.gde.2008.01.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Lu S, Dong Z. Characterization of TGF-beta-regulated interleukin-8 expression in human prostate cancer cells. Prostate. 2006;66:996–1004. doi: 10.1002/pros.20424. [DOI] [PubMed] [Google Scholar]
  • 28.Wise GJ, Marella VK, Talluri G, Shirazian D. Cytokine variations in patients with hormone treated prostate cancer. J Urol. 2000;164:722–25. doi: 10.1097/00005392-200009010-00024. [DOI] [PubMed] [Google Scholar]
  • 29.Nakashima J, Tachibana M, Horiguchi Y, et al. Serum interleukin 6 as a prognostic factor in patients with prostate cancer. Clin Cancer Res. 2000;6:2702–6. [PubMed] [Google Scholar]
  • 30.Shariat SF, Andrews B, Kattan MW, et al. Plasma levels of interleukin-6 and its soluble receptor are associated with prostate cancer progression and metastasis. Urology. 2001;58:1008–15. doi: 10.1016/s0090-4295(01)01405-4. [DOI] [PubMed] [Google Scholar]
  • 31.Karban AS, Okazaki T, Panhuysen CI, et al. Functional annotation of a novel NFKB1 promoter polymorphism that increases risk for ulcerative colitis. Hum Mol Genet. 2004;13(1):35–45. doi: 10.1093/hmg/ddh008. [DOI] [PubMed] [Google Scholar]
  • 32.Abdallah A, Sato H, Grutters JC, et al. Inhibitor kappa B-alpha (IkappaB-alpha) promoter polymorphisms in UK and Dutch sarcoidosis. Genes Immun. 2003;4(6):450–54. doi: 10.1038/sj.gene.6364001. [DOI] [PubMed] [Google Scholar]

Articles from Medical Science Monitor : International Medical Journal of Experimental and Clinical Research are provided here courtesy of International Scientific Information, Inc.

RESOURCES