Skip to main content
NCBI home page
Cytotechnology logoLink to Cytotechnology
. 2015 Feb 19;67(4):711–719. doi: 10.1007/s10616-015-9846-0

Spatiotemporal expression of Prdm genes during Xenopus development

Rieko Eguchi 1, Emi Yoshigai 2, Takamasa Koga 2, Satoru Kuhara 1,2, Kosuke Tashiro 1,2,✉
PMCID: PMC4474993  PMID: 25690332

Abstract

Epigenetic regulation is known to be important in embryonic development, cell differentiation and regulation of cancer cells. Molecular mechanisms of epigenetic modification have DNA methylation and histone tail modification such as acetylation, phosphorylation and ubiquitination. Until now, many kinds of enzymes that modify histone tail with various functional groups have been reported and regulate the epigenetic state of genes. Among them, Prdm genes were identified as histone methyltransferase. Prdm genes are characterized by an N-terminal PR/SET domain and C-terminal some zinc finger domains and therefore they are considered to have both DNA-binding ability and methylation activity. Among vertebrate, fifteen members are estimated to belong to Prdm genes family. Even though Prdm genes are thought to play important roles for cell fate determination and cell differentiation, there is an incomplete understanding of their expression and functions in early development. Here, we report that Prdm genes exhibit dynamic expression pattern in Xenopus embryogenesis. By whole mount in situ hybridization analysis, we show that Prdm genes are expressed in spatially localized manners in embryo and all of Prdm genes are expressed in neural cells in developing central nervous systems. Our study suggests that Prdm genes may be new candidates to function in neural cell differentiation.

Keywords: Epigenetics, Neural development, Prdm, Xenopus embryos

Introduction

Vertebrate development occurs as a series of cell fate determination and cell differentiation events and those are regulated by various secreted signaling molecules and transcription factors. Recently, epigenetic regulation has been reported that it is important in embryonic development, cell differentiation and regulation of cancer cells. Molecular mechanisms of epigenetic modification have DNA methylation and histone modification such as acetylation, phosphorylation and ubiquitination.

For example, histone acetylation is well correlated with the condition of gene expression. The acetylation level is regulated in a dynamic manner. Histone acetylation is catalyzed by HATs (histone acetyltransferase) and HDAC (histone deacetylase). HATs are classified into five groups, such as GNAT (GCN5-related N-acetyltransferase), MYST (MOZ, Ybf/Sas3, Sas2 and Tip60) and P300/CBP, and recently Camello is added as new group (Karmodiya et al. 2014). HDAC are also categorized into five groups; class 1, class 2a, class 2b, class 3 and class 4 by sequence homology and subcellular localization (Wang et al. 2014). Usually, HATs and HDAC are involved in a multisubunit and multifunctional complex and act as transcriptional activator and repressor, respectively.

Histone methylation is also reported as regulation system for gene expression level. Enzyme which catalyze protein methylation, has been first reported by study of SUV39H, which suppress SU(VAR)3–9 expression in position effect variegation of Drosophila. SUV39H contains the evolutionally conserved SET [Su(var)3–9, enhancer of zest (EZ), trithorax (TRX)] domain which consists of 130 amino residues (Aagaard et al. 1999). The SET domain is a catalytic domain conserved among lysine methyltransferases proteins and more than 60 SET protein genes have been identified in various organisms (Jenuwein et al. 1998; Trievel et al. 2002; Qian and Zhou 2006). SET proteins are known to function in cell development, for examples, Ezh2 which is a member of PcG regulates myogenesis by histone H3-K27 methylation (O’Carroll et al. 2001; Caretti et al. 2004). Mll and Mll2 are involved in TrxG sustain Hox genes regulation in normal development (Yu et al. 1998; Glaser et al. 2006).

Prdm genes family is one of sub-family of SET genes (Kim et al. 2003; Pinheiro et al. 2012; Eom et al. 2009; Wu et al. 2008; Hayashi et al. 2005). Prdm genes are characterized by an N-terminal PR/SET domain and C-terminal zinc finger domains (Fumasoni et al. 2007) and therefore they are considered to have both DNA-binding ability and methylation activity. Prdm family genes have been reported to control cell proliferation in cancer (Nishikawa et al. 2007; Tam et al. 2006) and in normal development (Davis et al. 2006). Moreover, they act to determine cell fate. For example, Prdm16 controls the switch between skeletal muscle and brown fat in mice (Seale et al. 2008) and hamlet decides neuron class in Drosophila (Moore et al. 2002). Prdm proteins interact with the other chromatin modifiers. Prdm1 and Prmt5 form complex and shows H2R3 and H4R3 di-methylation activity in mouse germ cell (Ancelin et al. 2006). Also, Prdm6 acts as an epigenetic regulator by cooperating with class 1 HDAC and G9a in mouse skeletal muscle (Davis et al. 2006). Prdm gene family consists of fifteen members and even though Prdm genes are thought to play important roles for cell fate determination and cell differentiation, there is an incomplete understanding of their expression and functions in early development.

Here, we report that Prdm genes exhibit dynamic expression pattern in Xenopus embryogenesis. By whole mount in situ hybridization analysis, we show that Prdm genes were expressed in spatially localized manners in embryo and all of Prdm genes were expressed in developing central nervous systems (CNS). Our studies suggest that Prdm genes may be new candidates to function in neural cell differentiation.

Materials and methods

Xenopus embryo culture and RT-PCR

Xenopus laevis (X. laevis) embryos were obtained by artificial fertilization and were cultured in 0.1 % Steinberg’s solution at 21 °C. The embryos were staged according to Niewkoop and Faber (1994). Total RNA was extracted from whole embryos using TRIsol® reagent (Life Technologies, Carlsbad, CA, USA). cDNA was synthesized with High Capacity cDNA Reverse Transcription Kits (Applied Biosystems, South San Francisco, CA, USA). Primers used for PCR is Table 1. Identification of X. laevis Prdm gene have not been completed, so Prdm3, 5, 6, 8, 10, 11, 13, 14, 15 and 16 were amplified by degenerate primers designed by X. tropicalis Prdm gene sequences.

Table 1.

Primer sequence for RT-PCR

Gene name Nucleotide Sequence (5′–3′)
Prdm1 F: ATGAAAATGGATATGGAAGGAATTGATATG
R: CTGAATTGGTGAATGCATCAGATAATTCTG
Prdm2 F: ATGTGGGAGGTATACTACCCAAACCTTGGATGGATG
R: AAATATTTTCTTACAGTATTTACAGGGATGCATCTC
Prdm3 F: ATGCCAGACCAGCGNACTTTNATGTCAGCAATHGARAAYATG
R: GTGNAGGGATTCCTGATCAGANAGNGANAGCATCAT
Prdm4 F: AGTGATAGTCACGAGCTGGACGCTGCGATTACTATG
R: GGAGCTGAAGGAGTGAGAGCACATTGAGCA
Prdm5 F: GTGGATGAAGGTATAGACAACAGRTTRATGTGG
R: CTCACATGTGAAGGGGCGCTTTTCTGAATGNGTDATCATRTG
Prdm6 F: GAGCCTAGTAAGTCAAGCTGGATGAGRTAYGTNCGNTG
R: CATCCTCTGATGTCGACTCAGCTGGGTNGCYTGNGTRAA
Prdm8 F: AAGGACAACAGAGAGTTGGAGCCTCGNAAYACNATG
R: CATTGCATATTCCTTTTTGTGGTGNGAYCTCAT
Prdm9 F: CAGATGTCGCAGGAGTCTTGT
R: TGTGAACTGTTCTCCACACTC
Prdm10 F: TGTAACTGGATGATGTTTGTACGNCCNGCNCA
R: GAATCCCATCATACACACNCGGCAYTTRAACAT
Prdm11 F: ATGCACCCGGAAAAGACGGAGGAAATGTGCAGRAAYATG
R: ATCGAACACTTGACACGCCTTNACRAACAT
Prdm12 F: ATGATGGGCTCGGTGCTG
R: CAGCTGTGAGTAGGCGCT
Prdm13 F: GGAGAGGAGCGNTACATCTGTTGGTAYTGYTGG
R: CTCGCTTGCTATCTCAGANAGCTGRTGRCTRTGCAT
Prdm14 F: ATGAACATACTNGCCACTCCNCAYGARATG
R: GTGGACCCTCATGTGCTTGTTCAGGCTNGANGAYTGNGA
Prdm15 F: GCTGCTGAACCTGAAAAAGACCTGAACCCNAGYTCNTCN
R: CCGGTGATGCTCCAGCATTACATCCCTCCTRTARAANAGYTT
Prdm16 F: CCTCTTCTTAAAAGCCCTTTGAACCATACACGNGARGCNAAR
R: AATGGCCGACATCTGTGGGTGAAAAAGNAGNGGNGANGG
Odc F: GCGGGCAAAGGAGCTTAATG
R: TAACGCCAGAATCTGCTGGG
Open in a new tab

Y = CT (meaning, Y can be C or T), R = AG, H = ACT, D = AGT, N = ACGT

F, forward primer; R, reverse primer

Whole mount in situ hybridization

Whole mount in situ hybridizations were performed based on routine method using digoxigenin-labeled antisense RNA probe (Jones and Smith 1999). The fragments for Prdm 1–16 were amplified using cDNA as a template and cloned into pGEM®-T vector (Promega, Madison, WI, USA). The DIG probes were synthesized by T7 and SP6 RNA polymerase using pGEM®-T constructs as templates. These probes were hybridized to Xenopus embryos which were fixed in 10 % formaldehyde, 0.1 M MOPS, pH7.4, 2 mM EGTA, 1 mM MgSO4 (MEMFA) for 30 to 60 minutes at room temperature. The color reaction was carried out using precipitating BM purple AP substrate (Roche, Mannheim, Germany).

Results

Temporal expression pattern of Prdm genes during development

First, we analyzed the temporal expression pattern of Prdm genes in Xenopus embryos. We extracted total RNAs from ten developmental stages, 6–7, 10–10.5, 12.5, 16–17, 19–20, 23–24, 26–27, 29/30–31, 34–35 and 37, and analyzed by RT-PCR method. Odc (ornithine decarboxylase) was used for internal control gene. As shown in Fig. 1, all of Prdm genes were expressed in early Xenopus embryos. Moreover, Prdm1, 2, 4, 9, 11 and 15 were observed at stage 6–7. Because transcription in embryos is not started until stage 8, it shows Prdm1, 2, 4, 9, 11 and 15 might existed as maternally inherited mRNAs and seem to function at very early phase of development. These results indicate most of Prdm genes are expressed and function in early embryogenesis.

Fig. 1.

Fig. 1

Open in a new tab

The temporal expression pattern of Prdm1–16 during development. RT-PCR analysis was carried out at stage 6–7, 10–10.5, 12.5, 16–17, 19–20, 23–24, 26–27, 29/30–31, 34–35 and 37 embryos. Total RNAs were isolated from whole embryos and that samples got converted to cDNA by reverse transcription reaction. ODC (ornithine decarboxylase) was used as control

Spatial expression pattern of Prdm genes during development

Next, we examined spatial expression pattern of Prdm genes in embryos at stage 10–40 by whole mount in situ hybridization (Fig. 2). Here, we described the expression regions of each Prdm gene member in detail.

Fig. 2.

Fig. 2

Fig. 2

Open in a new tab

The spatial expression pattern of Prdm1-16 during development. Xenopus embryos were sampled at various stages and fixed with MEMFA (0.1 M MOPS, 2 mM EGTA, 1 mM magnesium sulfate, 10 % formaldehyde buffer). Digoxigenin-labeled antisense RNA probes were hybridized to embryos. The color reaction was carried out using precipitating BM purple AP substrate

Prdm1 started to be expressed in animal pole at stage 10.5 and then in branchia and somite at stage 21. At stage 26, its expression was observed in eyes and ears.

Prdm2 expression was observed in whole region at stage 13, which may be the maternally inherited RNA, and it was restricted in eyes and notochord regions as the development progress. At stage 37/38, Prdm2 was expressed strongly in head region including eyes and notochord.

Prdm3 was expressed in notochord at stage 13 and in branchia and kidney at stage 21. As development progressed, Prdm3 expression was restricted in endbrain, midbrain, ventricular zone, eyes and nose at stage 21. It is consistent with the report in which Prdm3 was expressed in pronephron, forebrain, midbrain and hindbrain in Xenopus embryo (Van Campenhout et al. 2006).

Prdm4 was expressed in whole region at gastrula stage, and at stage 27, the expression was restricted in eyes and notochord. Moreover, at stage 31, its expression was localized in branchia, nose, interbrain, midbrain and ventricular zone. In mouse development, Prdm4 was observed in embryonic cortex region (Chittka et al. 2012), thereby, Xenopus Prdm4 may function as well as mouse one.

Prdm5 was expressed in whole region at stage 13 and the expression was restricted in notochord as stage progressed. At stage 29/30, Prdm5 was expressed in nose.

Prdm6 was expressed in notochord at stage from 17 to 21 and then in hindbrain at stage 26. At later stages, the expression was clearly detected in ventricular zone and notochord at stage 29/30 and in eyes and notochord at stage 39. Mouse Prdm6 is known as PRISM (PR domain in smooth muscle) (Davis et al. 2006) and reported to act in post-mitotic neurons (Kinameri et al. 2008).

Prdm8 was expressed in notochord at stage 23–27. Subsequently, at stage 31, it was expressed in midbrain and hindbrain. In development of mouse CNS including retina, spinal cord and endbrain, Prdm8 expression is temporally and spatially regulated in those cells (Komai et al. 2009) and it plays a role in neocortical development which morphological changes during late and terminal multipolar phases (Inoue et al. 2014).

Prdm9 expression was observed in notochord at stage 25 and in eyes and ears at stage 31. At stage 39, it was strongly expressed in midbrain region.

Prdm10 expression was not detected until stage 26. At stage 31, expression occured in eyes, branchia, interbrain, midbrain and the ventricular zone. Mouse Prdm10 was expressed in mesoderm and neural crest cell at E8.5 (Park and Kim 2010).

Prdm11 was not observed until stage 25. Its expression began in spinal cord and notochord at stage 27 and in the whole head and spinal cord at stage 39.

Prdm12 was expressed in neural crest cells at stage 13, in spinal cord at stage 21, and in forebrain, midbrain, ears, pronephron and nose at stage 24. Mouse Prdm12 is reported to be expressed similarly in spinal cord, forebrain and midbrain at fetal mouse E9.5 (Kinameri et al. 2008).

Prdm13 was expressed in neural crest cells and spinal cord at stage from 13 to 21. At stage 26, it was observed in eyes and hindbrain along with spinal cord and then in whole head and branchia at stage 40. Hanotel et al. (2014) indicated that Prdm13 suppresses neural cell differentiation to glutamatergic neuron by suppressing of Neurog2 in Xenopus embryo.

Prdm14 was expressed in spinal cord at stage 13 and in pharyngeal pouch at stage 23. At stage 27, it was expressed in notochord and at stage 37/38, strongly expressed in eyes and hindbrain. Prdm14 was reported to be expressed in mouse ICM (Yamaji et al. 2008) and to be essential for reacquisition of pluripotency in fibroblast (Chia et al. 2010).

Prdm15 was expressed in animal pole at stage 12 and in area of brain at stage 21. Moreover, the gene begun to be expressed in eyes, branchia, endbrain and ventricular zone at stage 28.

Expression of Prdm16 was observed in olfactory cord and pharyngeal pouch at stage 26. Moreover, Prdm16 begun to be expressed in branchia at stage 31, and the gene was strongly expressed in whole head and kidney at stage 39.

From these results, it was shown that Prdm genes are expressed in spatially localized manners in embryo and all of Prdm genes are expressed in developing CNS, suggesting that the genes of Prdm family function mainly in neural cell differentiation and proliferation through histone tail modification.

Discussion

Here, we showed that Prdm family genes were expressed in a tissue-specific manner in Xenopus embryos and moreover, all Prdm genes were expressed in neural region.

In mouse, expression analysis and functional analysis of some Prdm genes have been carried out. Prdm6, 8, 12, 13 and 16 were reported to be expressed in CNS (Kinameri et al. 2008). Yang and Shinkai (2013) showed that Prdm12 was expressed transiently in neural differentiation process of mouse embryonic carcinoma cells P19 and it was involved in neural cell differentiation by suppressing cell proliferation. Also, Prdm13 has been considered to switch from excitatory to inhibitory neuron differentiation in mouse brain through methylation activity for H3K9 and H3K27 (Chang et al. 2013). Also, the Prdm genes whose expressions were observed in the tissues besides the CNS have been identified and examined in mouse embryos. For example, Prdm9 which has catalytic activity for H3K9 tri-methylation, was detected in germ cells in meiotic phase and postnatal testis (Hayashi et al. 2005). Prdm3, 11 and 16 were expressed in mouse hematopoietic stem cells and might serve as regulator for their self-replication, maintenance and function (Thoren et al. 2013). Also, Prdm15 has been observed in human Burkitt’s B cell lymphoma (Giallourakis et al. 2013). In our analysis, we found also that Xenopus Prdm genes were expressed in tissues beside CNS in addition to expression in CNS. These indicate that Prdm genes may have regulative role for various cell differentiation.

Our and recent evidences showed that the Prdm genes have emerged as important factors in development and cell differentiation of CNS and the other tissues in vertebrates. Even though Prdm genes are estimated as not only protein modification enzyme but also DNA-binding protein, the targets for their binding has not been identified and hence, the molecular mechanisms of their functions have been not dissolved yet. The identification of their target gene might give a better understanding of the roles of Prdm genes in the animal development.

Acknowledgments

This work was supported by Grants-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology (MEXT) of Japan.

Contributor Information

Rieko Eguchi, Email: lover_soul_0121@yahoo.co.jp.

Kosuke Tashiro, Phone: 81 92 642 3043, Email: ktashiro@grt.kyushu-u.ac.jp.

References

  1. Aagaard L, Laible G, Selenko P, Schmid M, Dorn R, Schotta G, Kuhfittig S, Wolf A, Lebersorger A, Singh PB, Reuter G, Jenuwein T. Functional mammalian homologues of the Drosophila PEV-modifier Su(var)3–9 encode centromere-associated proteins which complex with the heterochromatin component M31. EMBO J. 1999;18:1923–1938. doi: 10.1093/emboj/18.7.1923. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Ancelin K, Lange UC, Hajkova P, Schneider R, Bannister AJ, Kouzarides T, Surani MA. Blimp1 associates with Prmt5 and directs histone arginine methylation in mouse germ cells. Nat Cell Biol. 2006;8:623–630. doi: 10.1038/ncb1413. [DOI] [PubMed] [Google Scholar]
  3. Caretti G, Di Padova M, Micales B, Lyons GE, Sartorelli V. The Polycomb Ezh2 methyltransferase regulates muscle gene expression and skeletal muscle differentiation. Genes Dev. 2004;18:2627–2638. doi: 10.1101/gad.1241904. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Chang JC, Meredith DM, Mayer PR, Borromeo MD, Lai HC, Ou YH, Johnson JE. Prdm13 mediates the balance of inhibitory and excitatory neurons in somatosensory circuits. Dev Cell. 2013;25:182–195. doi: 10.1016/j.devcel.2013.02.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chia NY, Chan YS, Feng B, Lu X, Orlov YL, Moreau D, Kumar P, Yang L, Jiang J, Lau MS, Huss M, Soh BS, Kraus P, Li P, Lufkin T, Lim B, Clarke ND, Bard F, Ng HH. A genome-wide RNAi screen reveals determinants of human embryonic stem cell identity. Nature. 2010;468:316–320. doi: 10.1038/nature09531. [DOI] [PubMed] [Google Scholar]
  6. Chittka A, Nitarska J, Grazini U, Richardson WD. Transcription factor positive regulatory domain 4 (PRDM4) recruits protein arginine methyltransferase 5 (PRMT5) to mediate histone arginine methylation and control neural stem cell proliferation and differentiation. J Biol Chem. 2012;287:42995–43006. doi: 10.1074/jbc.M112.392746. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Davis CA, Haberland M, Arnold MA, Sutherland LB, McDonald OG, Richardson JA, Childs G, Harris S, Owens GK, Olson EN. PRISM/PRDM6, a transcriptional repressor that promotes the proliferative gene program in smooth muscle cells. Mol Cell Biol. 2006;26:2626–2636. doi: 10.1128/MCB.26.7.2626-2636.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Eom GH, Kim K, Kim SM, Kee HJ, Kim JY, Jin HM, Kim JR, Kim JH, Choe N, Kim KB, Lee J, Kook H, Kim N, Seo SB. Histone methyltransferase PRDM8 regulates mouse testis steroidogenesis. Biochem Biophys Res Commun. 2009;388:131–136. doi: 10.1016/j.bbrc.2009.07.134. [DOI] [PubMed] [Google Scholar]
  9. Fumasoni I, Meani N, Rambaldi D, Scafetta G, Alcalay M, Ciccarelli FD. Family expansion and gene rearrangements contributed to the functional specialization of PRDM genes in vertebrates. BMC Evol Biol. 2007;7:187. doi: 10.1186/1471-2148-7-187. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Giallourakis CC, Bentia Y, Molinie B, Cao Z, Despo O, Pratt HE, Zukerberg LR, Daly MJ, Rioux JD, Xavier RJ. Genome-wide analysis of immune system genes by expressed sequence Tag profiling. J Immunol. 2013;190:5578–5587. doi: 10.4049/jimmunol.1203471. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Glaser S, Schaft J, Lubitz S, Vintersten K, van der Hoeven F, Tufteland KR, Aasland R, Anastassiadis K, Ang SL, Stewart AF. Multiple epigenetic maintenance factors implicated by the loss of Mll2 in mouse development. Development. 2006;133:1423–1432. doi: 10.1242/dev.02302. [DOI] [PubMed] [Google Scholar]
  12. Hanotel J, Bessodes N, Thélie A, Hedderich M, Parain K, Van Driessche B, Brandão Kde O, Kricha S, Jorgensen MC, Grapin-Botton A, Serup P, Van Lint C, Perron M, Pieler T, Henningfeld KA, Bellefroid EJ. The Prdm13 histone methyltransferase encoding gene is a Ptf1a–Rbpj downstream target that suppresses glutamatergic and promotes GABAergic neuronal fate in the dorsal neural tube. Dev Biol. 2014;386:340–357. doi: 10.1016/j.ydbio.2013.12.024. [DOI] [PubMed] [Google Scholar]
  13. Hayashi K, Yoshida K, Matsui Y. A histone H3 methyltransferase controls epigenetic events required for meiotic prophase. Nature. 2005;438:374–378. doi: 10.1038/nature04112. [DOI] [PubMed] [Google Scholar]
  14. Inoue M, Kuroda T, Honda A, Komabayashi-Suzuki M, Komai T, Shinkai Y, Mizutani K. Prdm8 regulates the morphogical transition at multipolar phase during neocortical development. PLoS ONE. 2014;9:e86356. doi: 10.1371/journal.pone.0086356. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Jenuwein T, Laible G, Dorn R, Reuter G. SET domain proteins modulate chromatin domains in eu- and heterochromatin. Cell Mol Life Sci. 1998;54:80–93. doi: 10.1007/s000180050127. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Jones CM, Smith JC. Whole mount in situ hybridization to Xenopus embryos. Methods Mol Biol. 1999;97:635–640. doi: 10.1385/1-59259-270-8:635. [DOI] [PubMed] [Google Scholar]
  17. Karmodiya K, Analika K, Muley V, Pradhan SJ, Bhide Y, Galande S. Camello, a novel family of Histone Acetyltransferases that acetylate histone H4 and is essential for zebrafish development. Sci Rep. 2014;4:6076. doi: 10.1038/srep06076. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Kim KC, Geng L, Huang S. Inactivation of a histone methyltransferase by mutations in human cancers. Cancer Res. 2003;63:7619–7623. [PubMed] [Google Scholar]
  19. Kinameri E, Inoue T, Aruga J, Imayoshi I, Kageyama R, Shimogori T, Moore AW. Prdm proto-oncogene transcription factor family expression and interaction with the Notch–Hes pathway in mouse neurogenesis. PLoS ONE. 2008;3:e3859. doi: 10.1371/journal.pone.0003859. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Komai T, Iwanari H, Mochizuki Y, Hamakubo T, Shinkai Y. Expression of the mouse PR domain protein Prdm8 in the developing central nervous system. Gene Expr Patterns. 2009;9:503–514. doi: 10.1016/j.gep.2009.07.005. [DOI] [PubMed] [Google Scholar]
  21. Moore AW, Jan LY, Jan YN. hamlet, a binary genetic switch between single- and multiple-dendrite neuron morphology. Science. 2002;297:1355–1358. doi: 10.1126/science.1072387. [DOI] [PubMed] [Google Scholar]
  22. Niewkoop PD, Faber J (1994) Normal table of Xenopus laevis (daudin). Garland Publishing, New York and London
  23. Nishikawa N, Toyota M, Suzuki H, Honma T, Fujikane T, Ohmura T, Nishidate T, Ohe-Toyota M, Maruyama R, Sonoda T, Sasaki Y, Urano T, Imai K, Hirata K, Tokino T. Gene amplification and overexpression of PRDM14 in breast cancers. Cancer Res. 2007;67:9649–9657. doi: 10.1158/0008-5472.CAN-06-4111. [DOI] [PubMed] [Google Scholar]
  24. O’Carroll D, Erhardt S, Pagani M, Barton SC, Surani MA, Jenuwein T. The polycomb-group gene Ezh2 is required for early mouse development. Mol Cell Biol. 2001;21:4330–4336. doi: 10.1128/MCB.21.13.4330-4336.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Park JA, Kim KC. Expression patterns of PRDM10 during mouse embryonic development. BMB Rep. 2010;43:29–33. doi: 10.5483/BMBRep.2010.43.1.029. [DOI] [PubMed] [Google Scholar]
  26. Pinheiro I, Margueron R, Shukeir N, Eisold M, Fritzsch C, Richter FM, Mittler G, Genoud C, Goyama S, Kurokawa M, Son J, Reinberg D, Lachner M, Jenuwein T. Prdm3 and Prdm16 are H3K9me1 methyltransferases required for mammalian heterochromatin integrity. Cell. 2012;150:948–960. doi: 10.1016/j.cell.2012.06.048. [DOI] [PubMed] [Google Scholar]
  27. Qian C, Zhou MM. SET domain protein lysine methyltransferase: structure, specificity and catalysis. Cell Mol Life Sci. 2006;63:2755–2763. doi: 10.1007/s00018-006-6274-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Seale P, Bjork B, Yang W, Kajimura S, Chin S, Kuang S, Scimè A, Devarakonda S, Conroe HM, Erdjument-Bromage H, Tempst P, Rudnicki MA, Beier DR, Spiegelman BM. PRDM16 controls a brown fat/skeletal muscle switch. Nature. 2008;454:961–967. doi: 10.1038/nature07182. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Tam W, Gomez M, Chadburn A, Lee JW, Chan WC, Knowles DM. Mutational analysis of PRDM1 indicates a tumor-suppressor role in diffuse large B-cell lymphomas. Blood. 2006;107:4090–4100. doi: 10.1182/blood-2005-09-3778. [DOI] [PubMed] [Google Scholar]
  30. Thoren LA, Fog CK, Jensen KT, Buza-Vidas N, Côme C, Lund AH, Porse BT. PRDM11 is dispensable for the maintenance and function of hematopoietic stem and progenitor cells. Stem Cell Res. 2013;11:1129–1136. doi: 10.1016/j.scr.2013.07.009. [DOI] [PubMed] [Google Scholar]
  31. Trievel RC, Beach BM, Dirk LM, Houtz RL, Hurley JH. Structure and catalytic mechanism of a SET domain protein methyltransferase. Cell. 2002;111:91–103. doi: 10.1016/S0092-8674(02)01000-0. [DOI] [PubMed] [Google Scholar]
  32. Van Campenhout C, Nichane M, Antoniou A, Pendeville H, Bronchain OJ, Marine JC, Mazabraud A, Voz ML, Bellefroid EJ. Evi1 is specifically expressed in ghe distal tubule and duct of the Xenopus pronephros and plays a role in its formation. Dev Biol. 2006;294:203–219. doi: 10.1016/j.ydbio.2006.02.040. [DOI] [PubMed] [Google Scholar]
  33. Wang C, Schroeder FA, Wey HY, Borra R, Wagner FF, Reis S, Kim SW, Holson EB, Haggarty SJ, Hooker JM. In vivo imaging of histone deacetylases (HDACs) in the central nervous system and major peripheral organs. J Med Chem. 2014;57:7999–8009. doi: 10.1021/jm500872p. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Wu Y, Ferguson JE, 3rd, Wang H, Kelley R, Ren R, McDonough H, Meeker J, Charles PC, Wang H, Patterson C. PRDM6 is enriched in vascular precursors during development and inhibits endothelial cell proliferation, survival, and differentiation. J Mol Cell Cardiol. 2008;44:47–58. doi: 10.1016/j.yjmcc.2007.06.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Yamaji M, Seki Y, Kurimoto K, Yabuta Y, Yuasa M, Shigeta M, Yamanaka K, Ohinata Y, Saitou M. Critical function of Prdm14 for the establishment of the germ cell lineage in mice. Nat Genet. 2008;40:1016–1022. doi: 10.1038/ng.186. [DOI] [PubMed] [Google Scholar]
  36. Yang CM, Shinkai Y. Prdm12 is induced by retinoic acid and exhibits anti-proliferative properties through the cell cycle modulation of P19 embryonic carcinoma cells. Cell Struct Funct. 2013;38:197–206. doi: 10.1247/csf.13010. [DOI] [PubMed] [Google Scholar]
  37. Yu BD, Hanson RD, Hess JL, Horning SE, Korsmeyer SJ. MLL, a mammalian trithorax-group gene, functions as a transcriptional maintenance factor in morphogenesis. Proc Natl Acad Sci USA. 1998;95:10632–10636. doi: 10.1073/pnas.95.18.10632. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Cytotechnology are provided here courtesy of Springer Science+Business Media B.V.

RESOURCES