Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2016 Jun 13.
Published in final edited form as: Genesis. 2015 Jun 13;53(6):377–386. doi: 10.1002/dvg.22861

Generation of a tamoxifen inducible Tnnt2MerCreMer knock-in mouse model for cardiac studies

Jianyun Yan 1,*, Nishat Sultana 1,*, Lu Zhang 1,*, David S Park 2, Akshay Shekhar 2, Jun Hu 1, Lei Bu 2, Chen-Leng Cai 1,#
PMCID: PMC4480198  NIHMSID: NIHMS693795  PMID: 26010701

Summary

Tnnt2, encoding thin-filament sarcomeric protein cardiac troponin T, plays critical roles in heart development and function in mammals. To develop an inducible genetic deletion strategy in myocardial cells, we generated a new Tnnt2:MerCreMer (Tnnt2MerCreMer/+) knock-in mouse. Rosa26 reporter lines were used to examine the specificity and efficiency of the inducible Cre recombinase. We found that Cre was specifically and robustly expressed in the cardiomyocytes at embryonic and adult stages following tamoxifen induction. The knock-in allele on Tnnt2 locus does not impact cardiac function. These results suggest that this new Tnnt2MerCreMer/+ mouse could be applied towards the temporal genetic deletion of genes of interests in cardiomyocytes with Cre-LoxP technology. The Tnnt2MerCreMer/+ mouse model also provides a useful tool to trace myocardial lineage during development and repair after cardiac injury.

Keywords: Tnnt2, MerCreMer, cardiomyocyte, tamoxifen, heart

Introduction

Cre recombinase from bacteriophage P1 recognizes specific 34-bp LoxP sequences and excises LoxP-flanked DNA at high efficiency (Branda and Dymecki, 2004; Sauer and Henderson, 1988). Conditional knockout with Cre-LoxP technology allows inactivation of genes in a tissue-specific manner, and has greatly advanced our knowledge on genes’ function in heart development and disease (Huang et al., 2012; Jiao et al., 2006; Song et al., 2007). To achieve myocardial specific deletion, a number of Cre deleter mouse lines have been created based on the myocardial genes including myosin light chain 2v (MLC2v), cardiac myosin heavy chain (Myh6) and cardiac Troponin T (Tnnt2) (Agah et al., 1997; Chen et al., 1998; Jiao et al., 2003; Moses et al., 2001). However, these Cre lines are not inducible and therefore cannot mediate a temporal genetic deletion at specific stages. Many genes are important for heart development and function at early embryonic and later postnatal stages (Bruneau et al., 2001; Cai et al., 2003; Kuo et al., 1997; Lyons et al., 1995), and inactivation of these genes with straight Cre lines may lead to early lethality, preventing further analyses of their roles at later stages. To overcome embryonic or neonatal lethality, an inducible system allowing temporal inactivation in cardiomyocytes has been developed using a tetracycline-controlled transactivator (tTA) driven by a rat MHC promoter (Fishman et al., 1994), and a reverse tetracycline-controlled transactivator (rtTA) directed by a rat Tnnt2 promoter (Wu et al., 2010). The tetracycline-inducible system requires two independent types of transgenic alleles including transactivator tTA or rtTA, and tetracycline responsive promoter TetO. In this system, administration of tetracycline for induction is water drinking based, and the tTA or ‘‘Tet-off’’ system sometimes does not mediate instant Cre excision (Robbins, 2004).

The inducible Cre recombinases are fusion proteins consisting of Cre recombinase and a specific ligand-binding domain, and can be activated by an exogenous ligand such as tamoxifen (Brocard et al., 1997; Indra et al., 1999; Zhang et al., 1996). Several inducible Cre recombinase mouse lines have been developed including Cre-ERT, Cre-ERT2 and MerCreMer (Brocard et al., 1997; Indra et al., 1999; Zhang et al., 1996). Compared with other inducible Cre recombinases, the MerCreMer system has been demonstrated to be stringent (Verrou et al., 1999). In this study, we report generation of a MerCreMer knock-in mouse line based on the Tnnt2 locus in mice.

RESULTS AND DISCUSSION

Generation and characterization of the Tnnt2MerCreMer /+ knock-in allele

Cardiac troponin T (cTnT or Tnnt2) is the tropomyosin-binding subunit of troponin (Tn) complex in the cardiomyocytes, and it plays a critical role in regulating cardiac muscle contraction by anchoring two other Tn components, troponin I (TnI) and troponin C, to tropomyosin on thin filaments (Lombardi et al., 2008; Nishii et al., 2008). Tnnt2 has been widely recognized as a marker for cardiomyocytes from early embryonic stages to adulthood (Koyanagi et al., 2007; Sato et al., 2004; Walsh et al., 2010). Given this, we decided to make a new inducible Cre mouse line, Tnnt2MerCreMer/+.

To generate this animal, MerCreMer-FRT-Neo-FRT cassette was inserted into the start codon of Tnnt2 through gene targeting (Figure 1A). Long range PCR was performed to screen the targeted ES cells with two pairs of primers (P1/P2 and P3/P4) to detect recombination at 5′ and 3′ arms. 5.5-kb and 4.7-kb DNA fragments were amplified when homologous recombination occurs at 5′ and 3′ ends, respectively (Figure 1B). They were further confirmed by DNA sequencing. Targeted ES cells were expanded and injected into the fertilized mouse eggs to generate chimeras. Offspring from the chimeric mice were analyzed by tail PCR. The Neo cassette flanked by two FRT sites was removed by crossing Tnnt2MerCreMer/+ mice with Flippase deleter mice (Figure 1A) (Farley et al., 2000).

Figure 1. Generation of Tnnt2MerCreMer/+ knock-in mice.

Figure 1

Open in a new tab

(A) Schematic representation of the targeting strategy. MerCreMer-FRT-Neo-FRT cassette was introduced into the Tnnt2 genomic locus (6 bp upstream of the ATG). The Neo cassette is flanked by two FRT sites. Tnnt2MerCreMer-Neo/+ mice were generated from the positive ES cells. Flippase deleter mice were crossed to Tnnt2MerCreMer-Neo/+ mice to remove the Neo cassette. (B) PCR analysis of genomic DNA from the targeted ES cells. Two fragments (5.5-kb/5′ arm and 4.7-kb/3′ arm) were amplified by long range PCR using primers P1 (external to 5′ arm) and P2 (in MerCreMer cassette), P3 (in Neo cassette) and P4 (external to 3′ arm), respectively.

Tnnt2MerCreMer/+ mediates robust and specific recombination in cardiomyocytes after tamoxifen administration

To determine recombination efficiency mediated by Tnnt2MerCreMer/+ allele, the mice were crossed to R26RlacZ/lacZ reporter mice (Soriano, 1999) which express β-galactosidase when the floxed stop cassette is removed . We first performed whole-mount X-gal staining on Tnnt2MerCreMer/+;R26RlacZ/+ doubly heterozygous hearts without tamoxifen treatment at adult stage (3 months old). Very few (less than 3) β-galactosidase expressing cells were detected in the whole heart, indicating very minimal leakage of Cre excision without tamoxifen induction (Supplementary Figure 1).

We next injected tamoxifen intraperitoneally into the pregnant mice at embryonic day (E) 8.5, 10.5, 11.5, 14.5 or 16.5 for two consecutive days (24 hour interval, 0.05 mg/g body weight/day). Embryos or hearts were collected 48 hours later at E10.5, 12.5, 13.5, 16.5 and P0, respectively. With X-gal staining, we detected robust and uniform staining in the hearts, suggesting tamoxifen treatment was sufficient to initiate Cre-mediated recombination driven by Tnnt2 at embryonic stages (Figure 2A-E). We also detected robust β-galactosidase expression in the postnatal heart at P30 and P60 after three times of tamoxifen injections (Figure 2F,G, 0.1 mg/g body weight/day). Further transverse sections of the hearts showed that X-gal staining was confined to the atrial and ventricular wall as well as the septum (notched arrows in Figure 2C-G), but was not in the aorta and pulmonary artery (arrowheads in Figure 2D1/E1/F1/G1), or valves (unnotched arrows in Figure 2D4/E4/F4/G4). These suggest that the Tnnt2MerCreMer/+ mouse line efficiently introduces recombination in the heart from embryonic stage to adulthood.

Figure 2. Tnnt2MerCreMer/+ drives efficient Cre recombination in hearts.

Figure 2

Open in a new tab

Tnnt2MerCreMer/+ mice were crossed to R26RlacZ/lacZ mice to trace Tnnt2 progeny (Tnnt2MerCreMer/+;R26RlacZ/+). X-gal staining shows β-galactosidase expression in the embryonic and postnatal hearts at E10.5-P60 after tamoxifen induction. Notched arrows indicate positive staining (cardiomyocytes). Arrowheads in D1/E1/F1/G1 indicate pulmonary artery. Unnotched arrows in D4/E4/F4/G4 indicate valves. C2/D3/E3/F3/G3 are high magnification images for C1/D2/E2/F2/G2 in areas labelled by asterisks. RA, right atrium; LA, left atrium; RV, right ventricle; LV, left ventricle; PA, pulmonary artery; VS, ventricular septum.

We then applied R26RtdTomato/tdTomato mice (Madisen et al., 2010) to examine cell types with recombination after tamoxifen induction. Consistent with the X-gal staining, we found tdTomato was also robustly expressed in the heart at E16.5, P0, P30 and P60 after 24 hours of tamoxifen induction (Figure 3A). Further immunostaining with antibody against Tnnt2 (a marker for cardiomyocytes), αSMA (a marker for vascular smooth muscle cells) and PECAM (a marker for vascular endothelial and endocardial cells) (Hungerford et al., 1996; Mack and Owens, 1999) showed that tdTomato is co-localized with anti-Tnnt2 (notched arrows in Figure 3B-E), but not co-expressed with anti-αSMA or anti-PECAM in the coronary smooth muscle or endothelial/endocardial cells (unnotched arrows in Figure 3 F-I) from embryonic (E16.5) to adult stages (P60). tdTomato was not detected in the epicardial layer (arrowheads in Figure 3 F4). These observations suggested that Tnnt2MerCreMer/+ allele introduces specific recombination in the cardiomyocytes.

Figure 3. Tnnt2MerCreMer/+ directs specific recombination in cardiomyocytes.

Figure 3

Open in a new tab

tdTomato expression in Tnnt2MerCreMer/+;R26RtdTomato/+ hearts after tamoxifen induction. Images in A1-4 show whole-mount views of hearts at E16.5, P0, P30 and P60, respectively. B-I are transverse sections of hearts with co-immunostaining with antibodies to Tnnt2 (B-E), αSMA (F,G) and PECAM (H,I). tdTomato-expressing cells are cardiomyocytes (co-expressed with Tnnt2, B-E), and are not coronary smooth muscle cells (not co-localized with αSMA, F,G) or endocardial/endothelial cells (not co-localized with PECAM, H,I). Notched arrows in B-E indicate Tnnt2 antibody staining. Unnotched arrows in F,G indicate αSMA antibody staining. Unnotched arrows in H/I indicate PECAM antibody staining in endocardial/endothelial cells. Arrowheads in F4 indicate epicardial layer. B4, C4, D4, E4, F4 and G4 are overlay images for B1/2/3, C1/2/3, D1/2/3, E1/2/3, F1/2/3 and G1/2/3, respectively. H1/I1 are PECAM staining and H2/I2 are merged images of DAPI/tdTomato/PECAM at P60.

Tnnt2MerCreMer/+ mice have normal cardiac structure and function

Tnnt2MerCreMer/+ is a heterozygous null allele for Tnnt2 and homozygous null animals (Tnnt2MerCreMer/MerCreMer) cannot survive beyond E10.5 with heart development defects. To assess the potential derangements in cardiac structure or function with heterozygous deletion of Tnnt2, male and female Tnnt2MerCreMer/+ mice were subjected to transthoracic echocardiography (n=11 for both wild type and Tnnt2MerCreMer/+ mice). We found Tnnt2MerCreMer/+ mice had normal left ventricular wall thickness, internal dimensions, and function when compared to the wild type littermate controls at 2–4 months old (Supplementary Table 1), and no difference were found between male and female animals (data not shown). Representative M-mode images from Tnnt2MerCreMer/+ and wild type mice are shown in Figure 4 A. These results are in agreement with previous reports demonstrating normal cardiac indices in mice haploinsufficient for Tnnt2 (Ahmad et al., 2008; Nishii et al., 2008).

Figure 4. Normal left ventricular function and dimensions after Cre induction in Tnnt2MerCreMer/+ mice.

Figure 4

Open in a new tab

Tamoxifen was administered at 0.1 mg/g body weight/day for three days. (A) Representative M-mode echocardiography images of Tnnt2MerCreMer/+ and wild type controls five weeks after tamoxifen treatment. (B) Cre induction does not result in any cardiac function or structural changes between genotypes or treatment groups. TMX, Tamoxifen; EF, ejection fraction; LVID, left ventricular internal diameter; LVAW, left ventricular anterior wall; LVPW, left ventricular posterior wall. All values were plotted as mean ± STDEV.

Several reports showed that the myocardial inducible Cre mouse model αMHC-MerCreMer (Sohal et al., 2001) had DNA damage with heart failure and even death at moderate to high dosage of tamoxifen administration (Bersell et al., 2013; Buerger et al., 2006; Hall et al., 2011; Hougen et al., 2010; Koitabashi et al., 2009; Lexow et al., 2013; Molkentin and Robbins, 2009). Specifically, three days/doses of tamoxifen administration at 0.03–0.09 mg /g body weight/day to the adult αMHC-MerCreMer mice resulted in 10–50% mortality within 1 week. The surviving animals displayed significant myocardial fibrosis and cardiac dysfunction within one month. High level Cre expression on αMHC-MerCreMer mice also leads to myocardial apoptosis within two weeks after injection (Bersell et al., 2013; Lexow et al., 2013). As a comparison, we evaluated cardiac tissue health, structure, and function on Tnnt2MerCreMer/+ mice (n=4, 2–3 months old) with wild type littermates (n=5, 2–3 months old) after three doses of tamoxifen at 0.1 mg/g body weight/day. We found that Tnnt2MerCreMer/+ mice did not display significant changes in myocardial apoptosis, fibrosis, wall thickness or cardiac function using transthoracic echocardiography within 1–5 weeks after tamoxifen administration (Figures 4 and 5, and Supplementary Table 1), suggesting Cre expression in Tnnt2MerCreMer/+ mice did not result in cardiotoxic effects with the dosage used in our study. The difference between αMHC-MerCreMer and Tnnt2MerCreMer/+ animals in response to tamoxifen might be due to the number of MerCreMer copies in their genome: αMHC-MerCreMer is a transgenic line that may contain multiple copies of MerCreMer in each myocardial cell, whereas Tnnt2MerCreMer/+ is a knock-in line where only one copy of MerCreMer is present in each myocardial cell. Therefore, Cre expression and nuclear translocation in the cardiomyocytes of αMHC-MerCreMer mice might be much higher than that of Tnnt2MerCreMer/+ animals with moderate to high dosage of tamoxifen.

Figure 5. Tamoxifen induction does not cause myocardial apoptosis or fibrosis in Tnnt2MerCreMer/+ mice.

Figure 5

Open in a new tab

TUNEL and trichrome staining were performed on R26RtdTomato/+ and Tnnt2MerCreMer/+;R26RtdTomato/+ hearts after tamoxifen administration. (A,B) A few apoptotic cells were observed on both R26RtdTomato/+ and Tnnt2MerCreMer/+;R26RtdTomato/+ hearts (arrows) after one week (P67). (C,D) The injection leads to sufficient excision on Tnnt2MerCreMer/+;R26RtdTomato/+ hearts, but not on R26RtdTomato/+ hearts when Tnnt2MerCreMer/+ is not present. (E-H) Cardiac fibrosis was not detected by trichrome staining on R26RtdTomato/+ and Tnnt2MerCreMer/+;R26RtdTomato/+ hearts after one (E,F) and five weeks (G,H, P95) of injection.

In summary, we generated a new inducible Tnnt2MerCreMer/+ knock-in mouse model that allows temporal genetic deletion of genes of interest in the cardiomyocytes from embryonic stages to adulthood, providing a valuable tool to dissect functions of genes in cardiomyocytes at specific developmental time points. The Tnnt2MerCreMer/+ mice with R26R reporter alleles are also very useful genetic tool to trace myocardial progeny during heart development as well as regeneration after cardiac injury.

MATERIALS AND METHODS

Generation of the Tnnt2MerCreMer/+ knock-in mouse line

Tnnt2MerCreMer/+ knock-in mice were generated by inserting MerCreMer-FRT-Neo-FRT cassette into the start codon of Tnnt2 locus, with disruption of endogenous ATG. Long range PCR was applied to screen the targeted ES cells using Expand Long Range dNTPack kit (Roche Cat # 04829042001) following the manufacturer’s instructions. PCR program consisted of an initial denaturation of 2 min at 92°C, 42 cycles of reactions (92 °C for 10 s; 60 °C for 15 s, 68 °C for 4 min), and a final elongation of 10 min at 68 °C. The primers used for long range PCR were: P1: CAGTCCCTGTTCAGAGGTAAGACA; P2: CTCTTCTTCTTGGGCATGGTCTGC; P3: GCGAGCACGTACTCGGATGGAAGC; P4: GTGACAGGACATCAAGACTCACTG. PCR fragments from the targeted ES cells were confirmed by DNA sequencing. Positive ES cells carrying the recombinant allele were injected into blastocysts to generate chimera mice. Tnnt2MerCreMer-Neo/+ mice were obtained by crossing male chimeras with Black Swiss female mice. The animal model is available to the research community upon request.

Animal breeding and tamoxifen administration

Rosa26:lacZ (R26RlacZ/lacZ) (Soriano, 1999) and Rosa26:tdTomato (R26RtdTomato/tdTomato) (Madisen et al., 2010) reporter mice were obtained from the Jackson Laboratory. Tnnt2MerCreMer/+ mice were bred with Rosa26 reporter mice to generate double heterozygous animals (Tnnt2MerCreMer/+;R26RlacZ/+ and Tnnt2MerCreMer/+;R26RtdTomato/+). Tamoxifen (Sigma-Aldrich) was dissolved in sesame oil at 10 mg/ml as stock solution. To induce Cre nuclear translocation, tamoxifen was administered to mice by intraperitoneal (IP) injection for two consecutive days (24 hours interval between each administration) at 0.05 mg/g body weight/day for embryonic stages, and 0.1 mg/g body weight/day for three consecutive days (or day 1, 3, 5) for adulthood. 24 hours later after the last injection, tissues were harvested for analysis. Mouse husbandry was carried out according to the protocol approved by the Institutional Animal Care and Use Committee (IACUC) at Icahn School of Medicine at Mount Sinai.

X-gal and Trichrome staining

Mouse embryos or hearts were fixed in 4% paraformaldehyde for 30 min on ice, washed twice with PBS and then stained with X-gal solution (5 mM Potassium Ferricyanide, 5 mM Potassium Ferrocyanide, 2 mM MgCl2, 1 mg/ml X-gal) overnight at room temperature. The tissues were washed twice with PBS, followed by photography with a Leica stereomicroscope. To examine β-galactosidase activity inside the heart, frozen cardiac samples were cryosectioned into 10 μm in thickness followed by X-gal staining at 37°C overnight and counterstained with eosin. Trichrome staining to determine cardiac fibrosis was performed with a Masson kit (Sigma-Aldrich, HT15) following the manufacturer’s instructions on cryosections.

Immunofluorescence

Mouse hearts were fixed in 4% paraformaldehyde on ice for 30 min and rinsed with PBS. Tissues were soaked in 30% sucrose and then embedded in Optimal Cutting Temperature compound (Tissue-Tek) on dry ice. Frozen samples were cut into 6 μm in thickness. Mouse anti-Troponin T (1:200, Thermo scientific), anti-αSMA (1:100, Sigma) and anti-PECAM (1:100, BD Biosciences) antibodies were used in this study. Alexa Flour 488 conjugated secondary antibodies (1:500, Invitrogen) were applied to detect primary antibodies.

Echocardiography and data analysis

Transthoracic echocardiography was performed using the Vevo 2100 high-resolution ultrasound imaging system with a real-time 30MHz linear array scanhead (MS400) at a frame rate of 235fps, a focal length of 8 mm, and a 10x10-mm field of view (Visualsonics; Toronto, Canada). Mice were anesthetized with 2% isofluorane, and hair was removed from the chest using a depilatory cream (Nair; Church & Dwight Co, Inc; Princeton, NJ). Warmed ultrasound transmission gel was placed on the chest and used to obtain left ventricular endpoints of cardiac function. B-mode cardiac imaging was conducted on transverse (short axis) plane. The papillary muscles were used for the short axis imaging landmark. M-mode recordings of the left ventricle were also recorded at the short axis B-mode imaging plane to obtain left ventricular function and dimensions through the cardiac cycle. Heart rate was monitored and core body temperature was maintained at 37°C using a heated platform and a hair dryer throughout the procedure. Data analysis was performed on VisualSonics Vevo 2100 V1.5.0 software (Visualsonics; Toronto, Canada). The following parameters were measured using short axis M-mode: diastolic and systolic left ventricular internal diameter (LVID), anterior wall thickness (LVAW), and posterior wall thickness (LVPW). From these measurements, left ventricular ejection fraction (LVEF) and percent fractional shortening (LVFS) were calculated within the Vevo software. Mean and standard deviation were reported for each group. Endpoints were compared using Sidak 1-way ANOVA. P<0.05 was considered statistically significant. All micro-ultrasound data analysis was conducted by 2 operators blinded to the experimental groups.

Supplementary Material

Supp FigureS1. Supplementary Figure 1. Tnnt2MerCreMer/+ mice minimally mediate recombination without induction.

Very few X-gal positive cells were detected on Tnnt2MerCreMer/+;R26RlacZ/+ hearts by X-gal staining without tamoxifen. (A) No X-gal positive cells were found from the anterior view. (B) Arrowhead indicates a single X-gal positive cell from the posterior view of the heart at 3 months old.

Supp TableS1

ACKNOWLEDGMENTS

The authors thank Dr. Kevin Kelly in the Transgenic Core at Mount Sinai for his help in generating Tnnt2MerCreMer/+ mouse. This work is supported by grants to C.L.C. from the the NHLBI (1R01HL095810 and 1K02HL094688), NYSTEM (C026426), the American Heart Association (0855808D) and the March of Dimes Foundation (5-FY07-642), and to A.S. from NIH T32 GM066704 (Bach).

Footnotes

Disclosures: None.

LITERATURE CITED

  1. Agah R, Frenkel PA, French BA, Michael LH, Overbeek PA, Schneider MD. Gene recombination in postmitotic cells. Targeted expression of Cre recombinase provokes cardiac-restricted, site-specific rearrangement in adult ventricular muscle in vivo. J Clin Invest. 1997;100:169–179. doi: 10.1172/JCI119509. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Ahmad F, Banerjee SK, Lage ML, Huang XN, Smith SH, Saba S, Rager J, Conner DA, Janczewski AM, Tobita K, Tinney JP, Moskowitz IP, Perez-Atayde AR, Keller BB, Mathier MA, Shroff SG, Seidman CE, Seidman JG. The role of cardiac troponin T quantity and function in cardiac development and dilated cardiomyopathy. PLoS One. 2008;3:e2642. doi: 10.1371/journal.pone.0002642. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bersell K, Choudhury S, Mollova M, Polizzotti BD, Ganapathy B, Walsh S, Wadugu B, Arab S, Kuhn B. Moderate and high amounts of tamoxifen in alphaMHC-MerCreMer mice induce a DNA damage response, leading to heart failure and death. Dis Model Mech. 2013;6:1459–1469. doi: 10.1242/dmm.010447. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Branda CS, Dymecki SM. Talking about a revolution: The impact of site-specific recombinases on genetic analyses in mice. Dev Cell. 2004;6:7–28. doi: 10.1016/s1534-5807(03)00399-x. [DOI] [PubMed] [Google Scholar]
  5. Brocard J, Warot X, Wendling O, Messaddeq N, Vonesch JL, Chambon P, Metzger D. Spatio-temporally controlled site-specific somatic mutagenesis in the mouse. Proc Natl Acad Sci U S A. 1997;94:14559–14563. doi: 10.1073/pnas.94.26.14559. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bruneau BG, Nemer G, Schmitt JP, Charron F, Robitaille L, Caron S, Conner DA, Gessler M, Nemer M, Seidman CE, Seidman JG. A murine model of Holt-Oram syndrome defines roles of the T-box transcription factor Tbx5 in cardiogenesis and disease. Cell. 2001;106:709–721. doi: 10.1016/s0092-8674(01)00493-7. [DOI] [PubMed] [Google Scholar]
  7. Buerger A, Rozhitskaya O, Sherwood MC, Dorfman AL, Bisping E, Abel ED, Pu WT, Izumo S, Jay PY. Dilated cardiomyopathy resulting from high-level myocardial expression of Cre-recombinase. J Card Fail. 2006;12:392–398. doi: 10.1016/j.cardfail.2006.03.002. [DOI] [PubMed] [Google Scholar]
  8. Cai CL, Liang X, Shi Y, Chu PH, Pfaff SL, Chen J, Evans S. Isl1 identifies a cardiac progenitor population that proliferates prior to differentiation and contributes a majority of cells to the heart. Dev Cell. 2003;5:877–889. doi: 10.1016/s1534-5807(03)00363-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Chen J, Kubalak SW, Chien KR. Ventricular muscle-restricted targeting of the RXRalpha gene reveals a non-cell-autonomous requirement in cardiac chamber morphogenesis. Development. 1998;125:1943–1949. doi: 10.1242/dev.125.10.1943. [DOI] [PubMed] [Google Scholar]
  10. Farley FW, Soriano P, Steffen LS, Dymecki SM. Widespread recombinase expression using FLPeR (flipper) mice. Genesis. 2000;28:106–110. [PubMed] [Google Scholar]
  11. Fishman GI, Kaplan ML, Buttrick PM. Tetracycline-regulated cardiac gene expression in vivo. J Clin Invest. 1994;93:1864–1868. doi: 10.1172/JCI117174. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Hall ME, Smith G, Hall JE, Stec DE. Systolic dysfunction in cardiac-specific ligand-inducible MerCreMer transgenic mice. Am J Physiol Heart Circ Physiol. 2011;301:H253–H260. doi: 10.1152/ajpheart.00786.2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Hougen K, Aronsen JM, Stokke MK, Enger U, Nygard S, Andersson KB, Christensen G, Sejersted OM, Sjaastad I. Cre-loxP DNA recombination is possible with only minimal unspecific transcriptional changes and without cardiomyopathy in Tg(alphaMHC-MerCreMer) mice. Am J Physiol Heart Circ Physiol. 2010;299:H1671–H1678. doi: 10.1152/ajpheart.01155.2009. [DOI] [PubMed] [Google Scholar]
  14. Huang J, Elicker J, Bowens N, Liu X, Cheng L, Cappola TP, Zhu X, Parmacek MS. Myocardin regulates BMP10 expression and is required for heart development. J Clin Invest. 2012;122:3678–3691. doi: 10.1172/JCI63635. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Hungerford JE, Owens GK, Argraves WS, Little CD. Development of the aortic vessel wall as defined by vascular smooth muscle and extracellular matrix markers. Dev Biol. 1996;178:375–392. doi: 10.1006/dbio.1996.0225. [DOI] [PubMed] [Google Scholar]
  16. Indra AK, Warot X, Brocard J, Bornert JM, Xiao JH, Chambon P, Metzger D. Temporally-controlled site-specific mutagenesis in the basal layer of the epidermis: comparison of the recombinase activity of the tamoxifen-inducible Cre-ERT) and Cre-ERT2) recombinases. Nucleic Acids Res. 1999;27:4324–4327. doi: 10.1093/nar/27.22.4324. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Jiao K, Kulessa H, Tompkins K, Zhou Y, Batts L, Baldwin HS, Hogan BL. An essential role of Bmp4 in the atrioventricular septation of the mouse heart. Genes Dev. 2003;17:2362–2367. doi: 10.1101/gad.1124803. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Jiao K, Langworthy M, Batts L, Brown CB, Moses HL, Baldwin HS. Tgfbeta signaling is required for atrioventricular cushion mesenchyme remodeling during in vivo cardiac development. Development. 2006;133:4585–4593. doi: 10.1242/dev.02597. [DOI] [PubMed] [Google Scholar]
  19. Koitabashi N, Bedja D, Zaiman AL, Pinto YM, Zhang M, Gabrielson KL, Takimoto E, Kass DA. Avoidance of transient cardiomyopathy in cardiomyocyte-targeted tamoxifen-induced MerCreMer gene deletion models. Circ Res. 2009;105:12–15. doi: 10.1161/CIRCRESAHA.109.198416. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Koyanagi M, Bushoven P, Iwasaki M, Urbich C, Zeiher AM, Dimmeler S. Notch signaling contributes to the expression of cardiac markers in human circulating progenitor cells. Circ Res. 2007;101:1139–1145. doi: 10.1161/CIRCRESAHA.107.151381. [DOI] [PubMed] [Google Scholar]
  21. Kuo CT, Morrisey EE, Anandappa R, Sigrist K, Lu MM, Parmacek MS, Soudais C, Leiden JM. GATA4 transcription factor is required for ventral morphogenesis and heart tube formation. Genes Dev. 1997;11:1048–1060. doi: 10.1101/gad.11.8.1048. [DOI] [PubMed] [Google Scholar]
  22. Lexow J, Poggioli T, Sarathchandra P, Santini MP, Rosenthal N. Cardiac fibrosis in mice expressing an inducible myocardial-specific Cre driver. Dis Model Mech. 2013;6:1470–1476. doi: 10.1242/dmm.010470. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Lombardi R, Bell A, Senthil V, Sidhu J, Noseda M, Roberts R, Marian AJ. Differential interactions of thin filament proteins in two cardiac troponin T mouse models of hypertrophic and dilated cardiomyopathies. Cardiovasc Res. 2008;79:109–117. doi: 10.1093/cvr/cvn078. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Lyons I, Parsons LM, Hartley L, Li R, Andrews JE, Robb L, Harvey RP. Myogenic and morphogenetic defects in the heart tubes of murine embryos lacking the homeo box gene Nkx2-5. Genes Dev. 1995;9:1654–1666. doi: 10.1101/gad.9.13.1654. [DOI] [PubMed] [Google Scholar]
  25. Mack CP, Owens GK. Regulation of smooth muscle alpha-actin expression in vivo is dependent on CArG elements within the 5' and first intron promoter regions. Circ Res. 1999;84:852–861. doi: 10.1161/01.res.84.7.852. [DOI] [PubMed] [Google Scholar]
  26. Madisen L, Zwingman TA, Sunkin SM, Oh SW, Zariwala HA, Gu H, Ng LL, Palmiter RD, Hawrylycz MJ, Jones AR, Lein ES, Zeng H. A robust and high-throughput Cre reporting and characterization system for the whole mouse brain. Nat Neurosci. 2010;13:133–140. doi: 10.1038/nn.2467. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Molkentin JD, Robbins J. With great power comes great responsibility: using mouse genetics to study cardiac hypertrophy and failure. J Mol Cell Cardiol. 2009;46:130–136. doi: 10.1016/j.yjmcc.2008.09.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Moses KA, DeMayo F, Braun RM, Reecy JL, Schwartz RJ. Embryonic expression of an Nkx2-5/Cre gene using ROSA26 reporter mice. Genesis. 2001;31:176–180. doi: 10.1002/gene.10022. [DOI] [PubMed] [Google Scholar]
  29. Nishii K, Morimoto S, Minakami R, Miyano Y, Hashizume K, Ohta M, Zhan DY, Lu QW, Shibata Y. Targeted disruption of the cardiac troponin T gene causes sarcomere disassembly and defects in heartbeat within the early mouse embryo. Dev Biol. 2008;322:65–73. doi: 10.1016/j.ydbio.2008.07.007. [DOI] [PubMed] [Google Scholar]
  30. Robbins J. Genetic modification of the heart: exploring necessity and sufficiency in the past 10 years. J Mol Cell Cardiol. 2004;36:643–652. doi: 10.1016/j.yjmcc.2004.02.012. [DOI] [PubMed] [Google Scholar]
  31. Sato Y, Kita T, Takatsu Y, Kimura T. Biochemical markers of myocyte injury in heart failure. Heart. 2004;90:1110–1113. doi: 10.1136/hrt.2003.023895. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Sauer B, Henderson N. Site-specific DNA recombination in mammalian cells by the Cre recombinase of bacteriophage P1. Proc Natl Acad Sci U S A. 1988;85:5166–5170. doi: 10.1073/pnas.85.14.5166. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Sohal DS, Nghiem M, Crackower MA, Witt SA, Kimball TR, Tymitz KM, Penninger JM, Molkentin JD. Temporally regulated and tissue-specific gene manipulations in the adult and embryonic heart using a tamoxifen-inducible Cre protein. Circ Res. 2001;89:20–25. doi: 10.1161/hh1301.092687. [DOI] [PubMed] [Google Scholar]
  34. Song L, Yan W, Chen X, Deng CX, Wang Q, Jiao K. Myocardial smad4 is essential for cardiogenesis in mouse embryos. Circ Res. 2007;101:277–285. doi: 10.1161/CIRCRESAHA.107.155630. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Soriano P. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat Genet. 1999;21:70–71. doi: 10.1038/5007. [DOI] [PubMed] [Google Scholar]
  36. Verrou C, Zhang Y, Zurn C, Schamel WW, Reth M. Comparison of the tamoxifen regulated chimeric Cre recombinases MerCreMer and CreMer. Biol Chem. 1999;380:1435–1438. doi: 10.1515/BC.1999.184. [DOI] [PubMed] [Google Scholar]
  37. Walsh S, Ponten A, Fleischmann BK, Jovinge S. Cardiomyocyte cell cycle control and growth estimation in vivo--an analysis based on cardiomyocyte nuclei. Cardiovasc Res. 2010;86:365–373. doi: 10.1093/cvr/cvq005. [DOI] [PubMed] [Google Scholar]
  38. Wu B, Zhou B, Wang Y, Cheng HL, Hang CT, Pu WT, Chang CP, Zhou B. Inducible cardiomyocyte-specific gene disruption directed by the rat Tnnt2 promoter in the mouse. Genesis. 2010;48:63–72. doi: 10.1002/dvg.20573. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Zhang Y, Riesterer C, Ayrall AM, Sablitzky F, Littlewood TD, Reth M. Inducible site-directed recombination in mouse embryonic stem cells. Nucleic Acids Res. 1996;24:543–548. doi: 10.1093/nar/24.4.543. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supp FigureS1. Supplementary Figure 1. Tnnt2MerCreMer/+ mice minimally mediate recombination without induction.

Very few X-gal positive cells were detected on Tnnt2MerCreMer/+;R26RlacZ/+ hearts by X-gal staining without tamoxifen. (A) No X-gal positive cells were found from the anterior view. (B) Arrowhead indicates a single X-gal positive cell from the posterior view of the heart at 3 months old.

NIHMS693795-supplement-Supp_FigureS1.tif (6.6MB, tif)
Supp TableS1
NIHMS693795-supplement-Supp_TableS1.docx (25.9KB, docx)

RESOURCES