Skip to main content
Emerging Infectious Diseases logoLink to Emerging Infectious Diseases
. 2015 Jul;21(7):1234–1236. doi: 10.3201/eid2107.141980

Geographic Range Expansion for Rat Lungworm in North America

Emily M York 1,✉, James P Creecy 1, Wayne D Lord 1, William Caire 1
PMCID: PMC4480392  PMID: 26079818

Abstract

Using quantitative PCR analysis and DNA sequencing, we provide evidence for the presence of rat lungworm (Angiostrongylus cantonensis) in Oklahoma, USA, and identified a potentially novel rat host (Sigmodon hispidus). Our results indicate a geographic range expansion for this medically and ecologically relevant parasite in North America.

Keywords: real-time PCR, quantitative PCR, Sigmodon hispidus, hispid cotton rat, zoonoses, rat lungworm, Angiostrongylus cantonensis, Parastrongylus cantonensis, geographic range expansion, parasites, Oklahoma, Louisiana, United States


Emerging infectious diseases negatively impact humans and wildlife, causing disease outbreaks and deaths and local and global extinctions (1). Zoonotic disease emergence or re-emergence results from numerous factors (e.g., globalization of trade, increased interaction of humans and animals, anthropogenic climate change) that function independently or synergistically (2,3). Consequently, the means by which parasitic zoonoses are studied must be constantly advanced to promote identification, control, and prevention of outbreaks.

The rat lungworm, Angiostrongylus (Parastrongylus) cantonensis, causes eosinophilic meningitis in humans (4) and various disease manifestations (meningoencephalitis, neurologic disorders) in atypical host species, including wildlife and captive animals (5). Transmission of these worms occurs by ingestion of third-stage larvae in raw or undercooked intermediate or paratenic hosts (6). Although variable among geographic regions and within host species, the prevalence of rat lungworms might be high under favorable conditions (7).

The occurrence of A. cantonensis rat lungworms has been documented worldwide, and its distribution has been attributed largely to the spread of intermediate molluscan host species (e.g., Achantina fulica) and definitive rodent host species (e.g., Rattus spp.) (8). Moreover, host specificity of rat lungworms is highly plastic, which contributes to its continuous geographic expansion (4). These factors indicate that the rat lungworm is an emerging zoonotic pathogen of concern to humans and wildlife, and therefore provides an excellent opportunity to evaluate the sensitivity and effectiveness of epidemiologic surveying techniques.

The Study

We evaluated the current distribution and potential spread of the rat lungworm within areas of the Gulf Coast region and midwestern United States by sampling rodent populations in regions of Louisiana and Oklahoma that were predicted by an ecologic niche model to contain suitable and unsuitable habitat (9). We used a quantitative PCR (qPCR) TaqMan assay (Life Technologies, Foster City, CA, USA) (10) to test for the parasite in tissue samples and further evaluated these samples through DNA sequencing analysis.

We trapped animals during the spring, summer, and fall months during 2010–2012. A total of 43 rodents and 3 shrews were collected from McCurtain County in southeastern Oklahoma, and 42 rodents were collected in Louisiana (Technical Appendix). We also obtained 56 Rattus norvegicus rat brain and lung tissue samples from the City of New Orleans Mosquito, Termite, and Rodent Control Board. Blood, lung, and brain tissue samples were collected from the rodents. Flotation was performed on all 148 lung samples, and all samples were negative for adult A. cantonensis rat lungworms.

Known adult rat lungworms were used as controls for molecular analyses (Technical Appendix). Cellular DNA was extracted from rodent blood and brain samples. We tested for rat lungworm internal transcribed spacer 1 (ITS1) DNA by using a TaqMan qPCR on an ABI 7500 system (10). A total of 134 blood samples and 137 brain samples contained DNA suitable for analysis. After qPCR, 34 of the 271 total tissue samples were classified as putatively positive for rat lungworm and sequenced, generating a 267-bp fragment of the ITS1 region (Technical Appendix).

On the basis of DNA sequencing, 3 brain samples were identified as containing A. cantonensis DNA (GenBank accession nos. KP231729, KP231728, and KP231727). These brain tissue samples were obtained from 3 rodents (host catalog nos. 32, 70, and 76), which were identified as 1 Hispid cotton rat (Sigmodon hispidus) and 2 brown rats (Rattus norvegicus), respectively (Table 1). A comparison of the 3 brain samples with those in GenBank by BLAST analysis (http://blast.ncbi.nlm.nih.gov/Blast.cgi) showed a match with rat lungworm (GenBank accession nos. GU587762.1 and GU587759.1) (Table 2).

Table 1. DNA sequences generated from 3 rat brain samples positive for Angiostrongylus cantonensis rat lungworms, United States*.

Rat host species Trapping location Host catalog no. Sequence, 5′→3′
Sigmodon hispidus Red Slough WMA, OK 32 TTCATGGATGGCGAACTGATAGTATCATCGCATATCTACTATACGCATGTGACACCTGATTGACAGGAAATCTTAATGACCCAAGTATAATGTTTCAATGGGCGCCAACGTAGCAACAGAACAGTTTTTCACACGTGAAAATGTGGAACGAGATACACAGGATGtatatataTATATATATATATATACACATATATRTGTGTRTGGAAATAGATATACTAKCTTCAGMGAKGRWKCGSGYGATTCGCGTATCTAAGAAAAACACA
Rattus norvegicus New Orleans, LA 70 TTCATGGATGGCGAACTGATAGTGTCATCGCATATCTACTATACGCATGTGACACCTGATTGACAGGAAATCTTAATGACCCAAGTATAATGTTTCAATGGGCGCCAACGTAGCAACAGAACAGTTTTTCTACACGTGAAAATGTGGAACGAGATACACAGGATGTATATATATATATATATACACATATATATGTGTATGGAAATTGATATACTAGCTTCAGCGATGGATCGGTCGATTCGCGTATCGATGAAAAACGCATCTA
Rattus norvegicus New Orleans, LA 76 TTCATGGATGGCGAACTGATAGTATCATCGCATATCTACTATACGCATGTGACACCTGATTGACAGGAAATCTTAATGACCCAAGTATAATGTTTCAATGGGCGCCAACGTAGCAACAGAACAGTTTTTCTACACGTGAAAATGTGGAACGAGATACACAGGATGTATATATATATATATATACACATATATATGTGTATGGAAATTGATATACTAGCTTCAGCGATGGATCGGTCGATTCGCGTATCGATGAAAAACGCAGCTA

*WMA, wildlife management area.

Table 2. BLAST* results for sequences from 3 rat brain samples, United States†.

Host catalog no. Rat host species Trapping location Match, % Coverage, % e value
32 Sigmodon hispidus Red Slough WMA, OK 92 98 5 × 10–105
70 Rattus norvegicus New Orleans, LA 99 100 3 × 10–130
76 R. norvegicus New Orleans, LA 99 100 1 × 10–133

*http://blast.ncbi.nlm.nih.gov/Blast.cgi
†WMA, wildlife management area.

All sequences were aligned by using MUSCLE in MEGA 5.2 (http://www.megasoftware.net/), manually inspected for consensus, and compared with the 267-bp fragment generated from the known sample of rat lungworm. Maximum-likelihood phylogenetic analysis was performed by using sequence data for the ITS1 region of A. cantonensis (GenBank accession no. GU587759.1), 2 closely related species, A. vasorum (the French heartworm, GU733324.1) and A. costaricensis (a parasitic nematode, (GU587745.1), and sequences obtained from the rodent hosts. Maximum-likelihood phylogenetic analysis grouped sequences from rat hosts 32, 70, and 76 with A. cantonensis with high bootstrap support (Figure).

Figure.

Figure

Maximum-likelihood bootstrap consensus phylogenetic tree showing the relationship between rat lungworm sequences generated in this study and other Angiostrongylus spp., United States. Tree was generated by using a Tamura 3-parameter model. Value along the branch is a bootstrap value.

Conclusions

Because the rat lungworm poses a major health risk to humans and wildlife worldwide, more work is needed to shed light on the location, dispersal, and influence of this parasite in new geographic regions. Although previous reports document rat lungworms in the Gulf Coast region of the United States (5,11), little is understood regarding their prevalence within definitive hosts and their dispersal throughout the southeastern United States. As expected, our analysis indicated that R. norvegicus rats from Louisiana harbored rat lungworms. Positive samples were collected from densely populated areas with high tourist activity, thereby increasing the risk for transmission to humans. Moreover, rat lungworms were identified outside their known habitat and in a new rat host species (S. hispidus) in Oklahoma, an area predicted to lack suitable habitat for the parasite (9). Our results provide a new perspective on the distribution of rat lungworms in the United States and indicate a northward range expansion that substantially increases the risk for disease spread within humans and wildlife.

Because endemic and novel pathogens require different and highly specialized disease management strategies, it is crucial to determine whether a pathogen is novel or endemic (12). Previous work has described the A. cantonensis rat lungworm as a novel pathogen in the southeastern United States. However, it is now characterized as endemic to this region, and our results strongly support this notion (11). Such changes in epidemiologic classification of rat lungworms accentuate the need for techniques that monitor the extent to which parasites infiltrate new geographic areas and potentially pose threats to humans and native wildlife. One such threat includes an increasing prevalence of angiostrongyliasis, which should receive increased scrutiny in patients with eosinophilic meningitis from localities characterized by paratenic and intermediate hosts.

Rat lungworm was found in a previously undocumented mammalian host, S. hispidus rats, which strongly suggests that this parasite is an endemic pathogen. Although vegetation is their primary food source, S. hispidus rats will eat invertebrates (13). Whether these rats directly (by intentional consumption of host) or indirectly (by consumption of host or free third-stage larvae on vegetation) consume the parasite, we cannot rule out the possibility that acquisition of the parasite could occur in this species and enable further range expansion for rat lungworms. S. hispidus rats are a known host for another closely related Angiostrongylus species, A. costaricensis, which lends additional support for the notion that S. hispidus rats might act as a host for rat lungworms. Alternatively, S. hispidus rats might simply be an accidental/dead end host for this parasite. Although wildlife might become infected with the parasite, not all wildlife are definitive hosts (5,11). Additional field and laboratory studies will clarify the role that S. hispidus rats play in the spread of the rat lungworm.

Because many terrestrial species remain taxonomically nondescribed, there is strong potential for continual emergence of unknown pathogens worldwide (14). Global travel, human encroachment into wildlife habitat, and climate change will influence distribution and emergence of disease (2,15). By incorporating field epidemiology with molecular genetic techniques to determine the geographic distribution of pathogens, major advances can be made in preventing the spread of wildlife diseases to human populations. Our results illustrate this point and highlight the need for future work to incorporate and refine these techniques and their application to epidemiology and wildlife disease surveillance.

Technical Appendix. Additional details on geographic range expansion for rat lungworm in North America.

14-1980-Techapp-s1.pdf (41.8KB, pdf)

Acknowledgments

We thank Joshua York, Erica Judd, Elizabeth O’Bannon, and Michelle Haynie for helpful comments on earlier drafts of the manuscript and technical support; Mark Eberhard for providing adult A. cantonensis rat lungworms; the City of New Orleans Mosquito, Termite, and Rodent Control Board for supplying samples and additional resources; and John Cross for being the inspiration for this project.

This study was supported by the Office of Research and Grants, the W. Roger Webb Forensic Science Institute, and the Department of Biology at the University of Central Oklahoma.

Biography

Mrs. York is an integrated pest management and collections specialist at the University of Oklahoma Sam Noble Museum of Natural History. Her research interests include infectious disease surveillance, host–parasite ecology, and animal behavior/interactions.

Footnotes

Suggested citation for this article: York EM, Creecy JP, Lord WD, Caire W. Geographic range expansion for rat lungworm in North America. Emerg Infect Dis. 2015 Jul [date cited]. http://dx.doi.org/10.3201/eid2107.141980

References

  • 1.Daszak P, Cunningham AA, Hyatt AD. Emerging infectious diseases of wildlife-threats to biodiversity and human health. Science. 2000;287:443–9. 10.1126/science.287.5452.443 [DOI] [PubMed] [Google Scholar]
  • 2.Bengis RG, Leighton FA, Fischer JR, Artois M, Morner T, Tate CM. The role of wildlife in emerging and re-emerging zoonoses. Rev Sci Tech. 2004;23:497–511 . [PubMed] [Google Scholar]
  • 3.Patz JA, Graczyk TK, Geller N, Vittor AY. Effects of environmental change on emerging parasitic diseases. Int J Parasitol. 2000;30:1395–405. 10.1016/S0020-7519(00)00141-7 [DOI] [PubMed] [Google Scholar]
  • 4.Prociv P, Spratt DM, Carlisle MS. Neuro-angiostrongyliasis: unresolved issues. Int J Parasitol. 2000;30:1295–303. 10.1016/S0020-7519(00)00133-8 [DOI] [PubMed] [Google Scholar]
  • 5.Duffy MS, Miller C, Kinsella J, Lahunta A. Parastrongylus cantonensis in a nonhuman primate, Florida. Emerg Infect Dis. 2004;10:2207–10. 10.3201/eid1012.040319 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Wang QP, Lai DH, Zhu XQ, Chen XG, Lun ZR. Human angiostrongyliasis. Lancet Infect Dis. 2008;8:621–30. 10.1016/S1473-3099(08)70229-9 [DOI] [PubMed] [Google Scholar]
  • 7.Lindo JF, Waugh C, Hall J, Cunningham-Myrie C, Ashley D, Eberhard M, et al. Enzootic Angiostrongylus cantonensis in rats and snails after an outbreak of human eosinophilic meningitis, Jamaica. Emerg Infect Dis. 2002;8:324–6. 10.3201/eid0803.010316 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Kliks MM, Palumbo N. Eosinophilic meningitis beyond the Pacific Basin: the global dispersal of a peridomestic zoonosis by Angiostrongylus cantonensis, the nematode lungworm of rats. Soc Sci Med. 1992;34:199–212. 10.1016/0277-9536(92)90097-A [DOI] [PubMed] [Google Scholar]
  • 9.York EM, Butler CJ, Lord WD. Global decline in suitable habitat for Angiostrongylus (=Parastrongylus) cantonensis: the role of climate change. PLoS ONE. 2014;9:e103831. 10.1371/journal.pone.0103831 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Qvarnstrom Y, Silva A, Teem J, Hollingsworth R, Bishop H, Graeff-Teixeira C, et al. Improved molecular detection of Angiostrongylus cantonensis in mollusks and other environmental sample with a species-specific ITS1-based TaqMan assay. Appl Environ Microbiol. 2010;76:5287–9. 10.1128/AEM.00546-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Kim DY, Stewart T, Bauer R, Mitchell M. Parastrongylus (=Angiostrongylus) cantonensis now endemic in Louisiana. J Parasitol. 2002;88:1024–6. 10.1645/0022-3395(2002)088[1024:PACNEI]2.0.CO;2 [DOI] [PubMed] [Google Scholar]
  • 12.Rachowicz LJ, Hero JM, Alford RA, Taylor JW, Morgan JAT, Vredenburg VT, et al. The novel and endemic pathogen hypotheses: competing explanations for the origin of emerging infectious diseases of wildlife. Conserv Biol. 2005;19:1441–8. 10.1111/j.1523-1739.2005.00255.x [DOI] [Google Scholar]
  • 13.Whitaker JO Jr. National Audubon Society field guide to North American mammals. New York: Alfred A. Knopf, Inc.; 1980. p. 745. [Google Scholar]
  • 14.Mora C, Tittensor DP, Adl S, Simpson AG, Worm B. How many species are there on Earth and in the ocean? PLoS Biol. 2011;9:e1001127. 10.1371/journal.pbio.1001127 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Cunningham AA. A walk on the wild side–emerging wildlife diseases. BMJ. 2005;331:1214–5. 10.1136/bmj.331.7527.1214 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Technical Appendix. Additional details on geographic range expansion for rat lungworm in North America.

14-1980-Techapp-s1.pdf (41.8KB, pdf)

Articles from Emerging Infectious Diseases are provided here courtesy of Centers for Disease Control and Prevention

RESOURCES