Skip to main content
Cellular Reprogramming logoLink to Cellular Reprogramming
. 2015 Jun 1;17(3):221–226. doi: 10.1089/cell.2015.0001

Conversion of Adipose Tissue-Derived Mesenchymal Stem Cells to Neural Stem Cell-Like Cells by a Single Transcription Factor, Sox2

Yiren Qin 1,,6, Chikai Zhou 2,,3,,6, Nianhong Wang 4,,6, Hao Yang 1, Wei-Qiang Gao 1,,5,
PMCID: PMC4487254  PMID: 26053521

Abstract

Adipose tissue is an attractive source of easily accessible adult candidate cells for regenerative medicine. Adipose tissue–derived mesenchymal stem cells (ADSCs) have multipotency and strong proliferation and differentiation capabilities in vitro. However, as mesodermal multipotent stem cells, whether the ADSCs can convert into induced neural stem cells (NSCs) has so far not been demonstrated. In this study, we found that normally the naïve ADSCs cultured as either monolayer or spheres in NSC medium did not express Sox2 and Pax6 genes and proteins, and could not differentiate to neuron-like cells. However, when we introduced the Sox2 gene into ADSCs by retrovirus, they exhibited a typical NSC-like morphology, and could be passaged continuously, and expressed NSC specific markers Sox2 and Pax6. In addition, the ADSC-derived NSC-like cells displayed the ability to differentiate into neuron-like cells when switched to the differentiation culture medium, expressing neuronal markers, including Tuj1 and MAP2 genes and proteins. Our results suggest the ADSCs can be converted into induced NSC-like cells with a single transcription factor Sox2. This finding could provide another alternative cell source for cell therapy of neurological disorders.

Introduction

Adipose tissue provides attractive, easily accessible adult candidate cells for regenerative medicine and can be isolated from both males and females at different ages, because obesity is a common problem and liposuction is a relatively safe and popular procedure. Adipose tissue–derived mesenchymal stem cells (ADSCs) have multipotency, can undergo self-renewing divisions, and possess the capacity to differentiate into osteogenic, chondrogenic, and adipogenic cell lineages (Qin et al., 2014; Zeve et al., 2009; Zuk et al., 2001). In addition, human and mouse adipose tissue–derived stem cells not only can be reprogrammed to induced pluripotent stem cells (iPSCs) with substantially higher efficiencies than those reported for human and mouse fibroblasts (Sugii et al., 2010), but they also have stronger proliferation and differentiation capabilities in vitro than skin fibroblasts (Rodeheffer et al., 2008; Zuk et al., 2001). In addition, we have recently reported that cloned mice and embryonic stem cells (ESCs) can be produced from adipose tissue–derived cells (Qin et al., 2013, 2015) and revealed that these cells possess good genetic stability. However, as mesodermal multipotent stem cells, whether the ADSCs can be directly converted into neural stem cells (NSCs) so far has not been demonstrated.

By transcription factor transduction, somatic cells can not only be reprogrammed to iPSCs (Takahashi and Yamanaka, 2006), but also directly converted from one cell type to another, such as conversion of fibroblasts into NSCs (Han et al., 2012) or neurons (Vierbuchen et al., 2010). Recently, Ring et al. reported the generation of induced neural stem cells (iNSCs) from mouse and human fibroblasts by direct reprogramming with a single transcription factor, Sox2 (Ring et al., 2012). NSCs have self-renewal capacity, can continue to be cultured and expanded in serum-free medium in vitro, and can differentiate into essentially all kinds of neurons. Unlike ESCs and iPSCs, iNSCs are not tumorigenic (Han et al., 2012; Ring et al., 2012). In view of the above advantages of ADSCs and NSCs, we wanted to convert ADSCs to induced NSC-like (iNSC-like) cells with a single factor, Sox2.

In this study, we used our previously purified and characterized ADSCs that expressed mesenchymal stem cell (MSC)-specific markers and possessed osteogenic, chondrogenic, and adipogenic differentiation potential (Qin et al., 2014). We found that the ADSCs maintained in monolayer or in spheres did not express Sox2 and Pax6 genes and proteins and did not differentiate to neuron-like cells. However, after they were infected with the retrovirus expressing Sox2, they showed classic NSC morphology and neural spheres and expressed NSC markers, including Sox2 and Pax6, on the basis of RT-PCR and immunostaining analyses. In addition, the NSC-like cells displayed the ability to differentiate into neuron-like cells, expressing neuronal markers such as Tuj1 and MAP2 genes and proteins. The present study indicates that ADSCs can be converted into NSC-like cells with a single transcription factor, Sox2.

Materials and Methods

Mouse ADSC cell line

The ADSC cell line used in the present study was established by us previously (Qin et al., 2014).

Retroviral infection

Retrovirus was produced by transfecting Plat-E cells with pMXs retroviral vectors (Plat-E cells and pMX-Sox2 retroviral plasmid were a gift from the Dr. Jinsong Li's lab). On the first day, Plat-E cells were seeded on a 100-mm dish. The next day, pMXs-based retroviral vectors were introduced into Plat-E cells using FuGENE 9 Transfection Reagent (Roche). Sox2 retroviral medium was collected and filtered through a 0.45-μm filter, and Polybrene (Sigma) was added (8 μg/mL). Sox2 retroviral medium was mixed with an equal volume of regular Dulbecco's Modified Eagle Medium (DMEM)+10% fetal bovine serum (FBS). ADSCs were then transduced with 1 mL of Sox2 retrovirus for 24 h and then cultured in NSC medium. NSC medium contained DMEM/F12 with 2% B27 (Life), 2 mM l-glutamine, 20 ng/mL fibroblast growth factor-2 (FGF-2), 20 ng/mL epidermal growth factor (EGF), and 2 μg/mL heparin.

Reverse transcription PCR

Total RNA from the cells was extracted using the Absolutely RNA Nanoprep Kit (Stratagene). One microgram of total RNA was reverse transcribed using a First Strand cDNA Synthesis Kit (TOYOBO). PCR was performed for 30 cycles with an annealing temperature of 60°C with Taq polymerase (Invitrogen), and PCR products were electrophoresed on 2% agarose gels. Primer sequences as shown in Table 1.

Table 1.

List of Primer Sequences

Gene name Forward primer Reverse primer
Sox2 CACCATCCGGGATGAAAGTGAGAT ACCAGAAAATGTCGCTTTAGTTTC
Pax6 TAGCCCAGTATAAACGGGAGTG CCAGGTTGCGAAGAACTCTG
Nestin CCCTGAAGTCGAGGAGCTG CTGCTGCACCTCTAAGCGA
Tuj1 TAGACCCCAGCGGCAACTAT GTTCCAGGTTCCAAGTCCACC
MAP2 GCCAGCCTCAGAACAAACAG AAGGTCTTGGGAGGGAAGAAC
GAPDH TGCCCAGAACATCATCCCT ATGCCTGCTTCACCACCTT

Immunofluorescence analyses

The cells were fixed in 4% paraformaldehyde solution for 10 min at room temperature. After being permeabilized using 0.1% Triton X-100 in phosphate-buffered saline (PBS) for 15 min at room temperature, the cells were blocked for 1 h in 5% donkey serum in PBS. The cells were incubated with primary antibodies Nestin (Cell Signaling Technology), Sox2 (Abcam), Tuj1 (Sigma), and MAP2 (Millipore), overnight at 4°C. The cells were treated with a fluorescently coupled secondary antibody and then incubated for 1 h at room temperature. The nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI; Sigma) for 5 min at room temperature.

Neural differentiation of iNSC-like cells

The cells were plated onto polyornithine/laminin-coated glass coverslips in 24-wells or a 60-mm dish containing NSC medium. After 24 h, the medium was switched to neural differentiation medium [neural basal medium, consisting of 2% B27, 1% N2, 10 ng/mL brain-derived neurotrophic factor (BDNF), 10 ng/mL glial cell line–derived neurotrophic factor (GDNF), 10 ng/mL insulin-like growth factor-1 (IGF-1), 1 μM cyclic adenosine monophosphate (cAMP), 200 μM ascorbic acid). The cells were investigated 2–4 weeks after initiation of differentiation.

Results

Generation and characterization of iNSC-like cells from ADSCs

In this study, we used our previously purified and characterized ADSC cell line, which expressed specific MSC markers and possessed osteogenic, chondrogenic, and adipogenic differentiation potential (Qin et al., 2014). When the ADSCs were cultured in normal medium (DMEM with 10% FBS), they exhibited a typical fibroblast-like morphology (Fig. 1A, left). However, when ADSCs were trypsinized and replated in NSC medium (see Materials and Methods) and maintained under this culture condition for 6–7 days, they formed spheres, called ADSC spheres (Fig. 1A, middle).

FIG. 1.

FIG. 1.

Generation and characterization of iNSC-like cells from ADSCs. (A) ADSCs cultured in normal medium exhibited a typical fibroblast-like morphology (left). However, ADSCs cultured in NSC medium could form spheres, called ADSC spheres (middle). ADSCs infected with Sox2 retrovirus cultured in NSC medium exhibited a typical NSC-like morphology, showed neural spheres, and could be passaged continuously (right). These cells were called iNSC-like cells. (B) RT-PCR analysis showed that ADSCs, ADSC spheres, and iNSC-like cells all expressed the Nestin gene, but only iNSC-like cells expressed the Sox2 and Pax6 genes. Scale bar, 50 μm.

Given that Sox2 is reported to highly expressed in NSCs (Sarkar and Hochedlinger, 2013) and can convert somatic cells into NSCs (Ring et al., 2012), we hypothesize that transduction of ADSCs might induce them to become iNSCs. We infected ADSCs with 1 mL of Sox2 retrovirus for 24 h and then cultured the cells in NSC medium. After culture for 6–7 days, these infected cells were digested and dissociated using Accutase and replated in NSC medium. After another 6–7 days in culture, these cells exhibited a typical NSC-like morphology (Fig. 1A, right), formed neural spheres, and could be passaged continuously. These cells were called iNSC-like cells.

To verify whether these cells had the characteristics of NSCs, we first performed RT-PCR analysis to measure expression levels of NSC-related genes, including Nestin, Sox2, and Pax6. We found that while the Nestin gene was expressed by some of the ADSCs, ADSC-sphere cells, and iNSC-like cells, Sox2 and Pax6 genes were only expressed by iNSC-like cells (Fig. 1B).

Next, we used immunofluorescent staining to determine expression levels of NSC-related proteins. Our results revealed that ADSCs, ADSC-spheres, and iNSC-like cells all expressed Nestin, but only iNSC-like cells expressed Sox2 and Pax6 proteins (Fig. 2). In sharp contrast, the naïve ADSCs and ADSC spheres did not express Sox2 and Pax6 genes and proteins (Figs. 1B and 2).

FIG. 2.

FIG. 2.

Immunofluorescence analysis of iNSC-like cells. Immunostaining showed that ADSCs, ADSC spheres, and iNSC-like cells all expressed Nestin proteins, but only iNSC-like cells expressed Sox2 and Pax6 proteins. In sharp contrast, ADSCs and ADSC spheres did not express these proteins. Scale bar, 50 μm.

Neural differentiation of iNSC-like cells in vitro

To verify whether the iNSC-like cells could differentiate into neural cells, we seeded these cells on to polyornithine/laminin-coated plates in neural differentiation medium (see Materials and Methods). After culture for 2–4 weeks, iNSCs-like cells differentiated into typical neuron-like cells in shape (Fig. 3A, bottom). By RT-PCR analysis, we found that these differentiated neuron-like cells indeed expressed the neuron-related genes Tuj1 and MAP2 (Fig. 3B). Next, we used immunofluorescent staining to study if the differentiated neuron-like cells from iNSCs-like cells also expressed the neuron-related proteins Tuj1 and MAP2. As shown in Figure 4 (bottom panel), they indeed expressed Tuj1 and MAP2. In contrast, ADSC spheres cultured in neural differentiation medium neither displayed neural morphology nor expressed Tuj1 and MAP2 genes and proteins (Fig. 3A, top, Fig, 3B, and Fig. 4, top panel).

FIG. 3.

FIG. 3.

Neural differentiation of iNSC-like cells in vitro. (A) After culture in neural differentiation medium for 2–4 weeks, iNSC-like cells differentiated into typical neuron-like cells in morphology (bottom). ADSC spheres cultured in neural differentiation medium, however, did not show neuron-like morphology (top). (B) RT-PCR analysis showed that differentiated neuron-like cells from iNSC-like cells expressed the neuron-related genes Tuj1 and MAP2. ADSC spheres maintained in neural differentiation medium did not express these genes. Scale bar, 50 μm.

FIG. 4.

FIG. 4.

Immunofluorescence analysis of differentiated neuron-like cells from iNSC-like cells. Immunofluorescent staining confirmed that the differentiated neuron-like cells from iNSC-like cells expressed the neuron-related proteins Tuj1 and MAP2 (bottom panel). In contrast, in control cultures, the ADSC spheres did not express these proteins (top panel). Scale bar, 50 μm.

Discussion

To the best of our knowledge, this is the first report to demonstrate the conversion of ADSCs into iNSC-like cells using one transcription factor, Sox2. These ADSCs-derived iNSC-like cells showed classic NSC morphology and neural spheres. RT-PCR and immunostaining analyses revealed that they expressed NSC markers, including Sox2 and Pax6. In addition, the iNSC-like cells displayed the ability to differentiate into neuron-like cells in vitro, expressing the neuronal marker Tuj1 and MAP2 genes and proteins.

Although adipose-derived stem cells can be reprogrammed to iPSCs with substantially higher efficiencies (Sugii et al., 2010), iNSCs were not tumorigenic as compared to ESCs and iPSCs. Furthermore, the iNSCs have self-renewal capacity and can be cultured continuously, expanded in serum-free medium in vitro, and differentiated into all kinds of neurons. Recently, iNSCs can be generated from skin fibroblasts by a direct reprogramming with a single transcription factor, Sox2 (Ring et al., 2012). However, the acquisition of skin cells from patients has certain disadvantages, such as pain and scar formation. As compared to skin cells, ADSCs have advantages, including easy access, because obesity affects health and liposuction is a relatively safe and popular procedure. In addition, ADSCs possess stronger proliferation in vitro than skin fibroblasts (Han et al., 2012; Ring et al., 2012), and our recent study confirmed ADSCs possess good genetic stability (Qin et al., 2013, 2015). So the adipose tissue from patients can provide virtually unlimited donor cells for the conversion.

It is important to note that as mesodermal multipotent stem cells, it is controversial whether the ADSCs could directly differentiate into NSCs (Gurdon and Melton, 2008; Yamanaka and Blau, 2010). Some studies have reported that when ADSCs are cultured in NSC medium, they can form NSC-like neural spheres and even could further differentiate into neural cells (Ahmadi et al., 2012; Anghileri et al., 2008). However, there was a question of whether these cells are really neurons because these investigators did not determine whether these NSC-like neural spheres express the NSC-specific markers Pax6 and Sox2. Importantly, our study showed that although ADSCs and ADSC spheres express Nestin, they do not express Pax6 and Sox2. Normally the mesoderm-derived ADSCs can differentiate into osteoblasts, chondrocysts, and adipocytes, but do not differentiate into the neural ectoderm cells. These results indicated that ADSCs only possess multipotency, not pluripotency. By transduction of the ADSCs with Sox2 gene, these cells become iNSCs, which can then be induced to differentiate into neurons.

At present, the successful methods of reprogramming somatic cells to the totipotent or pluripotent state are either nuclear transfer technique (to form ESCs, Tachibana et al., 2013) or induction of pluripotency by the Yamanaka factors (to form iPSCs; Takahashi and Yamanaka, 2006). In addition, by special transcription factor transduction, somatic cells can be converted from one cell type to another, such as from fibroblasts into NSCs (Han et al., 2012) or neurons (Vierbuchen et al., 2010). Recently, it was shown that by a single transcription factor, Sox2, the fibroblasts could be reprogrammed directly to iNSCs (Ring et al., 2012). This method made the transcription factor-mediated conversion easier. Sox2 is expressed during the earliest stages of ESC differentiation toward the neural lineage in vitro, supporting a role in neural commitment, and it promotes early neuroectodermal fate by directly suppressing key regulators of the alternative mesendodermal fate (Sarkar and Hochedlinger, 2013). The Sox2 functions were considered as a master regulator gene for NSC identity and maintenance.

In this study, we introduced the Sox2 gene into ADSCs by retrovirus, and these cells became iNSCs. Our findings identify another somatic cell source for generation of iNSCs, which are helpful for cell therapy of neurological disorders.

Acknowledgments

This study was supported by funds to W.-Q. Gao from the Chinese Ministry of Science and Technology (grant nos. 2012CB966800, 2013CB945600, and 2012CB967903), the National Natural Science Foundation of China (grant nos. 81130038 and 81372189), the Science and Technology Commission of Shanghai Municipality (Pujiang program), the Shanghai Education Committee Key Discipline and Specialty Foundation (grant no. J50208), the Shanghai Health Bureau Key Discipline and Specialty Foundation, and the K.C. Wong foundation. We thank Professor Jinsong Li of the Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences, for providing us with Plat-E cells and the pMX-Sox2 retroviral plasmid.

Author Disclosure Statement

The authors declare that no conflicting financial interests exist.

References

  1. Anghileri E., Marconi S., Pignatelli A., Cifelli P., Galié M., Sbarbati A., Krampera M., Belluzzi O., and Bonetti B. (2008). Neuronal differentiation potential of human adipose-derived mesenchymal stem cells. Stem Cells Dev. 17, 909–916 [DOI] [PubMed] [Google Scholar]
  2. Ahmadi N., Razavi S., Kazemi M., and Oryan S. (2012). Stability of neural differentiation in human adipose derived stem cells by two induction protocols. Tissue Cell 44, 87–94 [DOI] [PubMed] [Google Scholar]
  3. Gurdon J.B., and Melton D.A. (2008). Nuclear reprogramming in cells. Science 322, 1811–1815 [DOI] [PubMed] [Google Scholar]
  4. Han D.W., Tapia N., Hermann A., Hemmer K., Höing S., Araúzo-Bravo M.J., Zaehres H., Wu G., Frank S., Moritz S., Greber B., Yang J.H., Lee H.T., Schwamborn J.C., Storch A., and Schöler H.R. (2012). Direct reprogramming of fibroblasts into neural stem cells by defined factors. Cell Stem Cell 10, 465–472 [DOI] [PubMed] [Google Scholar]
  5. Qin Y., Lin J., Zhou C., Yin Q., Xie Z., Zhang X., Liu X.Y., Gao W., and Li J. (2013). Mice cloned from white adipose tissue-derived cells. J. Mol. Cell. Biol. 5, 348–350 [DOI] [PubMed] [Google Scholar]
  6. Qin Y., Zhou P., Zhou C., Li J., and Gao W.Q. (2014). The adipose-derived lineage-negative cells are enriched mesenchymal stem cells and promote limb ischemia recovery in mice. Stem Cells Dev. 23, 363–371 [DOI] [PubMed] [Google Scholar]
  7. Qin Y., Qin J., Zhou C., Li J., and Gao W.Q. (2015). Generation of embryonic stem cells from mouse adipose-tissue derived cells via somatic cell nuclear transfer. Cell Cycle Feb 18:0.. [Epub ahead of print] [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Ring K.L., Tong L.M, Balestra M.E., Javier R., Andrews-Zwilling Y., Li G., Walker D., Zhang W.R, Kreitzer A.C., and Huang Y. (2012). Direct reprogramming of mouse and human fibroblasts into multipotent neural stem cells with a single factor. Cell Stem Cell 11, 100–109 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Rodeheffer M.S., Birsoy K., and Friedman J.M. (2008). Identification of white adipocyte progenitor cells in vivo. Cell 135, 240–249 [DOI] [PubMed] [Google Scholar]
  10. Sarkar A., and Hochedlinger K. (2013). The sox family of transcription factors: Versatile regulators of stem and progenitor cell fate. Cell Stem Cell 12, 15–30 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Sugii S., Kida Y., Kawamura T., Suzuki J., Vassena R., Yin Y.Q., Lutz M.K., Berggren W.T., Izpisúa , Belmonte J.C, and Evans R.M. (2010). Human and mouse adipose-derived cells support feeder-independent induction of pluripotent stem cells. Proc. Natl. Acad. Sci. USA 107, 3558–3563 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Tachibana M., Amato P., Sparman M., Gutierrez N.M., Tippner-Hedges R., Ma H., Kang E., Fulati A., Lee H.S., Sritanaudomchai H., Masterson K., Larson J., Eaton D., Sadler-Fredd K., Battaglia D., Lee D., Wu D., Jensen J., Patton P., Gokhale S., Stouffer R.L., Wolf D., and Mitalipov S. (2013). Human embryonic stem cells derived by somatic cell nuclear transfer. Cell 153, 1228–1238 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Takahashi K., and Yamanaka S. (2006). Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126, 663–676 [DOI] [PubMed] [Google Scholar]
  14. Vierbuchen T., Ostermeier A., Pang Z.P., Kokubu Y., Südhof T.C., and Wernig M. (2010). Direct conversion of fibroblasts to functional neurons by defined factors. Nature 463, 1035–1041 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Yamanaka S., and Blau H.M. (2010). Nuclear reprogramming to a pluripotent state by three approaches. Nature 465, 704–712 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Zeve D., Tang W., and Graff J. (2009). Fighting fat with fat: The expanding field of adipose stem cells. Cell Stem Cell 5, 472–481 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Zuk P.A., Zhu M., Mizuno H., Huang J., Futrell J.W., Katz A.J., Benhaim P., Lorenz H.P., and Hedrick M.H. (2001). Multilineage cells from human adipose tissue: Implications for cell-based therapies. Tissue Eng. 7, 211–228 [DOI] [PubMed] [Google Scholar]

Articles from Cellular Reprogramming are provided here courtesy of SAGE Publications

RESOURCES