Graphical abstract
Method name: Rapid single worm RT-qPCR
Keywords: C. elegans, RNA, RT-qPCR
Abstract
Traditional RNA extraction methods rely on the use of hazardous chemicals such as phenol, chloroform, guanidinium thiocyanate to disrupt cells and inactivate RNAse simultaneously. RNA isolation from Caenorhabditis elegans presents another challenge due to its tough cuticle, therefore several repeated freeze–thaw cycles may be needed to disrupt the cuticle before the cell contents are released. In addition, a large number of animals are required for successful RNA isolation. To overcome these issues, we have developed a simple and efficient method using proteinase K and a brief heat treatment to release RNA of quality suitable for quantitative PCR analysis.The benefits of the method are:
-
•
Faster and safer compared to conventional RNA extraction methods
-
•
Released RNA can be used directly for cDNA synthesis without purification
-
•
As little as a single worm is sufficient
Method
Caenorhabditis elegans were cultured under standard laboratory condition [6]. Wild type N2 C. elegans was used and propagated at 20 °C in NGM (nematode growth medium) plates seeded with Escherichia coli OP50. The C. elegans and E. coli were obtained from Caenorhabditis Genetics Center.
RNA extraction, genomic DNA digestion, cDNA synthesis and RT-qPCR
A single worm was picked from an NGM plate using an eyelash pick and transferred to a drop of ∼20 μL of H2O to remove bacteria. The cleaned worm was transferred using the eyelash pick into 1 μL of worm lysis buffer (5 mM Tris pH 8.0 (Sigma–Aldrich), 0.5% Triton X-100 (Sigma–Aldrich), 0.5% Tween 20 (Bio-rad), 0.25 mM EDTA (Merck) and 1 mg/mL proteinase K (Roche)) on the wall of a 0.2 mL PCR tube. The tube was briefly centrifuged to bring the worm to the bottom of the tube and then incubated at 65 °C for 10 min in a thermocycler (Eppendorf). To inactivate proteinase K, the tube was heated to 85 °C for 1 min and then immediately cooled on ice. The worm lysate was used immediately for cDNA synthesis or stored below −70 °C. A single adult worm typically contained ∼35 ng total RNA, measured using Qubit RNA HS Assay kit (Life Technologies).
cDNA synthesis was performed using Maxima H Minus cDNA synthesis kit (Thermo Fisher) as described in the manufacturer’s manual. One microliter of cDNA synthesis mix was added to the worm lysate. The final mix contains 1× supplier-provided buffer, 0.5 mM each dNTP, 5 μM random hexamer, heat labile dsDNAse 1 unit/μL RNAse inhibitor and 20 unit/μL reverse transcriptase. The tube was briefly centrifuged, mixed, and incubated at 25 °C for 10 min, followed by 55 °C for 30 min and a final 85 °C for 5 min. The cDNA was diluted to 25 μL with H2O, used immediately or stored below −70 °C.
Quantitative PCR was performed using Roche LightCycler® 480 System. Each 10-μL reaction contained 0.5 μM each of forward and reverse primers, 0.1 μM hydrolysis probe, 1× Probes Master, and 2.5 μL of diluted cDNA. The primers for the quantification of the reference gene act-1 were manufactured by IDT and the sequences are: act1f (ACGCCAACACTGTTCTTTCC), act1r (GATGATCTTGATCTTCATGGTTGA), in 5′ → 3′ direction.
As a comparison, RNA extraction from worms was also performed using Trizol (Life Technologies) [3]. Briefly, 0.5 mL of Trizol was added to worms in a 1.5 mL tube and incubated at RT for 5 min. Chloroform (0.1 mL) was added and the tube was shaken vigorously for 15 s. The tube was incubated at room temperature for 2–3 min and then centrifuged at 12,000 × g for 15 min at 4 °C. The aqueous phase was transferred into a new tube and 0.25 mL of isopropanol was added. The tube was incubated at room temperature for 10 min and then centrifuged at 12,000 × g for 15 min at 4 °C. The supernatant was removed and the tube was washed with 1 mL of ice cold 70% (v/v) ethanol. The tube was air dried and resuspended in RNAse-free H2O. When extracting from a single worm, the precipitate was finally resuspended in 1 μL of H2O; when extracting from 100 worms, 100 μL of H2O was used. One microliter of purified RNA was used for cDNA synthesis (as described above).
We demonstrate, using act-1 as a reference gene and absolute threshold cycle (Ct) values as an indirect measurement, that RNA is released from animals of all developmental stages from eggs to adults (Table 1). The Ct values decreased as expected from eggs to adults, corresponding to an increase in RNA amount. We found that as little as a single egg could produce Ct values within a useful working range. In addition, cDNA produced from each animal treatment (2 μL) is normally diluted to 25 μL and only 2.5 μL is used for each qPCR reaction, thus a single animal is sufficient for 10 qPCR. For a single adult worm, this resulted in a Ct value of 18.9 ± 0.28 for the act-1 transcript. The worm lysate did not inhibit cDNA synthesis and qPCR as the amplification efficiency for act-1 was 100.2% (Fig. 1). As expected increasing the number of animals in a lysate from 1 to 4, correspondingly decreased the Ct value. Therefore, it is possible to adjust several parameters (dilution factor, number of animals) to obtain Ct values suitable for different genes. In contrast, attempts to purify RNA from a single adult worm using Trizol were unsuccessful; no Ct value could be computed. When 100 adults were used in the Trizol method, sufficient RNA could be isolated as expected.
Table 1.
Absolute threshold cycles for act-1 transcript RNA from animals of various stages was either extracted with the proteinase K + heat treatment or Trizol and converted to cDNA. The amounts of cDNA were quantified by qPCR and the Ct values (±SD) (n ≥ 6, biological replicates) were used as an indirect measurement of RNA abundance. Extraction of RNA from a single adult worm using Trizol was unsuccessful, NC: non computable. RNA from 100 worms could be extracted from Trizol and the Ct value reflects per single adult.
| Method | Sample | Ct |
|---|---|---|
| Proteinase K + heat treatment | 1 egg | 25.6 ± 0.08 |
| 1 L1 | 25.2 ± 0.12 | |
| 1 L2 | 22.4 ± 0.32 | |
| 1 L3 | 21.9 ± 0.88 | |
| 1 L4 | 19.8 ± 1.24 | |
| 1 adult | 18.9 ± 0.28 | |
| 2 adults | 18.0 ± 0.04 | |
| 4 adults | 16.8 ± 0.07 | |
| −RT | >35 | |
| Trizol | 1 adult | NC |
| 100 adults | 19.6 ± 0.10 | |
Fig. 1.
Standard curve for act-1.
Efficiency is 100.167%, calculated based on the formula: E = −1 + 10(−1/slope). The slope is −3.3179. The R2 is 0.9999.
Polymerase chain reaction for the amplification of ttn-1 transcript
RNA exposed to heat and potential nucleases can degrade rapidly. While RNA degradation can be accounted for in qPCR with appropriate controls [2], other applications such as cDNA cloning or transcriptome sequencing require relatively intact RNA. To assess if intact transcripts could be isolated from a single proteinase K digested worm, we amplified fragments of the ttn-1 cDNA.
cDNA from a single digested adult worm (1 μL) was used as a template in a 10 μL reaction containing 1× supplier-provided buffer, 0.25 μM each of forward and reverse primer, 0.2 mM each dNTP and 0.2 unit of polymerase (Phusion DNA polymerase, Thermo Fisher). The tube was heated at 98 °C for 1 min, followed by 30 cycles of 98 °C for 5 s, 65 °C for 15 s, 72 °C for 5 min. The PCR products were resolved on 0.8% agarose gel in 1 × TBE. Primers sequences are: ttnf (AGTGCAAGTGGTCACGCAAC), ttnr1 (TGAGGCTTTTACCGGGACTT), ttnr2 (TGTGGCTGCTGGGTAACAAT), ttnr3 (TCCAGTTGAATTGGCAGTTGG), in 5′ → 3′ direction.
Fig. 2 shows that cDNA of at least ∼4 kb was successfully amplified. Three primer pairs sharing a forward primer, with reverse primers located in exon 1–3, amplified fragments of 7.5, 5.0 and 2.5 kb, respectively, from genomic DNA. The amplicons from cDNA with the same three primer pairs generated products of ∼4.5, ∼3.0 and ∼2.0 kb in length, respectively. Thus, this method results in RNA of sufficient quality for not only routine qPCR but also for cloning mRNA transcripts.
Fig. 2.

DNA electrophoresis of PCR products from cDNA and gDNA using 3 different sets of primers. M: DNA ladder (Universal Ladder, Kapabiosystems); 1: primer ttnf + ttnr1; 2: primer ttnf + ttnr2; 3: primer ttnf + ttnr3.
Heat shock mRNA measurement using single animals
To exemplify the usefulness of this method, we measured the expression levels of two heat-shock protein transcripts (hsp-16.2 and hsp-70) from single animals after induction via exposure to high temperature (Fig. 3).
Fig. 3.
Changes in heat shock mRNA levels (hsp-16.2 and hsp-70, normalized to act-1) in C. elegans after heat treatment. The animals were raised at 20 °C, upshifted to 30 °C for 1 h and then returned to 20 °C. Error bar: standard deviation; n ≥ 5.
Age-synchronized C. elegans was grown on NGM plates at 20 °C until first day adult stage. Immediately before heat shock, animals were collected (time point 0) and treated with proteinase K. The plate was then moved to a dry incubator at 30 °C. After 1 h, the plate was returned to 20 °C and the animals were collected (time point 1). After 1, 3 and 5 h at 20 °C, animals were collected (time point 2, 4, and 6, respectively). cDNA synthesis and qPCR was carried out as above. Fold changes in the two heat shock transcripts (hsp-16.2 and hsp-70) were calculated using the 2−ΔΔCt formula, with act-1 as reference gene and assuming an amplification efficiency of 100%. The primers are: hsp16f (-TGCAGAATCTCTCCATCTGAGT), hsp16r (TGGTTTAAACTGTGAGACGTTGA), hsp70f (CGGTATTTATCAAAATGGAAAGGTT), hsp70r (TACGAGCGGCTTGATCTTTT), in 5′ → 3′ direction.
At the normal incubation temperature of 20 °C, the levels of the two transcripts were extremely low (Ct values > 30), as expected (Fig. 3). After 1 h of incubation at 30 °C, the level of the two transcripts increased dramatically (Ct values decreased to below 23). Once the animals were returned to 20 °C, the levels of the two transcripts decreased (Ct values gradually increased) and approached the pre heat-shock levels. This rapid alteration in expression level is consistent with other researchers’ findings [5].
In summary, we have developed a simple and efficient method for releasing RNA from as little as a single C. elegans which is not possible or very difficult with the widely used Trizol method. Without further purification, the RNA can be used successfully in routine qPCR. This method can dramatically cut down time, reagents and number of animals needed for quantitative analysis of gene expression.
Additional information
Background
Transcription analysis is an important step to understanding a physiological state and the analysis of multiple individual animals is likely to provide more insight than a potentially heterogeneous population. A major limitation in the use of C. elegans is the inability to extract usable quantities of high quality RNA from individual animals. Due to RNA’s inherent instability and the ubiquitous presence of RNAse most extraction protocols utilize harsh denaturants such as guanidine salt, phenol, and chloroform to rapidly solubilize cells or tissues and irreversibly deactivate RNAse [1]. RNA from C. elegans can be purified by phenol/chloroform extraction but requires additional pre-treatment. Typically, the worms are frozen in liquid nitrogen and ground to fine powder before being solubilized in the denaturants [3]. This extra step helps to rupture the worm’s resilient cuticle [4] and release cellular contents effectively. Even though these procedures have been used successfully for isolating RNA from C. elegans for many years, there are several drawbacks. A reasonably large number of animals are needed to provide RNA concentration high enough for successful precipitation. Also the chaotropes and organic solvents are highly hazardous. Moreover, the extraction process can be arduous particularly when dealing with a large number of samples. Many cell types from other organisms are readily lysed by mild detergents (or proprietary solutions from commercial kits) and the released RNA can then be used directly in downstream applications. However, the cuticle of C. elegans provides a tough barrier resistant to lysis by most solutions. To overcome this, we reported here a simple procedure that can effectively disintegrate C. elegans to release RNA ready for use in less than 15 min from one or more animals and without the use of hazardous chemicals. The approach enables population heterogeneity to be examined as this information is lost when extracting from groups of animals. One can analyse multiple individual animals to quantify the variation or to select individual lines with desired phenotypes. One example of this utility is that after microinjection, individual adults are allowed to lay eggs then expression levels of the transgenes are assessed in parents individually. Lines with low or high levels of expressions can then be established. This method will enable high throughput single animal screening.
Footnotes
This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
References
- 1.Chomczynski P., Sacchi N. The single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction: twenty-something years on. Nat. Protoc. 2006;1:581–585. doi: 10.1038/nprot.2006.83. [DOI] [PubMed] [Google Scholar]
- 2.Fleige S., Pfaffl M.W. RNA integrity and the effect on the real-time qRT-PCR performance. Mol. Aspects Med. 2006;27:126–139. doi: 10.1016/j.mam.2005.12.003. [DOI] [PubMed] [Google Scholar]
- 3.Ketting R.F., Tijsterman M., Plasterk R.H.A. Cold Spring Harbor Protocols; 2006. Isolation of RNA from C. elegans. pdb.prot4321. [DOI] [PubMed] [Google Scholar]
- 4.Page A.P., Johnstone I.L. The cuticle. WormBook. 2007:1–15. doi: 10.1895/wormbook.1.138.1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Prahlad V., Cornelius T., Morimoto R.I. Regulation of the cellular heat shock response in Caenorhabditis elegans by thermosensory neurons. Science. 2008;320:811–814. doi: 10.1126/science.1156093. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Riddle D.L., Blumenthal T., Meyer B.J., Priess J.R. second ed. Cold Spring Harbor Laboratory Press; 1997. C. elegans II. [PubMed] [Google Scholar]



