Skip to main content
PLOS One logoLink to PLOS One
. 2015 Jul 1;10(7):e0131317. doi: 10.1371/journal.pone.0131317

Hyper Accumulation of Arsenic in Mutants of Ochrobactrum tritici Silenced for Arsenite Efflux Pumps

Tânia Sousa 1,#, Rita Branco 1,#, Ana Paula Piedade 2, Paula V Morais 1,3,*
Editor: Alexandre Poulain4
PMCID: PMC4489015  PMID: 26132104

Abstract

Ochrobactrum tritici SCII24T is a highly As-resistant bacterium, with two previously described arsenic resistance operons, ars1 and ars2. Among a large number of genes, these operons contain the arsB and Acr3 genes that encode the arsenite efflux pumps responsible for arsenic resistance. Exploring the genome of O. tritici SCII24T, an additional putative operon (ars3) was identified and revealed the presence of the Acr3_2 gene that encodes for an arsenite efflux protein but which came to prove to not be required for full As resistance. The genes encoding for arsenite efflux pumps, identified in this strain, were inactivated to develop microbial accumulators of arsenic as new tools for bioremediation. Six different mutants were produced, studied and three were more useful as biotools. O. tritici wild type and the Acr3-mutants showed the highest resistance to As(III), being able to grow up to 50 mM of arsenite. On the other hand, arsB-mutants were not able to grow at concentrations higher than 1 mM As(III), and were the most As(III) sensitive mutants. In the presence of 1 mM As(III), the strain with arsB and Acr3_1 mutated showed the highest intracellular arsenic concentration (up to 17 ng(As)/mg protein), while in assays with 5 mM As(III), the single arsB-mutant was able to accumulate the highest concentration of arsenic (up to 10 ng(As)/mg protein). Therefore, arsB is the main gene responsible for arsenite resistance in O. tritici. However, both genes arsB and Acr3_1 play a crucial role in the resistance mechanism, depending on the arsenite concentration in the medium. In conclusion, at moderate arsenite concentrations, the double arsB- and Acr3_1-mutant exhibited a great ability to accumulate arsenite and can be seen as a promising bioremediation tool for environmental arsenic detoxification.

Introduction

Arsenic is a natural metalloid widely distributed in air, water and soil, and is considered as one of the chemicals of major public health concern [1]. Arsenic occurs in the environment in four oxidation states, but the most common forms are the soluble species arsenate [AsO4 3-] and arsenite [AsO2 -]. Arsenate is a structural analogue of phosphate that can enter cells via phosphate membrane transport systems, disrupting the metabolic processes that require oxidative phosphorylation [2,3]. Arsenite, the most toxic of arsenic oxyanions, is transported into cells by aqua-glyceroporins and exerts its toxicity by binding to thiol groups (SH) in proteins, impairing their function [2,3]. Many organisms like bacteria have developed a variety of mechanisms that allow them to grow in environments contaminated with arsenic. Such mechanisms include (i) arsenite methylation; (ii) arsenite oxidation to arsenate; (iii) arsenite extrusion systems; or (iv) arsenate reduction and consequent extrusion of arsenite [3].

One of the best documented mechanisms of arsenic resistance is the arsenite efflux from cells, performed by two different and unrelated families of membrane transport proteins, ArsB and Acr3p [4,5]. ArsB is encoded by the arsB gene that in some cases, is rearranged in operons with three genes (arsRBC), where ArsB alone extrudes arsenite with energy supplied by the membrane potential of the cell [6,7]. In other cases, arsB is clustered in operons with five genes (arsRDABC), where ATPase ArsA hooks up with ArsB and then arsenite is pumped out in an ATP-dependent process [6,8]. The Acr3p family includes the arsB gene of Bacillus subtilis [9] and the Acr3 gene from Saccharomyces cerevisiae [10], and encodes a membrane protein that catalyzes the extrusion of arsenite from cytosol [4]. Although ArsB and Acr3p share the same function, these proteins do not show sequence similarities.

Ochrobactrum tritici SCII24T has been reported as a strain with high capacity to resist to arsenic toxicity, able to grow in the presence of As(III) up to 50 mM [11]. Previous works identified two chromosomally located arsenic resistance operons: operon ars1 that contains five genes encoding proteins ArsR, ArsD, ArsA, cystathionine β-synthase (CBS)-domain-containing protein and ArsB, and confers resistance to arsenite and antimonite; and operon ars2, responsible for the resistance to arsenite and arsenate, composed of six genes encoding two additional ArsR, two ArsC, one ACR3 and an ArsH-like protein [11]. Additionally, this strain is capable of arsenite oxidation through the arsenite oxidase designated AioAB [12]. In this bacterium, the presence of different mechanisms for coping with arsenic in addition with other intrinsic characteristics such as lack of pathogenicity, high growth rates, no-exigent growth requirements and stability of the genome, makes it an interesting organism to be manipulated for the development of potential biotools [11,12].

The use of biotools to remove arsenic from polluted environments has been gaining notice to interest because of their potential in providing an effective technology for arsenic remediation. Moreover, biological approaches are often more environmentally friendly and economically viable [13]. Several approaches have been developed to deal with arsenic-contaminated waters including the use of bioaccumulation or biosequestration abilities of organisms, and the development of biosorbents [14,15].

In this work, the genome of strain O. tritici SCII24T was explored in order to reveal additional arsenic resistance related genes allowing a better understanding of the mechanisms of this organism to cope with arsenic. The main objective of this work was to construct an O. tritici mutant with potential for bioremediation applications, with special abilities to resist and accumulate arsenic. The genes that encode for arsenite efflux pumps were inactivated to achieve strains able to accumulate arsenic. With this strategy, we aim to obtain an efficient bioremediation tool able to remove arsenite from the environment.

Materials and Methods

Bacterial strains, plasmids and growth conditions

Bacterial strains and plasmids used in this study are listed in Table 1. O. tritici SCII24T strains and Escherichia coli AW3110 (7) were grown aerobically at 35°C in Luria-Bertani (LB) medium containing 10 g/L tryptone, 5 g/L yeast extract and 5 g/L NaCl or in Chemically Defined Medium (CDM) composed by 6.06 g/L Tris, 4.68 g/L NaCl, 1.49 g/L KCl, 1.07 g/L NH4Cl, 0.43 g/L Na2SO4, 0.2 g/L MgCl2.6H2O, 0.03 g/L CaCl2.2H2O, 0.23 g/L Na2HPO4.12H2O and 0.3% glucose. These media were supplemented with corresponding antibiotics, ampicillin (100 μg/mL), gentamicin (15 μg/mL), hygromycin (200 μg/mL) and sucrose (5%) when required. E. coli S17-1 and E. coli DH5α strains were used as host for the cloning vectors.

Table 1. Bacterial strains and plasmids used in this work.

Strain or Plasmid Relevant Characteristic(s) Reference or Source
Bacterial Strains
 O. tritici SCII24T Type strain; Ampr; As(III)r; As(V)r; Sb(III)r LMG
 arsB mutant Single mutant of SCII24T; Gmr; arsB mutated This study
 Acr3_1 mutant Single mutant of SCII24T; Hygr; Acr3_1 mutated This study
 Acr3_2 mutant Single mutant of SCII24T; Acr3_2 mutated This study
 arsB/Acr3_2 mutant Double mutant of SCII24T; Gmr; arsB and Acr3_2 mutated This study
 arsB/Acr3_1 mutant Double mutant of SCII24T; Gmr; Hygr; arsB and Acr3_1 mutated This study
 arsB/Acr3_1/Acr3_2 mutant Triple mutant of SCII24T; Gmr; Hygr, arsB, Acr3_1 and Acr3_2 mutated This study
 E. coli S17-1 Conjugation donor strain [34]
 E. coli DH5-α λ ϕ80dlacZ°M15 °(lacZYA-argF)U169 recA1 endA1 hsdR17(rk mk ) supE44 thi-1 gyrA relA1 Promega
 E. coli AW3110 K12 F- IN(rrnD-rrnE) Δars::cam [7]
Plasmids
 pK18::mob pUC18 derivative; lacZα Kanr; mob site; suicide vector [35]
 pTE-10M0X pTE-MCS derivative; Hygr Addgene
 pBBR1MCS-5 pBBR1MCS derivative; Gmr [17]
 pGEM-T Easy Ampr; T-tailed PCR product cloning vector; lacZ Promega
 pJQ200SK Suicide vector; sacB; Gmr ATCC
 pAcr3 pJQ200SK derivative carrying the gene Acr3_1 This study
 pAcr3 ::Hyg pJQ200SK derivative carrying the gene Acr3_1 disrupted by the insertion of Hygr cassette This study
 parsB pK18::mob derivative carrying the gene arsB This study
 parsB::Gm pK18::mob derivative carrying the gene arsB disrupted by the insertion of Gmr cassette This study
 pAcr3_2 pJQ200SK derivative carrying the upstream and the downstream fragments of the gene Acr3_2 This study

LMG, Laboratorium voor Microbiologie, Universiteit Gent.

ATCC, American Type Culture Collection.

Sequencing of Ochrobactrum tritici SCII24T genome

O. tritici SCII24T was isolated and the purified DNA was directly sequenced using Illumina (California, USA). Raw data was assembled using the assembly program Edena V3, and assembly coverage >8 was the standard for the assessment of high quality assembly. The assembled contigs were submitted to the RAST (Rapid Annotation using Subsystems Technology) annotation server for subsystem classification and functional annotation [16]. By using RAST, genes were annotated according to functional domains, recognized in multiple databases, grouped in functional subsystems, and divided in hypothetical and non-hypothetical genes. Arsenic related coding sequences (CDSs) were assigned using BLASTp with KEGG Orthology (KO). The nucleotide sequence of operon ars3, sequenced in this work, has been deposited in the GenBank database under accession number KP214556.

Construction of Ochrobactrum tritici SCII24T mutants

Bacterial strains and plasmids used in this work are indicated in Table 1. The first single arsB mutant was constructed by disruption of the arsB gene through insertion of a gentamycin resistance cassette (Gmr) into its unique NotI restriction site. Therefore, arsB gene was amplified by PCR from the type strain O. tritici SCII24T using the specific primers containing additional XbaI/HindIII recognition sites, xbaarsBf—TCTAGAATGCTGGCTGCCCTGCTGAT and hindarsBr—AAGCTTTCAGACAACACTGAGTCTCA. The PCR product (≈ 1300 bp) was digested with XbaI and HindIII enzymes, and cloned into the suicide vector pK18mob previously digested with the same enzymes, resulting in the plasmid parsB. The Gmr cassette (≈ 900 bp) was amplified from plasmid PBBR1MCS-5 [17] using the primers that incorporated the NotI recognition site. The obtained fragment was then digested with NotI enzyme and ligated to parsB, generating the vector parsB::Gm. This plasmid was transformed into E. coli S17-1 and transferred to the recipient strain O. tritici SCII24T by biparental conjugation using the filter mating method [18]. Double-crossover transconjugants were selected on LB plates with ampicillin and gentamicin. Positive mutants were confirmed by PCR using the specific primers used to amplify the arsB and the Gmr genes. Single Acr3_1 mutant was constructed by disruption of the Acr3_1 gene through insertion of a hygromycin resistance cassette (Hygr) into its unique PstI restriction site. The Acr3_1 gene was amplified by PCR from the type strain O. tritici SCII24T using specific primers, xbaAcr3f—TCTAGAAGTTCCACTTTCGAAC and hindAcr3r—AAGCTTTCAGAGTTTTCCTGTTTCGC. The PCR product (≈ 1000 bp) was cloned into pGEM-T Easy vector and digested with NotI. The released Acr3_1 fragment was then cloned into NotI site of the suicide vector pJQ200SK, resulting in the plasmid pAcr3_1. The Hygr cassette (≈ 1500 bp) was amplified from plasmid pTE-10M0X with primers that incorporated the PstI recognition site. The obtained fragment was digested with PstI enzyme and ligated to pAcr3_1, generating the plasmid pAcr3_1::Hyg. This construct was subsequently transformed into E. coli S17-1 and transferred to the recipient strain O. tritici SCII24T by biparental conjugation. Double-crossover transconjugants were selected on LB plates with ampicillin, hygromycin and sucrose. Positive mutants were confirmed by PCR using the specific primers to amplify the Acr3_1 and Hygr genes. Single Acr3_2 mutant was obtained by removing part of the newly annotated gene Acr3_2. In order to do it, the initial gene portion of 300bp amplified by specific primers, xbaAcr3’up-f—TCCTCTAGACGGCGTGCTTCTCGGCACAGT and pstAcr3’up-r—GACCTGCAGAGGAAGAACCAAGCGTAAACG and the terminal gene portion of 300 bp amplified using the specific primers, pstAcr3’down-f—GACCTGCAGCGATCACGCTGGCTGCGCTGC and xhoAcr3’down-r—GACCTCGAGACTGGAACCTCAACGAGAGGA were digested with the pair of enzymes respective. These fragments were cloned into pJQ200sk vector at the XbaI/PstI and PstI/XhoI restriction sites, originating the construct pAcr3_2. This plasmid was subsequently transformed into E. coli S17-1 and transferred to the recipient strain O. tritici SCII24T, and the transconjugants were selected on LB plates with ampicillin and sucrose. Positive mutants were confirmed by PCR using the specific primers to amplify the Acr3_2 gene. Double arsB/Acr3_2 mutant was constructed in order to disrupt both arsB and Acr3_2 genes. The pAcr3_2 plasmid was transformed into E. coli S17-1 and transferred to the recipient Acr3_2 mutant. Transconjugants were selected on LB plates with ampicillin, gentamicin and sucrose. Positive mutants were confirmed by PCR using the specific primers to amplify the arsB and Acr3_2 genes. Double arsB/Acr3_1 mutant was constructed using the previous strategies to disrupt both arsB and Acr3_1 genes. Thus, suicide plasmid parsB::Gm transformed in E. coli S17-1 was used to conjugate with the recipient strain Acr3_1 mutant. Transconjugants were selected on LB plates with ampicillin, hygromycin and gentamicin. Positive mutants were confirmed by PCR. Triple arsB/Acr3_1/Acr3_2 mutant was created by disrupting all three efflux bombs, arsB, Acr3_1 and Acr3_2. The pAcr3_2 plasmid was transformed into E. coli S17-1 and transferred to the recipient arsB/Acr3_1 mutant. Transconjugants were selected on LB plates with ampicillin, hygromycin, gentamicin and sucrose, and positive mutants were confirmed by PCR with specific primers to amplify the three genes.

Arsenite resistance assays

Arsenite resistance was determined by the clonogenic assay. Mutated and non-mutated O. tritici strains were grown in LB to an O.D. 600 nm of 0.2. Serial dilutions of each culture were prepared in NaCl 0.85% and were plated in triplicate on LB plates supplemented with increasing concentrations of As(III) [from 0 mM to 50 mM As(III)] and with the respective antibiotics. Plates were incubated at 35°C, and colonies were counted after 2–3 days. Differences between mutants and wild type O. tritici were also verified in Petri dishes, by evenly swabbing the cultures on agar plates with corresponding antibiotics, and pressing filter discs saturated with increasing arsenite concentrations (0 mM, 100 mM, 250 mM and 500 mM). After 2 days of incubation, differences in the arsenite sensitivity of the strains were evaluated by analysis of the growth inhibition halos around the discs.

Arsenic uptake assays

The uptake assays were made by exposing the strains to arsenic in the form of As(III) or As(V). In the arsenate uptake assays, E. coli AW3110, a strain non-resistant to arsenic (7), was used as control. Briefly, overnight-grown cultures of wild O. tritici SCII24T or As-mutants and E. coli AW3110 were diluted in 250 mL of a new LB medium supplemented with the respective antibiotics, and grown to exponential phase (± 0.5 O.D. 600 nm). Cultures were harvested by centrifugation at 4000 rpm for 30 min, and resuspended in 250 mL of CDM. Uptake assays were initiated by adding 1 mM As(III), 5 mM As(III) or 5 mM As(V) to the cellular suspensions, followed by incubations at 35°C, 150 rpm for 3 hours. After incubation, bacterial suspensions were harvested by centrifugation, washed twice with ice cold PBS (8 g/L NaCl, 0.2 g/L KCl, 1.44 g/L Na2HPO4, 0.24 g/L KH2PO4, pH 7.4) and resuspended in 2 mL of H2O:HNO3 10% (1:1). Cells were disrupted by freezing at -20°C for 10 min, followed by heating at 50°C for 60 to 120 min until no clump was observed, and then cells were centrifuged at 4000 rpm for 30 min, at 4°C. The supernatants were collected into new centrifuge tubes and used for the arsenic measurements. Resultant pellets were dissolved in 1 mL of NaOH 0.5 M, heated at 37°C for 30 min, and used for protein quantification. Total arsenic was analyzed by Inductively Coupled Plasma Mass Spectrometry (ICP-MS) in an ICP-MS Thermo X Series, and total protein was determined using the Bradford assay [19]. Intracellular arsenic content was expressed as nanogram of As per microgram of total cellular protein. Accumulation of arsenite inside the cells was also evaluated by Scanning Electron Microscopy (SEM) and Electron Probe Microanalysis Analysis (EPMA). For this procedure, exponentially grown cells were incubated for 3 hours in a CDM medium contaminated with 1 mM As(III) or 5 mM As(V), as described above. Then, cells were collected and placed onto an appropriate stainless steel support. Cells were dried, fixed with glutaraldehyde 2.5%, and dehydrated with increasing concentrations of ethanol solutions (70, 80, 90, 95 and 100%). After complete evaporation of the solvent, samples were sputtered coated with 30 nm of gold for SEM observations, secondary electron mode, in a Philips XL30 equipment with 10 kV beam. The same samples were used to perform elemental map distribution of As, in a 50x50 μm2 area, in a Cameca, Camebax SX50 EPMA equipment with 10 kV beam.

Results

Ochrobactrum tritici SCII24T genome sequencing and genes annotation

The genome of O. tritici SCII24T was sequenced using Illumina. Annotation of the genes confirmed the presence of the arsenic resistance genes arsB and Acr3_1 already identified in this strain, included in two different chromosomally located arsenic resistance operons [11]. Besides these two arsenic efflux systems, it was also possible to identify a third possible operon probably involved in arsenic resistance that was named putative operon ars3 (Fig 1). This one, detected in a contig carrying ParA, IncI, IncF and repC genes, comprised nine open reading frames (ORFs) and five of them showed high homology with genes already found in arsenic resistance determinants and is probably plasmid located. The first gene of this genetic region, arsC3, encoded a predicted protein of 176 aa with 98% identity and 96% similarity to an ArsR from Agrobacterium tumefaciens (WP_020810063), and also with 84% identity and 94% similarity to an ArsC from A. tumefaciens (CDN92172). The second gene, asrC4, encoded a protein of 145 aa with 96% identity and 96% similarity to an ArsC from A. tumefaciens (WP_020810062). The next gene, Acr3_2, encoded a protein of 346 aa with 95% identity and 96% similarity to an arsenic resistance protein ArsB from A. tumefaciens (WP_020810061). Downstream, the gene arsH2 was found, encoding a protein of 236 aa with 94% identity and 97% similarity to a NADPH-dependent FMN reductase from A. tumefaciens (WP_020810058). The last gene of the putative operon ars3 was arsR4, which encoded a protein of 120 aa with 91% identity and 94% similarity to an ArsR from A. tumefaciens (WP_020810055). Alignment of these new genes with those from operons ars1 and ars2 revealed that the currently identified arsR4 showed higher homology with arsR3 (70% similarity) than with the other previously identified regulators of the strain. Also, arsC3 was more similar to arsC1 (76% similarity) while arsC4 was more similar to arsC2. On the other hand, arsH2 was very similar to arsH1, exhibiting 72% of homology. Therefore, the putative operon ars3 showed an arrangement very similar to the operon ars2.

Fig 1. Genetic organizations of the three ars operons present in strain Ochrobactrum tritici SCII24T.

Fig 1

Gene orientations are shown by arrows. Pattern field arrows are representative of putative genes with unknown functionality. Mutation sites are indicated by inverted triangles. Gmr and Hygr mean the insertion of gentamycin and hygromycin resistance cassettes, respectively and X means deletion of partial gene sequence.

Arsenite resistance assays

To functionally characterize the interplay between the products of the resistance determinants, mutated and non-mutated strains were tested for arsenite resistance. Bacterial growth was evaluated in solid medium LB with As(III) concentrations ranging from 0 mM to 50 mM (Fig 2). O. tritici SCII24T and Acr3_1 or Acr3_2 mutants were able to grow up to 50 mM of arsenite. However, they showed a partial inhibition at very high concentrations of As(III) (i.e. > 20 mM). On the other hand, arsB and arsB/Acr3_2 mutants exhibited lower resistance capacity than the wild strain, since they were unable to grow at As(III) concentrations above 5 mM. Moreover, at low As(III) concentrations (< 5 mM) these mutants showed lower survival rates than the wild-type strain. The double arsB/Acr3_1 or triple arsB/Acr3_1/Acr3_2 mutants were not able to grow above 1 mM As(III), being the most arsenite sensitive mutants obtained. Differences in As(III) sensitivity between wild-type O. tritici SCII24T and mutants were also evaluated in Petri dishes, by growing strains in solid LB medium and by using a filter disk assay (Fig 3). The comparison of the inhibition halos revealed that arsB/Acr3_1 or arsB/Acr3_1/Acr3_2 mutants were the most As(III) susceptible strains.. Single arsB and double arsB/Acr3_2 mutants also showed As(III) sensibility, particularly in the presence of discs saturated with concentrations higher than 250 mM, although not as evident as for the arsB/Acr3_1 or arsB/Acr3_1/Acr3_2 mutants.

Fig 2. Clonogenic survival at different arsenite concentrations of strains O. tritici SCII24 (■), arsB mutant (●), Acr3_1 mutant (Δ), Acr3_2 mutant (◊), arsB/Acr3_2 mutant (*), arsB/Acr3_1 mutant (◆) and arsB/Acr3_1/Acr_2 mutant (□).

Fig 2

The cultures were spread on LB plates contaminated with different As(III) concentrations and the colonies were counted after 2–3 days of incubation at 35°C. Data shown are the mean values (± standard deviations) obtained from three independent experiments.

Fig 3. Growth of strains O. tritici SCII24 (A), Acr3_1 mutant (B), Acr3_2 mutant (C), arsB mutant (D), arsB/Acr3_2 mutant (E), arsB/Acr3_1 mutant (F) and arsB/Acr_1/Acr_2 mutant (G) on LB medium containing filter discs saturated with diverse arsenite concentrations, after 2 days of incubation at 35°C.

Fig 3

Numbers inside filters indicate the corresponding metal concentration used in each filter (0 mM, 100 mM, 250 mM and 500 mM As(III)).

Arsenite uptake assays

The capacity of mutated and non-mutated strains to accumulate arsenic was evaluated by exposing them to 1 mM or 5 mM of As(III) for 3 hours (Fig 4). These assays were only performed with the wild-type O. tritici SCII24T, the single arsB and Acr3_1 mutants and the double arsB/Acr3_1 mutant, because the results obtained from the arsenite resistance assays indicated no function for Acr3_2 gene. In the presence of low arsenite concentrations (1 mM) the double arsB/Acr3_1 mutant was able to accumulate up to 17 ng(As)/ng protein, while the wild-type O. tritici and the single arsB or Acr3_1 mutants accumulated only about 2 ng(As)/mg protein. After the accumulation tests, all cells showed viability. However, in assays with higher concentrations of arsenite (5 mM), arsB mutant accumulated up to 10 ng(As)/mg protein. Double arsB/Acr3_1 mutant was not tested in this condition since this mutant could not resist concentrations above 1 mM As(III). Both wild-type O. tritici and the double arsB/Acr3_1 mutant did not change their cell morphology at low arsenite concentrations (Fig 5). Moreover, the higher capacity of this double mutant to accumulate arsenic was visible in the elemental map distributions (small inserts in Fig 5) where the density of the As-specific signal was higher.

Fig 4. Arsenic uptake by O. tritici type strain and mutants.

Fig 4

Exponential growing cells were exposed to (A) 1 mM,(B) 5 mM arsenite and (C; D) 5 mM arsenate for 3 h. Data shown are the mean values (± standard deviations) obtained from three independent experiments. (*) symbol above bars indicate significant differences between samples (P < 0.05).

Fig 5. SEM micrographs of arsenic uptake by O. tritici type strain and double arsB/Acr3_1 mutant.

Fig 5

Exponentially grown O. tritici incubated for 3 h in the presence of 1 mM As(III) (B) and in the presence of 5 mM As(V) (C), and exponentially grown arsB/Acr3_1 mutant incubated for 3 h in the presence of 1 mM As(III) (E) and in the presence of 5 mM As(V) (F). Figures A and D are controls where O. tritici and the double mutant were grown without metal, respectively. Small charts inscribed inside represent a 50x50 μm2 area of the elemental map distribution of arsenic inside the cells (where blue corresponds to the presence of As).

Arsenate uptake assays

Wild-type O. tritici, the single arsB or Acr3_1 mutants and the double arsB/Acr3_1 mutant were also tested for their capacity to accumulate arsenic by subjecting them to 5 mM of As(V) for 3 hours (Fig 4). In this case, an arsenic sensitive strain, E. coli AW3110, was used as control and its capacity to take up arsenate was also evaluated. Results showed a significant difference concerning the values of arsenic accumulated by E. coli AW3110, O. tritici and mutants. E. coli accumulated about 140-fold more arsenic [420 ng(As)/mg protein] than O. tritici and its mutants that accumulated only about 3 ng(As)/mg protein. It was also possible to observe that no morphological changes were visible for O. tritici and arsB/Acr3_1 mutant grown in the presence of As(V) when compared with assays without exposition to the metalloid (Fig 5). In contrast, numerous E. coli AW3110 cells were lysed or degraded when grown in the presence of As(V) (data not shown). The elemental map distribution of As for the wild-type strain and arsB/Acr3_1 mutant are very similar in the cells incubated with and without metal, indicating that the concentration of the accumulated As(V) is lower than the detection limit of the EPMA equipment.

Discussion

O. tritici SCII24T can be considered one of the most arsenic resistant microorganisms ever reported [11]. In this organism, the two ars operons (ars1 and ars2) previously characterized comprise a large number of genes related to the bacterial ability to resist arsenic [11]. Among these genes, arsB and Acr3_1 encode two different arsenite efflux pumps.

The main objective of this work was to design and construct a strain with abilities to resist and accumulate arsenic in order to be used as a tool for bioremediation. Such a strain should resist high arsenic concentrations, should have an increased ability to take up arsenic ions from the environment and have a reduced efflux of arsenite. Several studies have shown that the inactivation of metal efflux proteins resulted in strains with enhanced metal bioaccumulation ability, which could be seen as a useful tool to include in a bioremediation strategy [11,20,21]. In this sense, the present study was designed in order to inactivate in O. tritici SCII24T all arsenic efflux pumps to obtain a mutant with reduced capacity to extrude arsenite and therefore, able to keep this metal sequestered into cells.

In the first step of this work, the draft genome sequence of O. tritici SCII24T was performed and an additional probable operon (ars3) was identified, with a genetic arrangement highly similar to ars2. The genes considered most likely responsible to encode for proteins able to pump arsenite, conferring resistance to arsenic ions, were the arsB, Acr3_1, and Acr3_2 genes.

Six different mutants (single, double or triple mutants) of O. tritici were successfully constructed, and their behaviour in presence of arsenic species was evaluated to identify the most efficient arsenic bioaccumulator. Both, single Acr3 mutants as well as the wild O. tritici strain were able to grow at very high As(III) concentrations compared to the other mutants. On the other hand, arsB and arsB/Acr3_2 mutants showed a moderate response to arsenite while arsB/Acr3_1 and arsB/Acr3_1/Acr3_2 mutants showed the lowest arsenite resistance ability. Mutation of arsB gene had a more expressive effect on the bacteria than mutation of Acr3_1 or Acr3_2 genes, supporting the previous conclusion that ArsB pump is the major contributor to bacterial arsenite resistance in O. tritici SCII24T [11]. In fact, as arsB belongs to a gene cluster arsRDAcbsB, ArsB protein pump becomes associated with the ArsA-ATPase, forming a more efficient As(III) efflux pump than ArsB or ACR3 without an associated ATPase [22]. Therefore, the different resistance levels conferred by the presence of arsB or Acr3 alone, comparatively to arsB associated with arsA, have been explained by the fact that thermodynamically, secondary carriers using membrane potential to export arsenite are less efficient systems than ATPase-associated systems [23].

Additionally, in this O. tritici SCII24T strain, mutation of the genes coding for the two secondary carrier proteins (ACR3) led to two different arsenite phenotypes. Double mutation of arsB and Acr3_1 genes resulted in a mutant with remarkably low As(III) resistance, while the double mutant of arsB and Acr3_2 genes did not show a more sensitive phenotype compared to the single arsB mutant. Moreover, the construction of the triple mutant did not result in a mutant more sensitive to arsenite than the double arsB/Acr3_1 mutant. Therefore, it seems that the newly found Acr3_2 gene has no effective role in the mechanism of arsenite resistance in O. tritici. The results on the As(III) sensitivity of the mutants also support the fact that both genes (arsB and Acr3_1) play a crucial role in this resistance mechanism. In fact, depending on the surrounding conditions, the genes might play different roles. For As(III) concentrations equal to or higher than 5 mM, arsB gene seems to play a crucial role in the resistance ability of the strains and for As(III) concentrations lower than 5 mM, Acr3_1 gene expression is enough for the resistance of the strains. The presence of multiple copies of the arsenic related genes in individual bacterial genomes is not new, as for instance in Herminiimonas arsernicoxydans [24]; Corynebacterium glutamicum [2] and Leptospirillum ferriphilum [25]. In the most recent years, the rapid development of high-throughput sequencing technology led to the identification of a large number of microbial genomes. Consequently, the access to nearly whole information about the arsenic-related genes of these strains was possible [26]. This bioinformatic analysis often results in data related to abundance and organization of arsenic-related operons but do not provide any evidence about their functionality.

The capacity of strains to accumulate arsenic was different among the mutants. For low As(III) concentrations (1 mM), the double arsB/Acr3_1mutant was able to accumulate several times more arsenic than the remaining strains. For higher As(III) concentrations (5 mM), where this double mutant was not able to grow, the single arsB mutant was able to accumulate the highest amount of arsenic. Moreover, our double arsB/Acr3_1 mutant, at a concentration of 7.5 μg/mL protein, was sufficient to remove around 120 ppb of As(III) in 3 hours, being more efficient in arsenic accumulating than other studied strains such as C. glutamicum [21] or E. coli [27,28]. Therefore, this bioengineered strain showed a great potential to be used in arsenic bioremediation.

As arsenite and arsenate have different pathways to enter the cell [3], strains were also evaluated regarding their capacity to take up arsenic in the form of arsenate. Cells of E. coli AW3110 were significantly more efficient at taking up arsenate than wild O. tritici or mutants (about 140-fold more arsenic). As E. coli AW3110 is a strain silenced for the ars genes, it is unable to extrude arsenic resulting in an hyper-accumulation of arsenate inside cells and, therefore, in hyper-sensitivity to arsenic [7]. However, in the case of O. tritici SCII24T and their mutants, no notable difference in the capacity of taking up arsenate was observed, and even the arsB/Acr3_1mutant, when incubated with arsenate, was not able to accumulate arsenic, despite the inactivation of both efflux proteins. It is possible that in O. tritici SCII24T, and, in consequence, in all mutants, arsenate does not enter the cell via the common phosphate transport system, PitA [3]. Exploring the draft genome of O. tritici, no Pit system was found. However, the other phosphate-specific transport system, Pst, was identified. It is reported that Pst system is a high-affinity phosphate transport system that differentiates between phosphate and arsenate approximately 100 fold more accurately than PitA [29]. In this strain, most probably, the Pst system discriminates between phosphate and the larger arsenate ions, preventing the entry of As(V), as was already reported for Halomonas GFAJ-1 [30]. Nevertheless, other possible mechanisms in O. tritici capable of detoxifying arsenate cannot be overruled.

Processes of bioremediation have gained increasing interest and biological approaches have been developed to deal with the arsenic contamination problem using bioaccumulation or biosequestration abilities of bacteria [15]. A few genetically modified microorganisms have been developed to yield high accumulation of arsenic by expression of intracellular arsenic-binding proteins [27,31]. Accumulator microorganisms have been used in consortiums with bacteria able to oxidize As(III) to As(V) to bioremediate arsenic more efficiently [21]. In this sense, O. tritici arsB/Acr3_1 mutant is a very interesting alternative tool for arsenite bioremediation, since it gathers several features to deal with arsenic. First, the presence of the arsenite oxidase system AioAB [12] allows a rapid oxidation of As(III) to As(V), which is far less mobile and therefore less toxic than As(III) [32,33]. Secondly, the double mutant would be able to uptake the remaining As(III) from medium which would be maintained inside cells.

In conclusion, this work, with the construction of the different mutants, demonstrated a relationship between the genetic determinants coding for the arsenite pumps and the arsenic resistance. Moreover, it contributed to produce an alternative solution for arsenic removal across a wide range of conditions. Such bacteria could represent an effective way to remove arsenic from contaminated sites. Its in-field application is normally target of some important issues that are being studied to be solved.

Data Availability

All relevant data are within the paper.

Funding Statement

This research was funded by FEDER through the program COMPETE and by national funds through FCT, Fundação para a Ciência e a Tecnologia, under projects PEst- 496C/EME/UI0285/2014 and CENTRO-07-0224-FEDER- 497 002001 and PTDC/BIA-MIC/114958/2009. TS is funded by a scholarship of the project. RB is funded by a post-doc grant (SFRH/BPD/48330/2008). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1. WHO (2010) Exposure to arsenic: a major public health concern In: Preventing disease through healthy environments. Geneva, Switzerland. [Google Scholar]
  • 2. Ordóñez E, Letek M, Valbuena N, Gil JA, Mateos LM (2005) Analysis of genes involved in arsenic resistance in Corynebacterium glutamicum ATCC 13032. Appl Environ Microbiol 71: 6206–6215. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Mukhopadhyay R, Rosen BP, Phung LT, and Silver S (2002) Microbial arsenic: from geocycles to genes and enzymes. FEMS Microbiol Rev 26: 311–325. [DOI] [PubMed] [Google Scholar]
  • 4. Rosen BP (2002) Biochemistry of arsenic detoxification. FEBS Lett 529: 86–92. [DOI] [PubMed] [Google Scholar]
  • 5. Bhattacharjee H, Rosen BP (2007) Arsenic metabolism in prokaryotic and eukaryotic microbes In: Nies DH, Silver S, editors. Molecular microbiology of heavy metals. Springer-Verlag, Berlin, Heidelberg: pp.371–406. [Google Scholar]
  • 6. Rosen BP (1999) Families of arsenic transporters. Trends Microbiol 7: 207–212. [DOI] [PubMed] [Google Scholar]
  • 7. Carlin A, Shi W, Dey S, Rosen BP (1995) The ars operon of Escherichia coli confers arsenical and antimonial resistance. J Bacteriol 177: 981–986. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Bruhn DF, Li J, Silver S, Roberto F, Rosen BP (1996) The arsenical resistance operon of IncN plasmid R46. FEMS Microbiol Lett 139: 149–153. [DOI] [PubMed] [Google Scholar]
  • 9. Sato T, Kobayashi Y (1998) The ars operon in the skin element of Bacillus subtilis confers resistance to arsenate and arsenite. J Bacteriol 180: 1655–1661. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Wysocki R, Bobrowicz P, Ulaszewski S (1997) The Saccharomyces cerevisiae ACR3 gene encodes a putative membrane protein involved in arsenite transport. J Biol Chem 272: 30061–30066. [DOI] [PubMed] [Google Scholar]
  • 11. Branco R, Chung AP, Morais PV (2008) Sequencing and expression of two arsenic resistance operons with different functions in the highly arsenic-resistant strain Ochrobactrum tritici SCII24T. BMC Microbiol 8: 95 10.1186/1471-2180-8-95 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Branco R, Francisco R, Chung AP, Morais PV (2009) Identification of an aox system that requires cytochrome c in the highly arsenic-resistant bacterium Ochrobactrum tritici SCII24. Appl Environ Microbiol 75: 5141–5147. 10.1128/AEM.02798-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Lièvremont D, Bertin PN, Lett MC (2009) Arsenic in contaminated waters: biogeochemical cycle, microbial metabolism and biotreatment processes. Biochemie 91: 1229–1237. [DOI] [PubMed] [Google Scholar]
  • 14. Dhuldhaj UP, Yadav IC, Singh S, Sharma NK (2013) Microbial interactions in the arsenic cycle: adoptive strategies and applications in environmental management. Rev Environ Contam Toxicol 224: 1–38. 10.1007/978-1-4614-5882-1_1 [DOI] [PubMed] [Google Scholar]
  • 15. Kruger MC, Bertin PN, Heipieper HJ, Arsène-Ploetze F (2013) Bacterial metabolism of environmental arsenic—mechanisms and biotechnological applications. Appl Microbiol Biotechnol 97: 3827–3841. 10.1007/s00253-013-4838-5 [DOI] [PubMed] [Google Scholar]
  • 16. Aziz RK, Bartels D, Best AA, DeJongh M, Disz T, Edwards RA, et al. (2008) The RAST Server: rapid annotations using subsystems technology. BMC Genomics 9: 75 10.1186/1471-2164-9-75 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Kovach ME, Elzer PH, Hill DS, Robertson GT, Farris MA, Roop RM 2nd, et al. (1995) Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene 166: 175–176. [DOI] [PubMed] [Google Scholar]
  • 18. De Lorenzo V, Timmis KN (1994) Analysis and construction of stable phenotypes in gram-negative bacteria with Tn5- and Tn10-derived minitransposons. Methods Enzymol 235: 386–405. [DOI] [PubMed] [Google Scholar]
  • 19. Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248–254. [DOI] [PubMed] [Google Scholar]
  • 20. Mateos LM, Ordóñez E, Letek M, Gil JA (2006) Corynebacterium glutamicum as a model bacterium for the bioremediation of arsenic. Int Microbiol 9: 207–215. [PubMed] [Google Scholar]
  • 21. Villadangos AF, Ordóñez E, Pedre B, Messens J, Gil JA, et al. (2014) Engineered coryneform bacteria as a bio-tool for arsenic remediation. Appl Microbiol Biotechnol 98: 10143–10152. 10.1007/s00253-014-6055-2 [DOI] [PubMed] [Google Scholar]
  • 22. Rensing C, Rosen BP (2009) Heavy metals cycles (arsenic, mercury, selenium, others) In: Schaechter M editor. Encyclopedia of microbiology. Oxford, UK: pp.205–219. [Google Scholar]
  • 23. Xu C, Zhou T, Kuroda M, Rosen BP (1998) Metalloid resistance mechanisms in prokaryotes. J Biochem 123: 16–23. [DOI] [PubMed] [Google Scholar]
  • 24. Muller D, Médigue C, Koechler S, Barbe V, Barakat M, Talla E, et al. (2007) A tale of two oxidation states: bacterial colonization of arsenic-rich environments. PLoS Genet. 3: 53. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Tuffin IM, Hector SB, Deane SM, Rawlings DE (2006) Resistance determinants of a highly arsenic-resistant strain of Leptospirillum ferriphilum isolated from a commercial biooxidation tank. Appl Environ Microbiol 72: 2247–2253. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Li X, Zhang L, Wang G (2014) Genomic evidence reveals the extreme diversity and wide distribution of the arsenic-related genes in Burkholderiales . PLoS ONE 9: 92236. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Kostal J, Yang R, Wu CH, Mulchandani A, Chen W (2004) Enhanced arsenic accumulation in engineered bacterial cells expressing ArsR. Appl Environ Microbiol 70: 4582–4587. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Singh S, Mulchandani A, Chen W (2008) Highly selective and rapid arsenic removal by metabolically engineered Escherichia coli cells expressing Fucus vesiculosus metallothionein. Appl Environ Microbiol 74: 2924–2927. 10.1128/AEM.02871-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Oremland RS, Newman DK, Kall BW, Stolz JF (2002) Bacterial respiration of arsenate and its significance in the environment In: Frankenberger WT, editor. Environmental chemistry of arsenic. Marcel Dekker Inc, New York: pp.273–295. [Google Scholar]
  • 30. Elias M, Wellner A, Goldin-Azulay K, Chabriere E, Vorholt JA, Erb TJ, et al. (2012) The molecular basis of phosphate discrimination in arsenate-rich environments. Nature 491: 134–137. 10.1038/nature11517 [DOI] [PubMed] [Google Scholar]
  • 31. Tsai SL, Singh S, Chen W (2009) Arsenic metabolism by microbes in nature and the impact on arsenic remediation. Curr Opin Biotechnol 20: 659–667. 10.1016/j.copbio.2009.09.013 [DOI] [PubMed] [Google Scholar]
  • 32. Hughes MF (2002). Arsenic toxicity and potential mechanisms of action. Toxicol Lett 133: 1–16. [DOI] [PubMed] [Google Scholar]
  • 33. Su C, Wilkin RT (2005) Arsenate and arsenite sorption on and arsenite oxidation by iron(II, III) hydroxycarbonate green rust In: O'Day, Vlassopoulos, Meng, Benning editors. Advances in arsenic research. ACS Symp Series; Washington, DC: pp.25–40. [Google Scholar]
  • 34. Schäfer A, Tauch A, Jäger W, Kalinowski J, Thierbach G, Pühler A (1994) Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum . Gene 145: 69–73. [DOI] [PubMed] [Google Scholar]
  • 35. Simon R, Priefer U, Pühler A (1983) A broad host range mobilization system for in vivo genetic engineering—transposon mutagenesis in Gram negative bacteria. Nat Biotechnol.1: 784–791. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All relevant data are within the paper.


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES