Skip to main content
PMC home page
PLOS ONE logoLink to PLOS ONE
. 2015 Jul 2;10(7):e0132183. doi: 10.1371/journal.pone.0132183

Screening for Suitable Reference Genes for Quantitative Real-Time PCR in Heterosigma akashiwo (Raphidophyceae)

Nanjing Ji 1, Ling Li 1, Lingxiao Lin 1, Senjie Lin 1,2,*
Editor: Ken Mills3
PMCID: PMC4489630  PMID: 26133173

Abstract

The raphidophyte Heterosigma akashiwo is a globally distributed harmful alga that has been associated with fish kills in coastal waters. To understand the mechanisms of H. akashiwo bloom formation, gene expression analysis is often required. To accurately characterize the expression levels of a gene of interest, proper reference genes are essential. In this study, we assessed ten of the previously reported algal candidate genes (rpL17-2, rpL23, cox2, cal, tua, tub, ef1, 18S, gapdh, and mdh) for their suitability as reference genes in this species. We used qRT-PCR to quantify the expression levels of these genes in H. akashiwo grown under different temperatures, light intensities, nutrient concentrations, and time points over a diel cycle. The expression stability of these genes was evaluated using geNorm and NormFinder algorithms. Although none of these genes exhibited invariable expression levels, cal, tub, rpL17-2 and rpL23 expression levels were the most stable across the different conditions tested. For further validation, these selected genes were used to normalize the expression levels of ribulose-1, 5-bisphosphate carboxylase/oxygenase large unite (HrbcL) over a diel cycle. Results showed that the expression of HrbcL normalized against each of these reference genes was the highest at midday and lowest at midnight, similar to the diel patterns typically documented for this gene in algae. While the validated reference genes will be useful for future gene expression studies on H. akashiwo, we expect that the procedure used in this study may be helpful to future efforts to screen reference genes for other algae.

Introduction

Harmful algal blooms (HABs) cause significant damages to marine ecosystems, local economies and human health [1–3]. Heterosigma akashiwo (Hada) Hada ex Y. Hara et Chihara is a HAB species within the class Raphidophyceae. This species is distributed worldwide, and is an eurythermal and euryhaline organism [4, 5]. H. akashiwo is notorious because its blooms have caused massive mortality of cultured finfish, but the mechanisms for ichthyotoxicity are not well resolved and remain controversial [6–9]. To understand how H. akashiwo forms blooms [10–13] and how the bloom kill fish, information on the molecular machinery or biochemical processes regulating growth and metabolism in this species is of great importance. Determining gene expression patterns under different environmental conditions is essential toward gaining such understanding.

Quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) is one of the most frequently-used technologies to study the expression patterns of genes, because it offers high sensitivity, specificity, reproducibility and accuracy [14, 15]. However, several variables associated with RNA samples may influence the accuracy of gene expression analysis, such as variations in RNA quantity and quality, enzymatic efficiency of reverse transcription and PCR amplification [16]. One common way to correct the biases caused by these factors is to normalize gene expression data against some properly established reference genes (housekeeping genes) [17–19]. Generally, an ideal reference gene should be expressed at stable levels in different tissues, under different treatments, or under different environmental conditions. Many genes have been used as reference genes, such as 18S ribosomal RNA (18S), glyceraldehyde-3-phosphate dehydrogenase (gapdh) and elongation factor 1α (ef1), simply because they have been shown to be appropriate in some model organisms. But, they have subsequently been found not to be always expressed at stable levels under different conditions in different species [20, 21]. Therefore, it is necessary to establish the suitability of the reference gene(s) for different species or specific types of conditions before use in gene expression studies. Until now, many studies have been carried out using or selecting reference genes in animals and plants [22–24] as well as algae (S1 Table). Yet no comprehensive screening for reference genes for H. akashiwo has been reported.

In this study, the stabilities in expression of ten candidate genes (Table 1), α-tubulin (tua), β-tubulin (tub), cytochrome c oxidase subunit II (cox2), 60S ribosomal protein L17-2 (rpL17-2), 60S ribosomal protein L23 (rpL23), calmodulin (cal), malate dehydrogenase (mdh), 18S, gapdh and ef1 in H. akashiwo were analyzed under four different experimental conditions. As a way to further validate the suitability of the most promising candidate genes identified, the two top-ranked reference genes for diel cycle studies were used to normalize rubisco large subunit (HrbcL) expression levels throughout a diel cycle. A set of four genes was found to be the most suitable as reference genes for all the four conditions we tested, while each condition had its own specific set of top-ranked reference genes.

Table 1. Candidate reference genes and HrbcL examined and their primers used in this study.

Gene symbol Primer sequences (5'→3') Forward/Reverse Amplicon length (bp)
rpL17-2 TACAGCATCAAGGACGAACCC 93
GTTGTGGGCCACCTCTCTCA
rpL23 GGTTTTCCCTGCTGTTGTCA 118
GCCCTTCATTTCACCCTTGT
cox2 CGATGTTTGGCTCTTTACGAC 130
CGAATGAAGGAACTGCGATA
cal GCACCATTGACTTCCCTGAGT 113
ACCGTTGCCATCCTTGTC
tua GCACCTTCTGCCTGGATAAC 174
TGGTCTGGAACTCGGTCATA
tub CTTCAGACCCGACAACTTCG 123
TCAGCCTCCTTTCTCACGAC
ef1 AGTATGCCTGGGTGCTTGAC 105
TGACGGTGTAGTGGAACTTGG
18S TGGTGGAGTGATTTGTCTGG 133
CCCAACTTCCTTCGGTTAGTC
gapdh TACTGCGATGAGCCTTGTGTG 96
GAACTTGGGGTTGAGGGAGA
mdh CCTCGTGATGTGAAGGTTGA 115
GCGTGAGTTCCTCGATGTCT
HrbcL ACCACAACCTGGAGTAGACCC 182
CGTATGCGATGTATGCGAAG
Open in a new tab

Materials and Methods

Heterosigma akashiwo culture and treatment

Heterosigma akashiwo were maintained in a glass bottle with f/2 medium (without added silicate) prepared with 0.22 μm-filtered and autoclaved seawater (salinity 30 PSU). Stock cultures were kept at 20°C under a 14: 10 h light: dark cycle with an average photon flux of 100 ± 10 μE.m-2.s-2. For all experiments, cell concentrations were determined using a Sedgwick-Rafter chamber under the microscope.

For experiments, each treatment group was set up in triplicate. Control group was cultured in normal f/2 medium under the temperature and light conditions as described above. Temperature treatment included exposure to 10°C, 20°C and 30°C, respectively for 24 h. Light treatment consisted of exposure to 200 (high light), 100 (normal light) and 50 μE.m-2.s-2 (low light), respectively for 96 h. For nitrogen (N) and phosphorus (P) stress treatment, the cultures were treated as previously described [25] with minor modification. Briefly, the pre-treatment stock culture in f/2 medium was inoculated to low nutrient media that were either stoichiometrically low in N (181.5 μM NaNO3 and 36.3 μM NaH2PO4.H2O, with 5: 1 of N: P) or low in P (883 μM NaNO3 and 7.06 μM NaH2PO4.H2O, with 125: 1 of N: P) conditions. When these cultures were growing in the exponential phase, they were re-inoculated into fresh batches of their corresponding media. Cell concentration was monitored daily as described above, and when cultures were exhibiting exponential growth again, samples were collected. In addition, to examine the diel patterns of gene expression, the control group cultures were sampled, in which sampling started at 6 h (T6) after the onset of light period (T0), and 12 (T12), 18 (T18), 24 (T24), and 30 (T30) h after T0, throughout a 24-h diel cycle. Samples were collected by centrifugation at 3000 × rpm for 5 min at 4°C. The cell pellets were suspended in 1 mL TRIzol reagent (Invitrogen), and stored at -80°C until RNA extraction within a month.

Total RNA extraction and cDNA synthesis

Total RNA was extracted as recently reported [26] and potential genomic DNA contamination was eliminated by incubating the RNA samples with RQ1 DNase (Promega). RNA was further purified by RNeasy Mini kit (Qiagen). RNA purity and concentration were measured by NanoDrop spectrophotometer (Theromo, Germany), and RNA integrity was evaluated by agarose gel electrophoresis.

The first-strand cDNA was synthesized from 300 ng of total RNA in a total volume of 20 μL using the ImProm-II reverse transcriptase (Promega) with random hexamer primer. The RNA template was first incubated with 0.5 μg of the primer at 70°C for 5 minutes, and then at 4°C for 5 minutes. Next, 4 μL ImProm-II 5 × reaction buffer, 4 μL MgCl2 (25 mM), 1 μL dNTP mix (10 mM each dNTP) and 1 μL ImProm-II reverse transcriptase were added and the mixture was incubated at 25°C for 5 minutes and then 42°C for 1 h. The reaction was terminated by incubating it at 70°C for 15 minutes. The cDNAs were diluted 1: 50 with nuclease-free water before use in subsequent experiments.

Selection of candidate reference genes for study

A group of genes that have been used as reference genes in various algae were summarized in S1 Table. Based on the availability of the sequences from H. akashiwo, we selected eight (tua, tub, 18S, gapdh, rpL23, cal, ef1, and mdh) from this list and added two others (cox2 and rpL17-2) that are functionally related to cox1 and rpL19 in the list to achieve a set of ten candidate genes. The nucleotide sequences of tua (AY729829), tub (AY729817), 18S (JX026930), cox2 (GQ222228), and gapdh (AF319449), were available from GenBank database, and the others were identified from transcriptome data of H. akashiwo [27].

Primer design and evaluation

The primers for qRT-PCR were designed using the Primer Premier 5.0 software and had estimated melt temperature of 57–60°C and amplicon lengths of 80–180 bp (Table 1). To check the specificity of the primers, regular PCR were run and all PCR products were examined on agarose gel for size, and then purified, cloned, and sequenced. For each primer, the PCR amplification efficiency (E) was calculated following E = [10(-1/slope)] × 100%, in which the slope were obtained from the standard curve generated from a serial dilutions of pooled cDNAs [28]. From the same dilution series correlation coefficient (R2) was also calculated.

qRT-PCR

Using the cDNAs as the templates, qRT-PCR was conducted using the CFX96 Real-Time System (Bio-Rad, USA). Each PCR reaction was carried out in a total volume of 12 μL containing 6 μL of 2 × iQ SYBR Green supermix (Bio-Rad, USA), 375 nM of each primer, and 5 μL of 1: 50 diluted cDNA. The PCR program was composed of a denaturation step of 3 min at 95°C, followed by 40 cycles of 95°C for 10 s and 60°C for 32 s. In each run, negative controls were set up with ddH2O and RNA as templates, respectively. Each reaction had three technical replicates. At the end, to confirm primer specificity, all the PCR products were subjected to melting curve analysis.

Gene stability analysis using geNorm and NormFinder

The geNorm [29] and NormFinder [30] software packages were employed to assess the stability of the expression levels of the candidate reference genes under the different experimental conditions. geNorm produces a stability measure (M) and by stepwise exclusion of the genes with the lowest stability creates a ranking of the tested genes (the lower the M value, the more stable the expression of the gene). The number of genes required for normalization of target gene expression also was estimated, and the normalization factor was calculated. NormFinder is a another program used to evaluate the candidate reference genes in given experimental design; it takes into consideration the intra- and inter-group variations and combines these results to estimate a reference gene stability value for each gene, avoiding influence caused by co-regulated candidate genes.

Relative quantification of HrbcL gene expression

Ribulose 1, 5-bisphosphate carboxylase/oxygenase (rbc) is the key enzyme catalyzing CO2 fixation and is thus essential for photosynthetic organism [31]. Diel regulation of rbc transcription has been well documented in many photosynthetic organisms from cyanobacteria, algae, to higher plants [32]. Therefore, we attempted to characterize the diel expression patterns of H. akashiwo rbc large subunit (HrbcL) using the best reference genes (rpL23 and rpL17-2) identified under diel cycle in the present study, as a way to further validate the selected reference genes. The sequence of HrbcL (EU168191) was obtained from GenBank, and primers were designed (Table 1). Relative expression levels of HrbcL were calculated by dividing the raw expression value of HrbcL for each sample by the normalization factor generated by geNorm.

Statistical analyses

All statistical analyses were performed with SPSS (version 16.0). Variations in the Ct values between and within treatments as well as in the relative expression of HrbcL in H. akashiwo were analyzed using one-way ANOVA, and the level of significance was defined at P < 0.05.

Results

RNA quality, primer specificity and amplification efficiencies

RNA samples prepared from H. akashiwo all displayed good quality, with A260/A280 ratios ranging from 1.9 to 2.2, and A260/A230 ranging from 1.9 to 2.1. RNA integrity was confirmed on agarose gel electrophoresis, which showed two discrete bands, one (more abundant) 28S rRNA and another 18S rRNA. Specificities of primers were confirmed by the presence of a single band with the expected size on agarose gel electrophoresis (S1 Fig), the presence of a single peak in melting curve analysis after qRT-PCR (S2 Fig), and sequencing results (S1 File). No product was detected in negative control (ddH2O or RNA as template), indicating that there was no gDNA contamination in the RNA extracts, and the qRT-PCR results were thus reliable. The PCR efficiency (E) of the ten candidate reference genes and Hrbc ranged from 90.1%-101%, and the correlation coefficient (R2) ranged from 0.991 to 0.999, which were within the commonly reported range of qRT-PCR.

Expression profiling of candidate reference genes

In order to investigate the relative expression levels of the ten candidate reference genes in H. akashiwo, the Ct values of these genes were calculated (S2 Table). The Ct median value of reference genes varied from 10.51 to 29.91, and most of the values were between 25.08 and 26.87 across all the samples (Fig 1). The 18S gene showed the highest expression level with Ct value ranging from 8.33 to 13.32 in different samples, while mdh exhibiting the lowest expression level with Ct value ranging from 27.47 to 32.72. Based on the comparative ranges of Ct values, the smallest gene expression variation seemed to occur in tua, while gapdh seemed to be the most variable. However, a simple comparison of the raw Ct value is not sufficient to determine expression stability of the candidate reference genes; therefore, further analyses using geNorm and NormFinder software were conducted to provide more accurate results.

Fig 1. Ct values of candidate reference genes across conditions tested.

Fig 1

Open in a new tab

Boxes show the median values (central lines), Q1 (lower outline) and Q3 (upper outline), and whiskers. The whiskers are set at 1.5 times IQR (interquartile range) above Q3 and 1.5 times IQR below the Q1. If the Maximun or Minimum values are outside this range, they are shown as outliers (*).

Expression stability of candidate reference genes

Average expression stability values (M) were obtained using geNorm, and all candidate genes were ranked based on the M values (Fig 2). All ten genes investigated in this study showed M values below the threshold value 1.5, indicating that the expression levels of these genes were relatively stable under all the conditions we examined. By comparison, as shown in Fig 2, the most stable genes were cal and tub under temperature treatment, 18S and tub under light treatment, rpL17-2 and rpL23 in the diel cycle samples, cal and rpL17-2 under nutrient treatment and all treatments combined (M = 0.488) (Total). We found that gapdh was the least stably expressed under temperature treatment, light treatment, time points over the diel cycle, and total (M = 1.219), and ef1 was the least stably expressed gene under nutrient treatment. In addition, our ANONA analysis showed that the variations in the gapdh and ef1 Ct values were attributable to experimental treatments rather than inconsistencies between replicates, because the between group variance was much higher than the within group variance (S3 Table).

Fig 2. Gene expression stability and ranking of the candidate reference genes as calculated by geNorm.

Fig 2

Open in a new tab

Average expression stability value (M) was calculated by stepwise exclusion of the least stable gene compared across different temperatures (Temperature), different light intensities (Light), different nutrient (N: P) ratios (Nutrient), different time points in the diel cycle (Diel), and the combination of all the samples (Total). In each plot, the least stable gene is on the left, and the most stable gene on the right.

The geNorm software was also used to determine the optimal number of references genes required for accurate normalization, according to the pairwise variation (Vn/Vn+1) value. Vandesompele et al. (2002) proposed 0.15 as a Vn/Vn+1 threshold value, below which the inclusion of an additional control gene is not required [29]. For individual experimental treatment, V2/V3 value was 0.056, 0.117, 0.086 and 0.119 in nutrient, light, temperature and diel time point treatments, respectively (Fig 3). These results indicated that the inclusion of a third gene would not have significant effect for any of the four treatments, so the two most stable reference genes were sufficient for accurate normalization of gene expression under these conditions. When all the samples were considered together, V2/V3, V3/V4 and V4/V5 value were 0.201, 0.167 and 0.145, respectively. Combined with the result of stability ranking, the results showed that the four most stable reference genes, cal, rpL17-2, tub and rpL23, would be sufficient for accurate gene expression normalization for H. akashiwo under any combination of the four conditions.

Fig 3. Determination of the optimal number of reference genes for normalizing gene expression (qRT-PCR) data.

Fig 3

Open in a new tab

Pair-wise variation (Vn/Vn+1, where n represents number of genes) was analyzed between the normalization factors (NFn and NFn+1) by geNorm software against all different conditions examined (nutrient, temperature, light, timing in the diel cycle and all these factors combined).

For an independent assessment, the expression stabilities of reference genes were also ranked by NormFinder (Table 2). The most stable genes were cal for light and nutrient treatments, rpL17-2 for temperature treatment, and rpL17-2 and rpL23 for diel cycle. When all the conditions were considered together, the same five most stable genes (cal, rpL17-2, tub, rpL23, and cox2) were identified by NormFinder as by geNorm, although cox2 was ranked first by NormFinder and fifth by geNorm. NormFinder identified gapdh and ef1 as the most unstable gene across all the conditions, which was consistent with the result from the geNorm.

Table 2. Expression stability values of the candidate reference genes calculated by NormFinder.

Temperature Light Nutrient Diel Total
Ranking a SV b Ranking SV Ranking SV Ranking SV Ranking SV
rpL17-2 0.247 cal 0.130 cal 0.096 rpL23 0.207 cox2 0.353
cox2 0.266 rpL23 0.176 rpL23 0.103 rpL17-2 0.230 tub 0.360
mdh 0.292 18S 0.226 tub 0.111 cox2 0.274 cal 0.361
cal 0.300 tub 0.234 mdh 0.142 cal 0.316 rpL17-2 0.370
ef1 0.319 ef1 0.285 gapdh 0.145 tua 0.405 rpL23 0.473
18S 0.374 tua 0.289 rpL17-2 0.149 ef1 0.570 18S 0.481
tub 0.375 mdh 0.302 18S 0.167 tub 0.576 mdh 0.489
rpL23 0.386 cox2 0.335 cox2 0.209 18S 0.588 tua 0.580
tua 0.390 rpL17-2 0.340 tua 0.234 mdh 0.848 ef1 0.689
gapdh 0.553 gapdh 0.367 ef1 0.408 gapdh 1.741 gapdh 1.020
Open in a new tab

aRanking indicates the genes stability from the most stable to the least stable.

bSV represents stability value.

Diel expression pattern of HrbcL and validation of the reference genes

To evaluate the usefulness of the selected reference genes, we compared the expression pattern of rbcL in H. akashiwo (HrbcL) under diel cycle (sampled every six hours) using the most stable (rpL17-2 and rpL23) and the least stable genes (gapdh and mdh) in the diel cycle among our ten candidate reference genes. When the most stable genes (rpL17-2 and rpL23) were used in combination for normalization, the expression levels of HrbcL decreased rapidly between six hours after the onset of light (T6) and two hours before the end of the light period (T12), reaching the lowest value at four hours after the onset of the dark period (T18), and increased thereafter (Fig 4). A similar expression pattern was observed when either rpL17-1 or rpL23 was used alone for normalization. When the least stable genes (gapdh and mdh) were employed together, the normalized expression levels of HrbcL were not significantly different between time points T12 and T18, and entirely different expression patterns were obtained when either one of these two least stable genes was used for normalization (Fig 4).

Fig 4. Diel pattern of HrbcL expression normalized against different reference genes.

Fig 4

Open in a new tab

Relative expression values shown are mean fold changes compared to T18 samples, with error bars representing standard deviation (data were derived from triplicated biological (culture) samples, each with triple technical (qPCR) replicates). Different alphabets above the bars indicate significant differences at different time points at P < 0.05, while same letters within each plot indicate lack of significant difference. The black horizontal black bars indicate the dark period.

Discussion

Research on H. akashiwo has uncovered its life cycle and ecological characteristics, such as diel vertical migration [33], benthic stage [11], and strong ability to tolerate sudden salinity decrease [12], which may be linked to its ecological success. However, molecular mechanisms underlying these features [34] are poorly understood and need to be investigated. The qRT-PCR technology has been extensively used in the study of marine phytoplankton to understand transcriptional responses to physical stressors [35, 36], nutrient starvation [37], and diel cycle [26, 38, 39], and to detect the activity and modulation of many metabolic processes [39, 40]. As the accuracy of gene expression data is highly dependent on the selection of suitable reference genes for normalizing gene expression against experimental variations, most of those studies used reference genes for the normalization. However, only a small faction of those reference genes has been systematically evaluated to ensure they are suitable for the species under investigation.

In this paper, we conducted careful evaluation on expression stability of ten candidate reference genes, eight of which have been used in previous studies on various organisms. We chose to investigate the effects of temperature, light, and nutrient conditions because they are the most common environmental variable influencing marine phytoplankton. Diel cycle was also examined because sampling for molecular analysis, particularly on research cruises, often occurs at different times of the day. Two widely used analysis programs, geNorm and NormFinder, were used to ensure reliability of gene expression stability assessment. Due to their distinct algorithms, slight differences were observed when the rankings of the candidate reference genes from these two programs were compared. For example, under temperature variations, rpL17-2 was ranked to be the most stable by NormFinder, whereas cal and tub were ranked as the most suitable candidate reference genes by geNorm (Fig 2, Table 2). Corresponding different results have also been reported and discussed in many previous studies [22, 23, 41]. However, both analysis programs produced the same top five most stable genes: cal, rpL17-2, tub, rpL23, and cox2. Therefore, these five can be considered the “short list” of reference genes for common transcriptional studies in H. akashiwo. Based on the below-threshold pairwise variation, V4/V5 value (0.145) and the high frequencies at which these genes were ranked favorable across the four separated sets of conditions, cal, rpL17-2, tub and rpL23 are particularly preferable for use under different environmental stress conditions or diel cycle of H. akashiwo. Picking common top-ranked genes from multiple analysis programs should give high confidence about the selection of the reference genes.

Even for specific environmental conditions or treatments, the picking common-gene approach can be also helpful for identifying best reference genes available. For temperature treatment, for instance, geNorm identified cal and tub as the most stable genes, followed by mdh, 18S, and others (Fig 2), whereas NormFinder ranked rpL17-2 as the best reference gene, followed by cox2, mdh, cal, and others (Table 2). Based on the ranking orders, cal and mdh would be the best choices among the ten examined presently for temperature effect studies. This result agrees with the previous studies on cal and mdh genes in algae. The calmodulin gene has been identified as a stable reference gene in the dinoflagellate Symbiodinium sp. under temperature stress [35], while mdh was shown to be relatively stable in the dinoflagellate Prorocentrum minimum across many experimental conditions (heat shock, toxic chemical exposures and different life stages) [42].

By the same way, we found cal and tub were sufficiently stable to be used for normalizing gene expression under light and nutrient treatments. The beta-tubulin gene has also been selected as reference gene in studies of gene expression in the chlorophyte macroalga Ulva linza [43] and the diatom Pseudo-nitzschia multistriata [44].

For diel cycle samples, both geNorm and NormFinder identified rpL23 and rpL17-2 as the ideal reference genes, and the pairwise variation V2/V3 of 0.119 indicated that these two ribosomal protein genes could be used in combination for normalization (Fig 3). Recently, various ribosomal proteins genes have frequently been identified as suitable reference genes in algae and other organisms. rpS30 (ribosomal protein small subunit 30S) gene has been selected as the most stable gene among twelve candidate reference genes compared throughout a diel cycle [38]. rpL19 (60S ribosomal protein L19) and rpL23 were validated as reference genes in the chlorophytes Chlamydomonas sp. (for freezing condition) [45] and Volvox carteri (for different cell types) [46], respectively.

The GAPDH gene (gapdh) has been considered to be a suitable reference gene for quantifying gene expression in many algal species under different conditions, such as Prorocentrum donghaiense under diel cycle [26], Alexandrium catenella in P-limited conditions [47] and Chlamydomonas sp. under different light treatment [48]. However, in our study, gapdh was ranked as one of the least stable genes under different treatments and in all samples combined, indicating that it is not suitable as a reference gene for H. akashiwo under our experimental conditions. In agreement of our result, the mRNA and protein levels of gapdh have been reported to be regulated by light in other algae [38, 49]. The variability of gapdh expression level also has been increasingly recognized for other types of organisms [29, 50, 51].

Like gapdh, 18S is commonly used as a reference gene [52], and it has been used to design probes for quantifying the abundance of H. akshiwo in field samples [53]. In the present study we found that 18S was a moderately stable gene across all conditions we examined, although it appeared to be a suitable reference gene under light treatment (Fig 2). Compared with other genes (mRNA transcripts) the Ct median value of 18S was much lower (Fig 1), indicating that the abundance of 18S transcript was much higher (~1000 folds that of cox2 and ~700,000 folds that of mdh). The high abundance of 18S compared to mRNA transcripts (target genes) makes it difficult to reliably subtract the background baseline value in qRT-PCR data analysis [29, 54]. In addition, 18S rRNA content may be affected by nutrient stress and vary over the diel cycle [25, 55]. Therefore, we recommend that 18S not be selected as a reference gene for qRT-PCR in H. akashiwo.

Applying the candidate reference genes to normalizing a well-characterized target gene would provide further validation for the reference genes. We chose to assess the expression profile of rbcL in H. akahsiwo (HrbcL) under a diel cycle because rbcL mRNA abundance is known to exhibit strong diel rhythm in many algal species [32]. We observed a similar diel rhythm in HrbcL expression whether the most stable genes reference genes (rpL23 and rpL17-2) for diel cycle were used individually or in combination (Fig 4) to the diel pattern reported for many algae [32, 56], i.e. expression level being the highest around the middle of the light period and lowest in the middle of the dark period. Many previous reports also have shown that the expression patterns of target genes showed similar trends when either single or combined most stable reference genes were used [28, 57]. This further verifies that rpL23 and rpL17-2 are suitable reference genes for H. akashiwo gene expression studies under diel (light dark) cycle. When the expression levels of HrbcL were normalized with the least stable genes (gapdh, mdh) for diel cycle, either singly or in combination, different diel patterns of HrbcL expression were observed, either by comparison to each other, to previously reported patterns, or to patterns when rpL23 and rpL17-2 were used for normalization (Fig 4). Clearly, gapdh and mdh are not suitable reference genes for gene expression studies in H. akashiwo under diel cycle. These results demonstrate that the use of reference genes without validation risks misinterpretation of results.

Conclusion

To our knowledge, this work is the first study to evaluate candidate reference genes for gene expression analysis in H. akashiwo under different environmental conditions (temperature, nutrient and light) and different time points over the diel cycle. After careful assessment using qRT-PCR combined with statistical analysis based on geNorm and NormFinder, our results show that cal and tub are good reference genes for gene expression studies under different light and nutrient conditions, rpL17-2 and rpL23 for diel cycle studies, cal and mdh for varying temperature conditions. Our results also lead us to conclude that if used in combination cal, tub, rpL17-2 and rpL23 are suitable reference genes for gene expression analysis under all the four different experimental conditions we examined, and because these conditions represent the most common environmental or sampling factors, they may be applicable to most field studies. The identification of the suitable reference genes in this study will facilitate future studies on gene expression in H. akashiwo to improve our understanding on the molecular mechanisms of bloom formation.

Supporting Information

S1 Table. Summary of reference genes that had been tested or used in algal research.

(DOC)

Click here for additional data file. (131KB, doc)
S2 Table. Ct values of candidate reference genes examined in this study.

(XLS)

Click here for additional data file. (38KB, xls)
S3 Table. Effects of different treatments on the Ct value of two least stable genes (gapdh and ef1).

(DOC)

Click here for additional data file. (35.5KB, doc)
S1 Fig. Agarose gel electrophoresis results of ten candidate reference genes and HrbcL PCR products.

(TIF)

Click here for additional data file. (3.3MB, tif)
S2 Fig. Melting curves of ten candidate reference genes and HrbcL.

(TIF)

Click here for additional data file. (3MB, tif)
S1 File. Sequence results of ten candidate reference genes and HrbcL.

(FASTA)

Click here for additional data file. (1.5KB, fasta)

Data Availability

All relevant data are within the paper and its Supporting Information files.

Funding Statement

This work was supported by National Natural Science Foundation of China grant 41176091 and 41330959 (http://www.nsfc.gov.cn/publish/portal1/) to SL. The funder had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1. Anderson DM, Glibert PM, Burkholder JM. Harmful algal blooms and eutrophication: nutrient sources, composition, and consequences. Estuaries. 2002; 25: 704–726. [Google Scholar]
  • 2. Anderson DM. Approaches to monitoring, control and management of harmful algal blooms (HABs). Ocean Coast Manage. 2009; 52: 342–347. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Hoagland P, Scatasta S. The economic effects of harmful algal blooms In: Granéli E, Turner JT, editors. Ecology of harmful algae. Berlin: Springer; 2006. pp. 391–402. [Google Scholar]
  • 4. Smayda TJ. Ecophysiology and bloom dynamics of Heterosigma akashiwo (Raphidophyceae) In: Anderson DM, Cembella AD, Hallegraef GM, editors. Physiological Ecology of Harmful Algal Blooms. Berlin: Springer; 1998. pp. 113–131. [Google Scholar]
  • 5. Honjo T. Overview on bloom dynamics and physiological ecology of Heterosigma akashiwo In: Smayda TJ, Shimizu Y, editors. Toxic Phytoplankton Blooms in the Sea. New York: Elsevier; 1993. pp. 33–41. [Google Scholar]
  • 6. Chang FH, Anderson C, Boustead NC. First record of a Heterosigma (Raphidophyceae) bloom with associated mortality of cage-reared salmon in Big Glory Bay, New Zealand. New Zeal J Mar Fresh. 1990; 24: 461–469. [Google Scholar]
  • 7. Khan S, Arakawa O, Onoue Y. Neurotoxins in a toxic red tide of Heterosigma akashiwo (Raphidophyceae) in Kagoshima Bay, Japan. Aquac Res. 1997; 28: 9–14. [Google Scholar]
  • 8. Twiner MJ, Dixon SJ, Trick CG. Toxic effects of Heterosigma akashiwo do not appear to be mediated by hydrogen peroxide. Limnol Oceanogr. 2001; 46: 1400–1405. [Google Scholar]
  • 9. Twiner MJ, Chidiac P, Dixon SJ, Trick CG. Extracellular organic compounds from the ichthyotoxic red tide alga Heterosigma akashiwo elevate cytosolic calcium and induce apoptosis in Sf9 cells. Harmful Algae. 2005; 4: 789–800. [Google Scholar]
  • 10. Harvey EL, Menden-Deuer S. Predator-induced fleeing behaviors in phytoplankton: a new mechanism for harmful algal bloom formation? PLoS One. 2012; 7: e46438 10.1371/journal.pone.0046438 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Tobin ED, Grünbaum D, Patterson J, Cattolico RA. Behavioral and physiological changes during benthic-pelagic transition in the harmful alga, Heterosigma akashiwo: potential for rapid bloom formation. PLoS One. 2013; 8: e76663 10.1371/journal.pone.0076663 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Strom SL, Harvey EL, Fredrickson KA, Menden-Deuer S. Broad salinity tolerance as a refuge from predation in the harmful raphidophyte alga Heterosigma akashiwo (Raphidophyceae). J Phycol. 2013; 49: 20–31. [DOI] [PubMed] [Google Scholar]
  • 13. Harvey EL, Menden-Deuer S. Avoidance, movement, and mortality: The interactions between a protistan grazer and Heterosigma akashiwo, a harmful algal bloom species. Limnol Oceanogr. 2011; 56: 371–378. [Google Scholar]
  • 14. Wong ML, Medrano JF. Real-time PCR for mRNA quantitation. Biotechniques. 2005; 39: 75–85. [DOI] [PubMed] [Google Scholar]
  • 15. Bustin SA, Benes V, Nolan T, Pfaffl MW. Quantitative real-time RT-PCR-a perspective. J Mol Endocrinol. 2005; 34: 597–601. [DOI] [PubMed] [Google Scholar]
  • 16. Bustin SA. Quantification of mRNA using real-time reverse transcription PCR (RT-PCR): trends and problems. J Mol Endocrinol. 2002; 29: 23–39. [DOI] [PubMed] [Google Scholar]
  • 17. Dundas J, Ling M. Reference genes for measuring mRNA expression. Theor Biosci. 2012; 131: 215–223. [DOI] [PubMed] [Google Scholar]
  • 18. Huggett J, Dheda K, Bustin S, Zumla A. Real-time RT-PCR normalisation; strategies and considerations. Genes Immun. 2005; 6: 279–284. [DOI] [PubMed] [Google Scholar]
  • 19. Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001; 29: e45 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Suzuki T, Higgins PJ, Crawford DR. Control selection for RNA quantitation. Biotechniques. 2000; 29: 332–337. [DOI] [PubMed] [Google Scholar]
  • 21. Czechowski T, Stitt M, Altmann T, Udvardi MK, Scheible W-R. Genome-wide identification and testing of superior reference genes for transcript normalization in Arabidopsis. Plant Physiol. 2005; 139: 5–17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Liu D, Shi L, Han C, Yu J, Li D, Zhang Y. Validation of reference genes for gene expression studies in virus-infected Nicotiana benthamiana using quantitative real-time PCR. PLoS One. 2012; 7: e46451 10.1371/journal.pone.0046451 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Gimeno J, Eattock N, Van Deynze A, Blumwald E. Selection and validation of reference genes for gene expression analysis in switchgrass (Panicum virgatum) using quantitative real-time RT-PCR. PLoS One. 2014; 9: e91474 10.1371/journal.pone.0091474 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Yang C, Pan H, Liu Y, Zhou X. Selection of reference genes for expression analysis using quantitative real-time PCR in the pea aphid, Acyrthosiphon pisum (Harris) (Hemiptera, Aphidiae). PLoS One. 2014; 9: e110454 10.1371/journal.pone.0110454 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Main CR, Doll C, Bianco C, Greenfield DI, Coyne KJ. Effects of growth phase, diel cycle and macronutrient stress on the quantification of Heterosigma akashiwo using qPCR and SHA. Harmful Algae. 2014; 37: 92–99. [Google Scholar]
  • 26. Shi X, Zhang H, Lin S. Tandem repeats, high copy number and remarkable diel expression rhythm of form II RuBisCO in Prorocentrum donghaiense (dinophyceae). PLoS One. 2013; 8: e71232 10.1371/journal.pone.0071232 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Keeling PJ, Burki F, Wilcox HM, Allam B, Allen EE, Amaral-Zettler LA, et al. The Marine Microbial Eukaryote Transcriptome Sequencing Project (MMETSP): illuminating the functional diversity of eukaryotic life in the oceans through transcriptome sequencing. PLoS Biol. 2014; 12: e1001889 10.1371/journal.pbio.1001889 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Zhu J, Zhang L, Li W, Han S, Yang W, Qi L. Reference gene selection for quantitative real-time PCR normalization in Caragana intermedia under different abiotic stress conditions. PLoS One. 2013; 8: e53196 10.1371/journal.pone.0053196 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, et al. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002; 3: Research0034 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Andersen CL, Jensen JL, Ørntoft TF. Normalization of real-time quantitative reverse transcription-PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 2004; 64: 5245–5250. [DOI] [PubMed] [Google Scholar]
  • 31. Portis AR Jr. Regulation of ribulose 1, 5-bisphosphate carboxylase/oxygenase activity. Annu Rev Plant Biol. 1992; 43: 415–437. [Google Scholar]
  • 32. Paul JH, Kang JB, Tabita FR. Diel Patterns of Regulation of rbcL Transcription in a Cyanobacterium and a Prymnesiophyte. Mar Biotechnol. 2000; 2: 429–436. [DOI] [PubMed] [Google Scholar]
  • 33. Watanabe M, Kohata K, Kunugi M. Phosphate accumulation and metabolism by Heterosigma akashiwo (Raphidophyceae) during diel vertical, migration in a stratified microcosm. J Phycol. 1988; 24: 22–28. [Google Scholar]
  • 34. Coyne KJ. Nitrate Reductase (NR1) sequence and expression in the Harmful Alga Heterosigma Akashiwo (Raphidophyceae). J Phycol. 2010; 46: 135–142. [Google Scholar]
  • 35. Rosic NN, Pernice M, Rodriguez-Lanetty M, Hoegh-Guldberg O. Validation of housekeeping genes for gene expression studies in Symbiodinium exposed to thermal and light stress. Mar Biotechnol. 2011; 13: 355–365. 10.1007/s10126-010-9308-9 [DOI] [PubMed] [Google Scholar]
  • 36. Davis AK, Hildebrand M, Palenik B. Gene expression induced by copper stress in the diatom Thalassiosira pseudonana . Eukaryot Cell. 2006; 5: 1157–1168. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Stuart RK, Dupont CL, Johnson DA, Paulsen IT, Palenik B. Coastal strains of marine Synechococcus species exhibit increased tolerance to copper shock and a distinctive transcriptional response relative to those of open-ocean strains. Appl Environ Microbl. 2009; 75: 5047–5057. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Siaut M, Heijde M, Mangogna M, Montsant A, Coesel S, Allen A, et al. Molecular toolbox for studying diatom biology in Phaeodactylum tricornutum . Gene. 2007; 406: 23–35. [DOI] [PubMed] [Google Scholar]
  • 39. Bender SJ, Parker MS, Armbrust EV. Coupled effects of light and nitrogen source on the urea cycle and nitrogen metabolism over a diel cycle in the marine diatom Thalassiosira pseudonana . Protist. 2012; 163: 232–251. 10.1016/j.protis.2011.07.008 [DOI] [PubMed] [Google Scholar]
  • 40. Moseley JL, Chang C-W, Grossman AR. Genome-based approaches to understanding phosphorus deprivation responses and PSR1 control in Chlamydomonas reinhardtii . Eukaryot Cell. 2006; 5: 26–44. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Yan X, Dong X, Zhang W, Yin H, Xiao H, Chen P, et al. Reference Gene Selection for Quantitative Real-Time PCR Normalization in Reaumuria soongorica . PLoS One. 2014; 9: e104124 10.1371/journal.pone.0104124 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Guo R, Ki JS. Evaluation and validation of internal control genes for studying gene expression in the dinoflagellate Prorocentrum minimum using real-time PCR. Eur J Protistol. 2012; 48: 199–206. 10.1016/j.ejop.2011.11.001 [DOI] [PubMed] [Google Scholar]
  • 43. Dong M, Zhang X, Chi X, Mou S, Xu J, Xu D, et al. The validity of a reference gene is highly dependent on the experimental conditions in green alga Ulva linza . Curr Genet. 2012; 58: 13–20. 10.1007/s00294-011-0361-3 [DOI] [PubMed] [Google Scholar]
  • 44. Adelfi MG, Borra M, Sanges R, Montresor M, Fontana A, Ferrante MI. Selection and validation of reference genes for qPCR analysis in the pennate diatoms Pseudo-nitzschia multistriata and P. arenysensis . J Exp Mar Biol Ecol. 2014; 451: 74–81. [Google Scholar]
  • 45. Liu C, Wu G, Huang X, Liu S, Cong B. Validation of housekeeping genes for gene expression studies in an ice alga Chlamydomonas during freezing acclimation. Extremophiles. 2012; 16: 419–425. 10.1007/s00792-012-0441-4 [DOI] [PubMed] [Google Scholar]
  • 46. Kianianmomeni A, Hallmann A. Validation of reference genes for quantitative gene expression studies in Volvox carteri using real-time RT-PCR. Mol Biol Rep. 2013; 40: 6691–6699. 10.1007/s11033-013-2784-z [DOI] [PubMed] [Google Scholar]
  • 47. Zhang C, Lin S, Huang L, Wang L, Li M, Liu S. Suppression subtraction hybridization analysis revealed regulation of some cell cycle and toxin genes in Alexandrium catenella by phosphate limitation. Harmful Algae. 2014; 39: 26–39. [Google Scholar]
  • 48. Mou S, Zhang X, Miao J, Zheng Z, Xu D, Ye N. Reference genes for gene expression normalization in Chlamydomonas sp. ICE-L by quantitative real-time RT-PCR. J Plant Biochem Biot. 2014: 1–7. [Google Scholar]
  • 49. Fagan T, Morse D, Hastings JW. Circadian synthesis of a nuclear-encoded chloroplast glyceraldehyde-3-phosphate dehydrogenase in the dinoflagellate Gonyaulax polyedra is translationally controlled. Biochemistry. 1999; 38: 7689–7695. [DOI] [PubMed] [Google Scholar]
  • 50. Wang GP, Xu CS. Reference gene selection for real-time RT-PCR in eight kinds of rat regenerating hepatic cells. Mol Biotechnol. 2010; 46: 49–57. 10.1007/s12033-010-9274-5 [DOI] [PubMed] [Google Scholar]
  • 51. Gu C, Chen S, Liu Z, Shan H, Luo H, Guan Z, et al. Reference gene selection for quantitative real-time PCR in Chrysanthemum subjected to biotic and abiotic stress. Mol Biotechnol. 2011; 49: 192–197. 10.1007/s12033-011-9394-6 [DOI] [PubMed] [Google Scholar]
  • 52. Chung CC, Hwang S-PL, Chang J. Nitric oxide as a signaling factor to upregulate the death-specific protein in a marine diatom, Skeletonema costatum, during blockage of electron flow in photosynthesis. Appl Environ Microb. 2008; 74: 6521–6527. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53. Blanco EP, Hagström J, Salomon PS, Granéli E. Detection of Heterosigma akashiwo (Hada) using specific RNA probes: Variability of RNA content with environmental conditions. Harmful Algae. 2013; 24: 80–88. [Google Scholar]
  • 54.Boldt L, Yellowlees D, Leggat W. Measuring Symbiodinium sp. gene expression patterns with quantitative real-time PCR. Proceedings of the 11th ICRS, 7–11 July 2009, Ft. Lauderdale, Florida, pp. 118–122.
  • 55. Vrede T, Dobberfuhl DR, Kooijman S, Elser JJ. Fundamental connections among organism C: N: P stoichiometry, macromolecular composition, and growth. Ecology. 2004; 85: 1217–1229. [Google Scholar]
  • 56. Pichard SL, Campbell L, Kang JB, Tabita FR, Paul JH. Regulation of ribulose bisphosphate carboxylase gene expression in natural phytoplankton communities. I. Diel rhythms. Mar Ecol Prog Ser. 1996; 139: 257–265. [Google Scholar]
  • 57. Lee JM, Roche JR, Donaghy DJ, Thrush A, Sathish P. Validation of reference genes for quantitative RT-PCR studies of gene expression in perennial ryegrass (Lolium perenne L.). BMC Mol Biol. 2010; 11: 8–21. 10.1186/1471-2199-11-8 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Table. Summary of reference genes that had been tested or used in algal research.

(DOC)

Click here for additional data file. (131KB, doc)
S2 Table. Ct values of candidate reference genes examined in this study.

(XLS)

Click here for additional data file. (38KB, xls)
S3 Table. Effects of different treatments on the Ct value of two least stable genes (gapdh and ef1).

(DOC)

Click here for additional data file. (35.5KB, doc)
S1 Fig. Agarose gel electrophoresis results of ten candidate reference genes and HrbcL PCR products.

(TIF)

Click here for additional data file. (3.3MB, tif)
S2 Fig. Melting curves of ten candidate reference genes and HrbcL.

(TIF)

Click here for additional data file. (3MB, tif)
S1 File. Sequence results of ten candidate reference genes and HrbcL.

(FASTA)

Click here for additional data file. (1.5KB, fasta)

Data Availability Statement

All relevant data are within the paper and its Supporting Information files.

Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES