Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2016 Aug 1.
Published in final edited form as: Int J Parasitol. 2015 May 18;45(0):595–603. doi: 10.1016/j.ijpara.2015.02.013

A novel Sarcocystis neurona genotype XIII is associated with severe encephalitis in an unexpectedly broad range of marine mammals from the northeastern Pacific Ocean

Lorraine Barbosa a,b, Christine K Johnson a, Dyanna M Lambourn c, Amanda K Gibson b, Katherine H Haman b,d, Jessica L Huggins e, Amy R Sweeny b, Natarajan Sundar b, Stephen A Raverty d,f, Michael E Grigg b,d,*
PMCID: PMC4490116  NIHMSID: NIHMS692208  PMID: 25997588

Abstract

Sarcocystis neurona is an important cause of protozoal encephalitis among marine mammals in the northeastern Pacific Ocean. To characterize the genetic type of S. neurona in this region, samples from 227 stranded marine mammals, most with clinical or pathological evidence of protozoal disease, were tested for the presence of coccidian parasites using a nested PCR assay. The frequency of S. neurona infection was 60% (136/227) among pinnipeds and cetaceans, including seven marine mammal species not previously known to be susceptible to infection by this parasite. Eight S. neurona fetal infections identified this coccidian parasite as capable of being transmitted transplacentally. Thirty-seven S. neurona-positive samples were multilocus sequence genotyped using three genetic markers: SnSAG1-5-6, SnSAG3 and SnSAG4. A novel genotype, referred to as Type XIII within the S. neurona population genetic structure, has emerged recently in the northeastern Pacific Ocean and is significantly associated with an increased severity of protozoal encephalitis and mortality among multiple stranded marine mammal species.

Keywords: Sarcocystis neurona, Marine mammal, Protozoal disease, Coccidia, Parasite, Genotype, SnSAG, Encephalitis

1. Introduction

The protozoan parasite Sarcocystis neurona is well recognized for causing equine protozoal myeloencephalitis (EPM), a severe neurological disease in horses (Dubey et al., 1991). In North America, the life cycle of S. neurona includes the Virginia opossum (Didelphis virginiana) as the definitive host (Fenger et al., 1995; Dubey and Lindsay, 1998) and a variety of mammals as intermediate hosts, including raccoons (Procyon lotor), nine-banded armadillos (Dasypus novemcinctus), dogs (Canis familiaris), and southern sea otters (Cheadle et al., 2001; Dubey et al., 2001a, b, 2006; Cooley et al., 2007). Opossums excrete infective sporocysts in their feces (Dubey et al., 2000), and infection in intermediate hosts occurs when sporocysts are ingested. Sarcocystis neurona typically encysts in muscle cells of intermediate hosts without causing clinical disease, but may cause encephalomyelitis if the parasite migrates into the CNS (Dubey et al., 2000, 2001a).

The recent development of molecular genotyping markers has allowed for multilocus sequence typing (MLST) of S. neurona isolates in order to determine whether particular genotypes associate with disease (Rejmanek et al., 2010; Wendte et al., 2010b). Sarcocystis neurona is known to possess six major surface antigen genes, SnSAGs 1–6 (Ellison et al., 2002; Hyun et al., 2003; Howe et al., 2005; Crowdus et al., 2008; Wendte et al., 2010b). Analysis for the presence or absence and allelic variation within these genes allows for classification of S. neurona isolates into genotypes or antigen genetic (Ag) types. Microsatellite (MS) markers are also used for the classification of epidemiological clones of S. neurona. In the United States, the population genetic structure of S. neurona is defined by 12 Ag types that further sub-divide into 22 MS types (Rejmanek et al., 2010; Wendte et al., 2010a, b). Not only has this classification system served to identify geographic clustering of genotypes, but it has revealed that genotypes are shared between terrestrial and marine species, supporting the idea of land-to-sea movement of this parasite (Sundar et al., 2008; Rejmanek et al., 2010; Wendte et al., 2010b), analogous to the related protozoal agents Toxoplasma, Giardia and Cryptosporidium (Miller et al., 2002, 2008; Fayer et al., 2004; Conrad et al., 2005).

In the Americas, certain S. neurona genotypes are thought to have emerged on the west coast via repeated introductions of opossums to California over many years (Grinnell et al., 1937; Rejmanek et al., 2010). Since the association between protozoa and fatal neurological disease in southern sea otters was first established (Thomas and Cole, 1996), S. neurona has been reported as an important cause of fatal encephalitis among marine mammals, including free-ranging Pacific harbor seals and sea otters off the coasts of California, Washington and Alaska, USA (Lapointe et al., 1998; Lindsay et al., 2000; Miller et al., 2001a, b; Kreuder et al., 2003; Thomas et al., 2007; Gibson et al., 2011). In 2004, an unusually pathogenic genotype of S. neurona (Type I) was identified as the primary cause of death in a mass mortality event that resulted in nearly 60 southern sea otter deaths in the space of 1 month (Miller et al., 2010; Wendte et al., 2010a). This was the first recorded apicomplexan-associated epizootic event in a marine mammal. Molecular analysis of isolates collected from the outbreak identified a genetically distinct clone that had expanded by self-mating in the opossum definitive host (Wendte et al., 2010a). This sexual expansion of distinct genotypes by uni-parental mating is now thought to play a key role in the maintenance of dominant lineages of S. neurona in nature (Wendte et al., 2010a).

During the past two decades, the geographic range of the opossum has edged northward. Accordingly, S. neurona infections have been detected in marine mammals stranding along the coast of the northeastern Pacific Ocean (Gibson et al., 2011). This region supports a variety of marine mammals including threatened and endangered species, so knowledge of the variables (e.g., pathogen prevalence, genotype and anthropogenic changes) associated with mortality is required for conservation efforts. Here, using advanced molecular techniques, we characterized the genotypes of S. neurona infecting marine mammals stranded along the coast of the northeastern Pacific Ocean. We identify the emergence of a new genotype of S. neurona (Type XIII), demonstrate that S. neurona is capable of transplacental transmission in both pinnipeds and cetaceans, and show that parasite genotype is associated with protozoal disease severity and related mortality in multiple marine mammal species.

2. Materials and methods

2.1. Sample collection

A total of 227 study subjects of beach-cast marine mammal carcasses were collected between 2004 and 2012 in two main areas: i) the outer coastal regions (n = 131) of Oregon (n = 9), Washington (n = 120), and southern British Columbia (n = 2) and ii) the inland coastal regions (n = 96) of Washington (n = 93) and southern British Columbia (n = 3). Carcasses were opportunistically collected from these regions by the Washington Department of Fish and Wildlife, USA, Cascadia Research, USA and the Department of Fish and Oceans, Canada as part of a coastal health monitoring program by the Northwestern Marine Mammal Stranding Network, USA. This work was authorized under the Marine Mammal Protection Act (MMPA) Stranding Agreements and Section 109(h) (16 U.S.C. 1379(h)), USA. Additional samples were acquired under a National Marine Fisheries Service (NMFS), USA MMPA Section 120 Letter of Authorization and NMFS MMPA Scientific Research Permits 782–1702 and 13430. According to the Convention of International Trade of Endangered Species (CITES), both United States CITES export and Canadian CITES import permits were obtained in accordance with international protocols, and United States Fish and Wildlife declarations were completed prior to the transport of specimens across the international border.

Upon carcass collection, species identification and date were documented, and GPS coordinates (latitude/longitude) were recorded as an estimate for stranding location. Species were also categorized by stranding region. Individuals from Gertrude Island, USA and those stranding east of the entrance to the Strait of Juan de Fuca, USA were classified as inner coast, while individuals stranding along the Pacific Ocean coastline were classified as outer coast. Size of animal, sex and age class (fetus, pup/calf, subadult and adult, estimated using dentition) were determined at necropsy.

The majority of samples were from stranded animals with clinical or pathological evidence of protozoal disease, manifesting as: i) observation of ante-mortem neurological behavior, or ii) post-mortem gross lesions indicative of protozoal encephalitis. Additionally, Guadalupe fur seals and harbor porpoises that stranded during the study period were submitted as suspected protozoal cases due to region-wide unusual mortality events, and sea otters were submitted as suspected protozoal cases due to previous outbreaks of protozoal disease in sea otter populations. A subset of Pacific harbor seals without evidence of protozoal disease and a number of large cetaceans were also submitted.

Complete necropsies were performed on all marine mammal carcasses. Tissue samples for molecular detection of protozoal agents were sent to the Molecular Parasitology Section at the National Institutes of Health (NIH), USA where they were stored at −80°C until analysis. Following necropsy, a veterinary pathologist examined tissue samples by histology for the presence of parasites, inflammation and associated pathology in a blinded fashion. An encephalitis score (absent, mild to moderate or marked to severe) was assigned based on histological severity of the encephalitis due specifically to the presence and number of protozoa and the extent and severity of the associated inflammatory infiltrate detected in the brain of infected animals. A cause of death category (incidental, contributing or direct) was also assigned to each individual based on the anatomic location and density of infection, extent of inflammation and whether other agents (i.e., domoic acid, starvation, injury) may have influenced the overall contribution of S. neurona infection to the death of the animal, according to Gibson et al. (2011).

2.2. DNA extraction

DNA was extracted from tissue samples (including brain, heart, muscle and lymph node) according to the DNeasy Purification of Total DNA from Animal Tissues protocol (QIAGEN, Valencia, California, USA). Briefly, approximately 25 mg of tissue was digested overnight (approximately 20 h) at 55°C with Proteinase K and processed as described previously (Gibson et al., 2011). DNA extraction was performed on mutiple (between 1 – 10) separate tissue sections from each individual. All extracted DNA was stored at −20°C until required for PCR analysis.

2.3. Molecular characterization

Extracted DNA from tissue samples was used for multiple PCRs, with primer sets for the internal transcribed spacer 1 (ITS1) and ITS1500 loci for initial coccidian screening. The ITS1 locus is specific for apicomplexan DNA and was used to differentiate between S. neurona, Toxoxplasma gondii and Neospora caninum by their electrophoretic size polymorphism in a DNA agarose gel and by DNA sequencing (Gibson et al., 2011). The ITS1500 locus is highly specific for the detection of S. neurona and Sarcocystis falcatula (Wendte et al., 2010b). For most tissue samples from carcasses collected between 2006 and 2009 (n = 147), PCRs at the ITS1 and ITS1500 loci were performed as part of the Gibson et al. (2011) study. Those samples were revisited here in order to determine the S. neurona genotype infecting those marine mammals. They were augmented with additional carcasses collected between 2005 and 2012 (n = 80), providing a total of 227 samples.

PCR amplification was conducted according to Wendte et al. (2010b). DNA product was stored at 4°C until gel electrophoresis on 0.8% agarose gels stained with Gel Red dye (Biotium, Inc., Hayward, California, USA) for visualization under UV light. Positive amplicons were digested using Exo-SAP (USB Corporation, Cleveland, Ohio, USA) according to the manufacturer’s instructions prior to DNA sequencing. DNA sequencing was carried out by Rocky Mountain Laboratory Genomics Unit DNA Sequencing Center, Division of Intramural Research (Hamilton, Montana, USA). The resulting sequences and polymorphisms were identified by alignment against a reference S. neurona isolate designated SN1 (Marsh et al., 1999) using the Seqman component of the Lasergene software. (DNASTAR, Inc., Madison, Wisconsin, USA). In order to decrease the chances of having false positive or false negative results, only specimens that tested S. neurona DNA-positive in a minimum of two tissue samples or negative in a minimum of two tissue samples were included in the study as cases and controls, respectively.

For samples with enough extracted DNA product remaining after initial PCR screening, molecular genotyping was performed. Three sets of nested surface antigen primers (for use in external and internal PCRs), SnSAG1-5-6, SnSAG3 and SnSAG4 were used, which allowed for S. neurona genotyping based on allele presence at SnSAGs 1, 5 and 6, and polymorphisms at specific nucleotide positions in SnSAG3 and SnSAG4 (Crowdus et al., 2008; Howe et al., 2008; Rejmanek et al., 2010; Wendte et al., 2010b). The SnSAG1-5-6 genes are differentially encoded among S. neurona strains, whereas SnSAG3 and SnSAG4 are polymorphic. The SnSAG2 gene is non-polymorphic (Rejmanek et al., 2010; Wendte et al., 2010b), and was not utilized in this study. In order to increase sensitivity, a set of forward and reverse internal primers were developed for SnSAG4 for use in a nested reaction, and a forward internal primer was developed for SnSAG1-5-6, for use in a hemi-nested reaction. The primers designed were as follows: SnSAG4 INTFWD -CAAGCAACAGCGGTAACAGA, INTREV - CTCTGCGAACGGGAAGTTAG; SnSAG1-5-6 INTFWD - TGACACTCTGCTCYGCCAGA.

External PCRs consisted of 3 µL of sample DNA, 5 µL of 10X PCR buffer containing 15 mM MgCl2 (Sigma-Aldrich, St. Louis, Missouri, USA), 5 µL of 2 mM dNTPs mix, 25 pmole of each primer (forward and reverse), 0.5 µL of DNA Taq polymerase (Sigma-Aldrich) and deionized water in a total reaction volume of 50 µL. PCR conditions included initial denaturation at 95°C for 5 min; followed by 35 cycles consisting of 95°C for 40 s, 58°C for 40 s and 72°C for 40 s; and a final extension for 10 min at 72°C. All nested PCRs utilized 1µL of PCR product from the primary reaction as template, and reaction protocols and conditions were the same as for the initial PCR. Negative controls for both external and internal nested reactions consisted of molecular grade de-ionized water as well as DNA extracted from muscle tissue of an uninfected mouse. Product visualization and DNA sequencing were performed as described above. Because immunosuppression due to morbillivirus infection can contribute to the development of protozoal disease, all animals were tested for morbilivirus infection by PCR (Haas et al., 1991)

2.4. Parasite isolation and microsatellite analysis

High resolution microsatellite typing is an excellent tool for identifying subtle genetic variations within Ag types, however it is an inherently less sensitive and more labor-intensive technique than nested MLST analysis. It requires sufficient parasite DNA from cloned isolates, which can only be achieved by culturing the parasite from infected tissues harvested from recently deceased animals. When fresh carcasses were available, parasites for MS typing were isolated according to Miller et al. (2004). Briefly, fresh brain tissue from stranded marine mammals with suspected protozoal infections were washed in antibiotic saline solution, trypsinized, disrupted by pipetting and seeded onto MA104 monkey kidney cell monolayers to isolate parasites. In total, six S. neurona isolates were recovered. Parasite DNA was extracted from parasite pellets and analyzed at 12 MS markers according to Wendte et al. (2010b). MS allelic types were assigned based on the number of di-, tri- or complex-repeats obtained at each marker. The inheritance pattern of the repeats identified across the 12 MS markers was used to determine a multilocus MS type.

2.5. Data analysis

Statistical associations were evaluated between S. neurona genotype and putative risk factors including species, age class, sex, stranding year, stranding region (inner versus outer coast), and co-infection status (singular S. neurona infection versus co-infection with T. gondii in brain tissue), using the Fisher exact test and the chi square test for trend. Associations between S. neurona genotype and the encephalitis score and the cause of death category were evaluated on a subset of samples for which sufficient DNA was present to permit MLST genotyping using the two-sided Fisher exact test. P values < or = 0.05 were considered statistically significant. Statistical analyses were conducted using Epi Info (version 7.1.2.0, Center for Disease Control, Atlanta, GA, USA), and STATA statistical software (version 12.1, StataCorp, College Station, TX, USA).

3. Results

3.1. Sarcocystis neurona infections among stranded marine mammals from the northeastern Pacific Ocean

The overall frequency of S. neurona infection in our population of marine mammals exhibiting mainly pre- or post-mortem signs of neurological disease or stranding during peak seasons when neurological disease is observed was 60% (136/227). Sarcocystis neurona infection was documented in 63% (76/121) of Pacific harbor seals (Phoca vitulina), 70% (32/46) of Pacific harbor porpoises (Phocoena phocoena), 44% (11/25) of Guadalupe fur seals (Arctocephalus townsendi), 38% (3/8) of Steller sea lions (Eumatopias jubatus), 67% (4/6) of Northern sea otters (Enhydra lutris), 20% (1/5) of Northern fur seals (Callorhinus ursinus), 75% (3/4) of California sea lions (Zalophus californianus), and all (3/3) Northern elephant seals (Mirounga angustirostris), and all (1/1) of Pacific white-sided dolphins (Langenorhynchus obliquidens). Sarcocystis neurona was also detected in a pregnant adult pygmy sperm whale (Kogia breviceps) as well as her second trimester fetus. Two killer whales (Orcinus orca), two gray whales, a Bryde’s whale (Balaenoptera brydei), and a sperm whale (Physeter macrocephalus) were not found to be infected with S. neurona. Sixty-two percent (8/13) of fetuses, 50% (28/56) of pups/calves, 57% (39/69) of yearling/subadults, and 69% (61/89) of adults were positive for S. neurona by PCR. Sixty-three percent (63/100) of females and 57% (71/124) of males were S. neurona-positive. In three individuals, the sex was not known.

Sarcocystis neurona infections were identified in 50% (48/96) of inner coast individuals and 67% (88/131) of outer coast individuals. Stranding region was analyzed on a species-specific basis among residential species that had sufficient sample sizes (Pacific harbor seals and harbor porpoises). Pacific harbor seals were significantly more likely to be infected with S. neurona if stranded on the outer coast than if stranded on the inner coast (P = 0.0002) (Fig. 1). Samples analyzed in 2006 – 2009 by Gibson et al. (2011) identified a high prevalence of co-infections with multiple coccidian species, as was likewise observed among the additional samples collected during 2005 – 2012 for the current study. In total, tissues from 66% (90/136) of S. neurona-positive individuals were infected with at least one additional coccidian parasite, including T. gondii (85/90), N. caninum (8/90), and other species within the family Sarcocystidae (13/90) (Sarcocystis canis-like, Sarcocystis cruzi-like, Sarcocystis columbae-like, Sarcocystis sp. CRC-836, Coccidia A, B or C, among others). Nineteen individuals were infected with three or more coccidian species. All animals in this study were PCR negative for morbillivirus (Barrett et al., 1985), and there was no evidence of viral inclusions detected.

Fig. 1.

Fig. 1

Open in a new tab

Distribution of Sarcocystis neurona infection among 227 stranded marine mammals across Washington and Oregon, USA, and southern British Columbia, Canada. Each symbol represents a single sampled individual; individuals are designated by species group according to symbol and by infection status by shade (negative, white; infected, black). Pacific Harbour Seals (n = 121) and Harbour Porpoises (n = 46) represented the largest sample groups. Additional species were grouped by species type (pinniped, cetacean, mustelid) and group composition is shown above. Distribution maps were constructed using geographical coordinates collected at the time of sampling in R (Version 3.0.1). Base map data: ©2015 Google.

3.2. Molecular genetic analysis of S. neurona genotypes

Thirty-seven of the 136 S. neurona-infected individuals had sufficient DNA available to permit MLST analyses at the SnSAG1-5-6, SnSAG3 and SnSAG4 genes in order to determine the Sarcocystis genotype responsible for infection. In 26 individuals, all markers were successfully PCR amplified and DNA sequenced, permitting an MLST genotype designation (Table 1). Two genotypes were identified: genotype VI (n = 15), a widely distributed genotype common throughout the United States, and genotype XIII (n = 11), a novel genotype not previously observed. For the remaining 11 S. neurona-infected individuals, it was not possible to assign a genotype due to a lack of sequence information at one or more of the SnSAG genes.

Table 1.

Species, stranding year, Sarcocystis neurona surface antigen (SnSAG) sequencing and histopathological data for S. neurona -infected marine mammals stranded along the northeastern coast of the Pacific

Animal ID Species Stranding
Year		 Genotype SnSAG1-5-6 SnSAG3
 SnSAG4 Protozoal Encephalitis Cause of Deat Brain Coinfection Used in Statistical
Analysis
239 503 504 505 506 735 1057
SN1 Reference II 1 C A T A T T C C
ZC1 California Sea Lion 2008 ind 1 C Mild/Moderate Contributing - n
PP1 Harbour Porpoise 2007 VI 5 C A T A T T C G Mild/Moderate Direct - y
PP2 Harbour Porpoise 2008 VI 5 C A T A T T C G Mild/Moderate Incidental - y
PP3 Harbour Porpoise 2008 VI 5 C A T A T T C G Mild/Moderate Direct - y
PP4 Harbour Porpoise 2008 VI 5 C A T A T T C G Marked/Severe Direct Coccidia C n
PP5 Harbour Porpoise 2008 VI 5 C A T A T T C G Mild/Moderate Direct Toxoplasma
gondii 		n
PP6 Harbour Porpoise 2008 VI 5 C A T A T T C G Mild/Moderate Contributing - y
PP7 Harbour Porpoise 2009 XIII 1 G - - - - C T C Mild/Moderate Direct - y
PP8 Harbour Porpoise 2009 ind 1 Contributing T. gondii n
PP9 Harbour Porpoise 2009 VI 5 C A T A T T C G Absent Contributing - y
PP10 Harbour Porpoise 2009 VI 5 C A T A T T C G Absent Incidental - y
PP11 Harbour Porpoise 2011 VI 5 C A T A T T C G Marked/Severe Contributing T. gondii n
PP12 Harbour Porpoise 2012 VI 5 C A T A T T C G Absent Incidental - y
PV1 Pacific Harbour Seal 2005 ind 1 C Mild/Moderate Incidental - n
PV2 Pacific Harbour Seal 2007 ind G Marked/Severe Direct T. gondii n
PV3 Pacific Harbour Seal 2007 VI 5 C A T A T T C G Marked/Severe Direct T. gondii n
PV4 Pacific Harbour Seal 2008 ind 1 C Absent Incidental - n
PV5 Pacific Harbour Seal 2008 XIII 1 G - - - - C T C Mild/Moderate Contributing - n
PV6 Pacific Harbour Seal 2008 XIII 1 G - - - - C T C Marked/Severe Direct - y
PV7 Pacific Harbour Seal 2008 XIII 1 G - - - - C T C Marked/Severe Direct T. gondii n
PV8 Pacific Harbour Seal 2009 ind C A T A T T C G Mild/Moderate Incidental - n
PV9 Pacific Harbour Seal 2009 XIII 1 G - - - - C T C Marked/Severe Direct - y
PV10 Pacific Harbour Seal 2009 ind G Marked/Severe Direct T. gondii n
PV11 Pacific Harbour Seal 2009 VI 5 C A T A T T C G - n
PV12 Pacific Harbour Seal 2009 VI 5 C A T A T T C G Absent Incidental - n
PV13 Pacific Harbour Seal 2009 XIII 1 G - - - - C T C Marked/Severe Direct - y
PV14 Pacific Harbour Seal 2009 XIII 1 G - - - - C T C Marked/Severe Direct - y
PV15 Pacific Harbour Seal 2010 XIII 1 G - - - - C T C Marked/Severe Direct - y
PV16 Pacific Harbour Seal 2011 XIII 1 G - - - - C T C Marked/Severe Direct T. gondii n
PV17 Pacific Harbour Seal 2011 ind C A T A T T C G Marked/Severe Contributing T. gondii n
PV18 Pacific Harbour Seal 2011 XIII 1 G - - - - C T C Marked/Severe Direct - y
PV19 Pacific Harbour Seal 2011 ind C A T A T T C G Marked/Severe Direct - n
PV20 Pacific Harbour Seal 2012 ind G - - - - C T C Marked/Severe Direct - n
PV21 Pacific Harbour Seal 2012 ind C A T A T T C G Marked/Severe Direct - n
PV22 Pacific Harbour Seal 2012 VI 5 C A T A T T C G Marked/Severe Direct T. gondii n
PV23 Pacific Harbour Seal 2012 VI 5 C A T A T T C G Marked/Severe Direct - y
EJ1 Steller Sea Lion 2008 XIII 1 G - - - - C T C Marked/Severe Direct - y
Open in a new tab

“-” represents an insertion or deletion at SnSAG3. Only specimens possessing full multilocus sequence types (MLST) were used for statistical analysis.

ind, indeterminate; unable to assign a strain genotype.

The protozoal encephalitis category was assigned based on the histological severity of the encephalitis due specifically to the protozoal infection.

The cause of death category was assigned based on the overall contribution of S. neurona infection to the death of the animal.

Empty cells represent a lack of available data.

Since high resolution MS typing is a less sensitive technique that cannot readily be set up in a nested or multiplexed PCR configuration, this technique was only applied against the six S. neurona isolates that were recovered by cell culture (Table 2). The two isolates identified as Type VI had different MS types, p’ and r. In contrast, the two Type XIII isolates shared the same novel MS type, hh. The other two isolates (PV17, PV19) did not amplify at the SnSAG1, SnSAG5 or SnSAG6 gene. However, they both possessed the same MS type, u, and were presumed to be either Ag type VI or VII based on alleles present at the SnSAG3 and SnSAG4 genes. This Ag/MS type combination has been identified previously in an infected southern sea otter from Monterey CA, USA (Wendte et al., 2010a).

Table 2.

Microsatellite (MS) sequencing of Sarcocystis neurona (Sn) strains from six isolates from marine mammals stranded along the coast of the northeastern Pacific Ocean

MS locus
Sample Year Source Ag Type MS Type Sn2
(GT)n		 Sn3
(AT)n		 Sn4
(CA)n		 Sn5
(CA)n		 Sn7
(CA)n		 Sn8
(CA)n		 Sn9
(GT)n		 Sn10
(AT)n		 Sn11
(CA)n		 Sn1520
(CTA)n		 Sn1863
(AC)n		 Sn515
complex
Total nt count
SO3106 1999 Wendte et al., 2010a II i 9 12 12 9 17 10 17 11 13 9 17 120
PP11 2011 This study VI r 10 11 a 9 a 10 14 10 a 14 16 81
PV16 2011 this study XIII hh 9 10 a 10 a 10 14 9 14 10 22 81
PV17 2011 this study ind u 10 a a 9 18 10 14 9 a a 15
PV18 2011 this study XIII hh 9 10 a 10 18 a 14 9 14 10 22
PV19 2011 this study ind u 10 a 13 9 18 10 14 9 14 14 15
PV22 2012 this study VI p’ 10 11 13 9 18 10 14 10 14 15 16
Open in a new tab

SO, Sea Otter; PP, Harbour Porpoise; PV, Harbour Seal; nt, nucleotide.

a

Unable to assign numerical value for the number of repeats at the MS locus.

ind, indeterminate; unable to assign a strain genotype.

Specimens are grayscale shaded to reflect different antigen (Ag) and MS types.

Empty cells represent a lack of available data.

SO3106 serves as a reference sequence (Wendte et al., 2010a).

3.3. Risk factors for parasite infection

Genotype XIII was significantly more common in harbor seals and genotype VI was significantly more common in harbor porpoises (P = 0.012), although each genotype was capable of infecting both pinnipeds and cetaceans. Age class, sex, stranding region, stranding year and co-infection status did not differ among animals infected with genotype XIII compared with genotype VI, although insufficient power may have precluded determining significance. Genotype XIII was first identified in stranded animals in 2008, and all 11 genotype XIII individuals were collected from the outer coast of Washington State.

Of the 26 individuals to whom an MLST genotype was assigned, one individual (PV11; genotype VI) was excluded from the encephalitis and cause of death analyses due to a lack of histopathological data, and two more individuals (PV12, genotype VI; and PV5, genotype XIII) were excluded because they were infected transplacentally and did not represent environmentally-acquired infections. Another seven individuals were excluded from the pathological analyses due to brain co-infections with other protozoan species based on evidence that co-infections with both S. neurona and T. gondii are associated with increased encephalitis and mortality (Gibson et al., 2011). Among the remaining 16 singly-infected animals, those infected with genotype XIII (n = 8) were significantly more likely to develop a marked or severe encephalitis than those animals infected with genotype VI (n = 8) (P = 0.01). Accordingly, cause of death by S. neurona was significant among genotype XIII infected individuals - all animals died directly as a result of their S. neurona infection, whereas the majority of genotype VI infected individuals did not (P = 0.03). When the seven individuals with brain co-infections were also considered, those infected with genotype XIII (n = 10) all died directly as a result of their S. neurona infection and were still significantly more likely to develop severe encephalitis than those infected with genotype VI (n = 13) (P = 0.05).

4. Discussion

Sarcocystis neurona has previously been documented infecting sea otters, harbor porpoises and harbor seals (Wendte et al., 2010a). This study establishes that S. neurona is capable of infecting a wider range of marine pinnipeds and cetaceans, including a Steller sea lion, Guadalupe fur seal, Northern elephant seal, Northern fur seal, pygmy sperm whale and Pacific white-sided dolphin. The molecular genetic analyses identified three MS genetic signatures among two genotype VI isolates and two additional isolates that did not PCR amplify at the SnSAG1-5-6 locus (Table 2). All of these Ag/MS genotypes have been identified previously among northeastern Pacific Ocean marine mammals and intermediate terrestrial hosts throughout the United States (Wendte et al., 2010a). In contrast, a new, unique molecular signature (Ag type XIII, MS type hh) was identified in this study and is responsible for fatal infections among both pinnipeds and cetaceans in the northeastern Pacific Ocean. All but one individual with single genotype XIII infections, and all individuals with co-infections that included genotype XIII, had marked/severe protozoal encephalitis and all died of protozoal disease, demonstrating that this genotype is highly pathogenic and is an important cause of mortality in marine mammals. Although protozoal disease has been seen in association with immunosuppression due to morbillivirus infection (Haas et al., 1991), all animals in this study were PCR-negative for this virus. The mortalities appear to be attributed to genotype XIII, however, other disease processes potentially contributing to immunosuppression were not screened for in this study. Sarcocystis neurona Type XIII was first detected in the northeastern Pacific Ocean in 2008 and is likely an emerging disease in this region. Infections with this parasite genotype have now occurred over several years, indicating a persistent source of infection that has the potential to cause long-term impacts on marine mammal populations, and possibly be even more detrimental than the Type I epizootic, which emerged in 2004 and caused mass mortality among sea otters off the coast of California before subsequently disappearing (Miller et al., 2010; Wendte et al., 2010a).

The population genetic structure of S. neurona is not complex. In the United States it is largely comprised of 12 MLST Ag types that appear largely clonal in origin (Wendte et al., 2010a). Despite this relative lack of overall diversity, local populations of S. neurona are known to exhibit substantial smaller-scale variability, as evidenced by the application of MS markers (Asmundsson et al., 2006; Sundar et al., 2008; Wendte et al., 2010a). The discovery of a highly pathogenic genotype of S. neurona infecting pinnipeds and cetaceans in the northeastern Pacific Ocean is of particular interest. Current efforts to sequence the Type XIII genome are ongoing to determine the genetic history of the strain and whether it is a recent strain that has emerged by sexual recombination in its definitive opossum host from a cross between strains of S. neurona circulating in the United States. Previous studies have demonstrated that experimental crosses between avirulent strains of the closely related coccidian parasite, T. gondii, are capable of producing offspring more virulent than either parent, and that this appears to be occurring in nature (Grigg et al., 2001; Wendte et al., 2010a). Hence, sexual reproduction has the potential to rapidly produce new gene combinations that can lead to a spectrum of disease, ranging from largely incidental infections to mass mortality events (Miller et al., 2004; Wendte et al., 2010a). In this context, the S. neurona 2004 outbreak in southern sea otters was determined to be the result of infection by a single, distinct genotype (Ag type I, MS type c), that was amplified by its opossum definitive host (Miller et al., 2010; Wendte et al., 2010a). Since the discovery of Type XIII among marine mammals stranding along the coast of the northeastern Pacific Ocean, this genotype has yet to be detected in the definitive opossum host. Work is ongoing to determine the source or reservoir of infection for this highly pathogenic genotype (to marine pinnipeds and cetaceans) among the definitive host, as well as known S. neurona intermediate hosts.

The mechanism for S. neurona transmission in the marine environment is unclear. The widely accepted hypothesis is that the definitive host, the Virginia opossum, sheds the infective stage of the parasite on land, which then enters the marine environment through freshwater runoff, a mechanism that has also been proposed for a variety of similar protozoal pathogens (Miller et al., 2002, 2008; Fayer et al., 2004; Conrad et al., 2005; Shapiro et al., 2012). There is evidence that near-shore filter-feeding invertebrates can concentrate the closely related protozoan T. gondii, which may then be consumed by intermediate hosts (Lindsay et al., 2001; Miller et al., 2008). Furthermore, S. neurona infection in sea otters has been linked to consumption of certain prey, including filter-feeding bivalves and soft-sediment invertebrates, as well as to sandy foraging habitat (Johnson et al., 2008). Filter-feeding fish, including northern anchovies and Pacific sardines, have been shown experimentally to ingest T. gondii oocysts, which remained infective over time, perhaps suggesting that filter-feeding fish could function as transport hosts for protozoal infection of marine mammals (Massie et al., 2010).

In our sample population, harbor seals stranding along the outer coast were significantly more likely to be infected with S. neurona than those along the inner coast, while infection in another resident species, the harbor porpoise, was evenly distributed. The model of land-to-sea transmission is supported here by the fact that harbor seals spend a significant portion of their lives on land (whereas harbor porpoises are restricted to the water), thus increasing exposure to potential land-based pathogens. While harbor porpoises and harbor seals have been known to consume both pelagic and benthic fishes, with substantial overlap in prey species (Pacific herring, walleye Pollock, Pacific sand lance, eelpout) (Brown et al., 1983; Walker et al., 1998; Lance et al., 2007), harbor seals are also known to consume a high proportion of benthic and epibenthic prey including rockfish spp., sculpins and several flatfish spp.) (Brown et al., 1983; Lance et al., 2007). Thus, differences in diet between these two species could also contribute to discrepancies in S. neurona infection, if certain prey species are indeed acting as transport hosts. Examination of samples from a broader geographical range including land-based mammals could determine whether genotype XIII exists outside the outer coastal waters of Washington State or if there may be a point source of infection in this region. The fact that the infective oocyst stage of similar protozoan parasites can remain viable in the environment for extended periods of time (Lindsay et al., 2003) suggests that factors such as location in the water column, bottom sediment, current and weather may also play a role in sporocyst distribution and subsequent infection of marine mammals.

Vertical transmission is an important route of infection for N. caninum (Anderson et al., 1997; Davidson et al., 1999; Moré et al., 2009), and has been demonstrated to occur for T. gondii, and some Sarcocystis spp. (Moré et al., 2009), however, fetal infection with S. neurona has not previously been documented (Duarte et al., 2004). Our study has identified fetal infection with S. neurona in a Steller sea lion, a harbor porpoise, five harbor seals and a pygmy sperm whale. Fetuses from the harbor porpoise, the pygmy sperm whale and a harbor seal were recovered postmortem from the mother’s uterus, and both mother and fetus were infected with S. neurona. The remaining five fetuses were beach-cast carcasses, too young to have been viable, and thus were determined to have become infected trans-placentally. These findings indicate that vertical transmission of S. neurona infection may exist as a new threat to the population health of listed and/or recovering pinnipeds and cetaceans by decreasing their reproductive fecundity.

During recent decades, small mammals including the Virginia opossum have been observed to shift their geographic ranges northwards (Myers et al., 2009), both due to increases in global surface temperature (Alley et al., 2007), and likely increased availability of human-associated food resources (Kanda, 2005). As the range of the opossum expands, new S. neurona genotypes such as Type XIII may emerge to cause infection in susceptible host species not previously exposed to these pathogens such as marine mammals. Although some of the marine mammal species in our study, such as the Pacific harbor seal and the harbor porpoise, have stable population growth, pathogens that are prevalent in less abundant species may have negative consequences on population health and reproductive fitness, particularly in heavily impacted ecosystems. Better understanding of the genetic variation of pathogens such as S. neurona, their capacity to cause reproductive loss, and how this variation influences host specificity and pathogenicity, will allow for enhanced appreciation of the population-level risks associated with S. neurona infection in marine mammals.

Highlights.

  • Sarcocystis neurona genotype XIII is associated with severe protozoal encephalitis and mortality in marine mammals

  • Sarcocystis neurona is capable of transplacental transmission

  • Sarcocystis neurona infects many more marine mammal species than previously known

Acknowledgements

This work was supported in part by the Intramural Research Program of the National Institutes of Health (NIH) and National Institute of Allergy and Infectious Diseases (NIAID), US. MEG is a scholar of the Canadian Institute for Advanced Research (CIFAR) Program for Integrated Microbial Biodiversity, Canada. Specimens and support for carcass collection and sampling were provided by various Northwest Marine Mammal Stranding Network participants including staff, interns and volunteers from Washington Department of Fish and Wildlife, Cascadia Research Collective, Portland State University Mammal Stranding Network, Oregon State University, San Juan County Stranding Network, Port Townsend Marine Science Center, Central Puget Sound Stranding Network, Washington and Oregon State Parks, Wolf Hollow, PAWS Wildlife, Makah Tribe, U.S. Fish and Wildlife Service, National Marine Fisheries Service/National Marine Mammal Laboratory and National Oceanic and Atmospheric Administration (NOAA) NW Region Office of Protected Resources, USA that responded to the numerous marine mammal strandings in Oregon and Washington. Special thanks to Susan Berta, John Calambokidis, Deb Duffield, Joe Gaydos, Steven Jefferies, Harriet Huber, Deanna Lynch, Brent Norberg, Stephanie Norman, Jim Rice, Amy Traxler and Kristin Wilkinson. We also thank the Rocky Mountain Laboratories Genomics Unit, USA and its DNA Sequencing Center for providing sequence data, and Sandra Etheridge of the Animal Health Center, Canada for immunohistochemistry. Stranding response and diagnostic costs were supported by the John H. Prescott Marine Mammal Rescue Assistance Grant Program, USA; NOAA Prescott Marine Mammal Rescue Grants, USA; Washington Department of Fish and Wildlife, USA; the Cascadia Research Collective, USA; and the Animal Health Center, British Columbia Ministry of Agriculture, Canada

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Anderson ML, Reynolds JP, Rowe JD, Sverlow KW, Packham AE, Barr BC, Conrad PA. Evidence of vertical transmission of Neospora sp. infection in dairy cattle. J Am Vet Med Assoc. 1997;210:1169–1172. [PubMed] [Google Scholar]
  2. Alley R, Berntsen T, Bindoff NL, Chen Z, Chidthaisong A, Friedlingstein P, Gregory J, Hegerl G, Heimann M, Hewitson B, Hoskins B, Joos F, Jouzel J, Kattsov V, Lohmann U, Manning M, Matsuno T, Molina M, Nicholls N, Overpeck J, Qin D, Raga G, Ramaswamy V, Ren J, Rusticucci M, Solomon S, Somerville R, Stocker TF, Stott P, Stouffer RJ, Whetton P, Wood RA, Wratt D. Technical Summary. In: Solomon S, Qin D, Manning M, Chen Z, Marquis M, Averyt KB, Tignor M, Miller HL, editors. Climate Change 2007: The Physical Science Basis. Contribution of Working Group I to the Fourth Assessment Report of the Intergovernmental Panel on Climate Change. Cambridge, United Kingdom and New York, NY, USA: Cambridge University Press; 2007. pp. 21–87. [Google Scholar]
  3. Asmundsson IM, Dubey JP, Rosenthal BM. A genetically diverse but distinct North American population of Sarcocystis neurona includes an overrepresented clone described by 12 microsatellite alleles. Infect Genet Evol. 2006;6:352–360. doi: 10.1016/j.meegid.2006.01.001. [DOI] [PubMed] [Google Scholar]
  4. Barrett T, Shrimpton S, Russell S. Nucleotide sequence of the entire protein coding region of canine distemper virus polymerase associated (P) protein mRNA. Virus Res. 1985;3:367–372. doi: 10.1016/0168-1702(85)90436-8. [DOI] [PubMed] [Google Scholar]
  5. Brown RF, Mate BR. Abundance, movements, and feeding habits of harbor seals, Phoca vitulina, at Netarts and Tillamooks Bays, Oregon. Fish Bull. 1983;81:291–301. [Google Scholar]
  6. Cheadle MA, Tanhauser SM, Dame JB, Sellon DC, Hines M, Ginn PE, MacKay RJ, Greiner EC. The nine-banded armadillo (Dasypus novemcinctus) is an intermediate host for Sarcocystis neurona . Int J Parasitol. 2001;31:330–335. doi: 10.1016/s0020-7519(01)00177-1. [DOI] [PubMed] [Google Scholar]
  7. Conrad PA, Miller MA, Kreuder C, James ER, Mazet J, Dabritz H, Jessup DA, Gulland F, Grigg ME. Transmission of Toxoplasma: clues from the study of sea otters as sentinels of Toxoplasma gondii flow into the marine environment. Int J Parasitol. 2005;35:1155–1168. doi: 10.1016/j.ijpara.2005.07.002. [DOI] [PubMed] [Google Scholar]
  8. Cooley AJ, Barr B, Rejmanek D. Sarcocystis neurona encephalitis in a dog. Vet Pathol. 2007;44:956–961. doi: 10.1354/vp.44-6-956. [DOI] [PubMed] [Google Scholar]
  9. Crowdus CA, Marsh AE, Saville WJ, Lindsay DS, Dubey JP, Granstrom DE, Howe DK. SnSAG5 is an alternative surface antigen of Sarcocystis neurona strains that is mutually exclusive to SnSAG1. Vet Parasitol. 2008;158:36–43. doi: 10.1016/j.vetpar.2008.08.012. [DOI] [PubMed] [Google Scholar]
  10. Davison HC, Otter A, Trees AJ. Estimation of vertical and horizontal transmission parameters of Neospora caninum infections in dairy cattle. Int J Parasitol. 1999;29:1683–1689. doi: 10.1016/s0020-7519(99)00129-0. [DOI] [PubMed] [Google Scholar]
  11. Duarte PC, Conrad PA, Barr BC, Wilson WD, Ferraro GL, Packham AE, Carpenter TE, Gardner IA. Risk of transplacental transmission of Sarcocystis neurona and Neospora hughesi in California horses. J Parasitol. 2004;90:1345–1351. doi: 10.1645/GE-3372. [DOI] [PubMed] [Google Scholar]
  12. Dubey JP, Lindsay DS. Isolation in immunodeficient mice of Sarcocystis neurona from opossum (Didelphis virginiana) faeces, and its differentiation from Sarcocystis falcatula . Int J Parasitol. 1998;28:1823–1828. doi: 10.1016/s0020-7519(98)00166-0. [DOI] [PubMed] [Google Scholar]
  13. Dubey JP, Chapman JL, Rosenthal BM, Mense M, Schueler RL. Clinical Sarcocystis neurona, Sarcocystis canis, Toxoplasma gondii, and Neospora caninum infections in dogs. Vet Parasitol. 2006;137:36–49. doi: 10.1016/j.vetpar.2005.12.017. [DOI] [PubMed] [Google Scholar]
  14. Dubey JP, Davis SW, Speer CA, Bowman DD, de Lahunta A, Granstrom DE, Topper MJ, Hamir AN, Cummings JF, Suter MM. Sarcocystis neurona n. sp. (Protozoa: Apicomplexa), the etiologic agent of equine protozoal myeloencephalitis. J Parasitol. 1991;77:212–218. [PubMed] [Google Scholar]
  15. Dubey JP, Saville WJ, Lindsay DS, Stich RW, Stanek JF, Speert CA, Rosenthal BM, Njoku CJ, Kwok OC, Shen SK, Reed SM. Completion of the life cycle of Sarcocystis neurona . J Parasitol. 2000;86:1276–1280. doi: 10.1645/0022-3395(2000)086[1276:COTLCO]2.0.CO;2. [DOI] [PubMed] [Google Scholar]
  16. Dubey JP, Zarnke R, Thomas NJ, Wong SK, Van Bonn W, Briggs M, Davis JW, Ewing R, Mense M, Kwok OC, Romand S, Thulliez P. Toxoplasma gondii, Neospora caninum, Sarcocystis neurona, and Sarcocystis canis-like infections in marine mammals. Vet Parasitol. 2003;116:275–296. doi: 10.1016/s0304-4017(03)00263-2. [DOI] [PubMed] [Google Scholar]
  17. Dubey JP, Saville WJ, Stanek JF, Lindsay DS, Rosenthal BM, Oglesbee MJ, Rosypal AC, Njoku CJ, Stich RW, Kwok OC, Shen SK, Hamir AN, Reed SM. Sarcocystis neurona infections in raccoons (Procyon lotor): evidence for natural infection with sarcocysts, transmission of infection to opossums (Didelphis virginiana), and experimental induction of neurologic disease in raccoons. Vet Parasitol. 2001a;100:117–129. doi: 10.1016/s0304-4017(01)00500-3. [DOI] [PubMed] [Google Scholar]
  18. Dubey JP, Rosypal AC, Rosenthal BM, Thomas NJ, Lindsay DS, Stanek JF, Reed SM, Saville WJ. Sarcocystis neurona infections in sea otter (Enhydra lutris): evidence for natural infections with sarcocysts and transmission of infection to opossums (Didelphis virginiana) J Parasitol. 2001b;87:1387–1393. doi: 10.1645/0022-3395(2001)087[1387:SNIISO]2.0.CO;2. [DOI] [PubMed] [Google Scholar]
  19. Ellison SP, Omara-Opyene AL, Yowell CA, Marsh AE, Dame JB. Molecular characterisation of a major 29 kDa surface antigen of Sarcocystis neurona . Int J Parasitol. 2002;32:217–225. doi: 10.1016/s0020-7519(01)00324-1. [DOI] [PubMed] [Google Scholar]
  20. Fenger CK, Granstrom DE, Langemeier JL, Stamper S, Donahue JM, Patterson JS, Gajadhar AA, Marteniuk JV, Xiaomin Z, Dubey JP. Identification of opossums (Didelphis virginiana) as the putative definitive host of Sarcocystis neurona . J Parasitol. 1995;81:916–919. [PubMed] [Google Scholar]
  21. Gibson AK, Raverty S, Lambourn DM, Huggins J, Magargal SL, Grigg ME. Polyparasitism is associated with increased disease severity in Toxoplasma gondii-infected marine sentinel species. PLoS Negl Trop Dis. 2011;5:e1142. doi: 10.1371/journal.pntd.0001142. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Grigg ME, Sundar N. Sexual recombination punctuated by outbreaks and clonal expansions predicts Toxoplasma gondii population genetics. Int J Parasitol. 2009;39:925–933. doi: 10.1016/j.ijpara.2009.02.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Grigg ME, Bonnefoy S, Hehl AB, Suzuki Y, Boothroyd JC. Success and virulence in Toxoplasma as the result of sexual recombination between two distinct ancestries. Science. 2001;294:161–165. doi: 10.1126/science.1061888. [DOI] [PubMed] [Google Scholar]
  24. Grinnell J, Dixon JS, Linsdale JM. Fur-bearing mammals of California: their natural history, systematic status, and relations to man. I and II. Berkeley, USA: University of California Press; 1937. [Google Scholar]
  25. Haas L, Subbarao S, Harder T, Bernd-Liess B, Barrett T. Detection of phocid distemper virus RNA in seal tissues using slot hybridization and the polymerase chain reaction amplification assay: genetic evidence that the virus is distinct from canine distemper virus. J Gen Virol. 1991;72:825–832. doi: 10.1099/0022-1317-72-4-825. [DOI] [PubMed] [Google Scholar]
  26. Howe DK, Gaji RY, Mroz-Barrett M, Gubbels MJ, Striepen B, Stamper S. Sarcocystis neurona merozoites express a family of immunogenic surface antigens that are orthologues of the Toxoplasma gondii surface antigens (SAGs) and SAG-related sequences. Infect Immun. 2005;73:1023–1033. doi: 10.1128/IAI.73.2.1023-1033.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Howe DK, Gaji RY, Marsh AE, Patil BA, Saville WJ, Lindsay DS, Dubey JP, Granstrom DE. Strains of Sarcocystis neurona exhibit differences in their surface antigens, including the absence of the major surface antigen SnSAG1. Int J Parasitol. 2008;38:623–631. doi: 10.1016/j.ijpara.2007.09.007. [DOI] [PubMed] [Google Scholar]
  28. Hyun C, Gupta GD, Marsh AE. Sequence comparison of Sarcocystis neurona surface antigen from multiple isolates. Vet Parasitol. 2003;112:11–20. doi: 10.1016/s0304-4017(02)00392-8. [DOI] [PubMed] [Google Scholar]
  29. Johnson CK, Tinker MT, Estes JA, Conrad PA, Staedler M, Miller MA, Jessup DA, Mazet JK. Prey choice and habitat use drive sea otter pathogen exposure in a resource-limited coastal system. PNAS. 2008;106:2242–2247. doi: 10.1073/pnas.0806449106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Kanda LL. Winter energetics of Virginia opossums Didelphis virginiana and implications for the species’ northern distributional limit. Ecography. 2005;28:731–744. [Google Scholar]
  31. Kreuder C, Miller MA, Jessup DA, Lowenstine LJ, Harris MD, Ames JA, Carpenter TE, Conrad PA, Mazet JA. Patterns of mortality in southern sea otters (Enhydra lutris nereis) from 1998–2001. J Wildl Dis. 2003;39:495–509. doi: 10.7589/0090-3558-39.3.495. [DOI] [PubMed] [Google Scholar]
  32. Lance MM, Jeffries SJ. Contract Report to SeaDoc Society Research Agreement No. K004431-25. Olympia WA, USA: Washington Department of Fish and Wildlife; 2007. Temporal and spatial variability of harbor seal diet in the San Juan Island archipelago. [Google Scholar]
  33. Lapointe JM, Duignan PJ, Marsh AE, Gulland FM, Barr BC, Naydan DK, King DP, Farman CA, Huntingdon KA, Lowenstine LJ. Meningoencephalitis due to a Sarcocystis neurona-like protozoan in Pacific harbor seals (Phoca vitulina richardsi) J Parasitol. 1998;84:1184–1189. [PubMed] [Google Scholar]
  34. Lindsay DS, Thomas NJ, Dubey JP. Biological characterisation of Sarcocystis neurona isolated from a Southern sea otter (Enhydra lutris nereis) Int J Parasitol. 2000;30:617–624. doi: 10.1016/s0020-7519(00)00034-5. [DOI] [PubMed] [Google Scholar]
  35. Lindsay DS, Phelps KK, Smith SA, Flick G, Sumner SS, Dubey JP. Removal of Toxoplasma gondii oocysts from sea water by eastern oysters (Crassostrea virginica) J Euk Microbiol. 2001;(Suppl):197S–198S. doi: 10.1111/j.1550-7408.2001.tb00517.x. [DOI] [PubMed] [Google Scholar]
  36. Lindsay DS, Collins MV, Mitchell SM, Cole RA, Flick GJ, Wetch CN, Lindquist A, Dubey JP. Sporulation and survival of Toxoplasma gondii oocysts in seawater. J Euk Microbiol. 2003;50(Suppl):687–688. doi: 10.1111/j.1550-7408.2003.tb00688.x. [DOI] [PubMed] [Google Scholar]
  37. Massie GN, Ware MW, Villegas EN, Black MW. Uptake and transmission of Toxoplasma gondii oocysts by migratory, filter-feeding fish. Vet Parasitol. 2010;169:296–303. doi: 10.1016/j.vetpar.2010.01.002. [DOI] [PubMed] [Google Scholar]
  38. Marsh AE, Barr BC, Tell L, Bowman DD, Conrad PA, Ketcherside C, Green T. Comparison of the internal transcribed spacer, ITS-1, from Sarcocystis falcatula isolates and Sarcocystis neurona . J Parasitol. 1999;85:750–757. [PubMed] [Google Scholar]
  39. Miller MA, Sverlow K, Crosbie PR, Barr BC, Lowenstine LJ, Gulland FM, Packham A, Conrad PA. Isolation and characterization of two parasitic protozoa from a Pacific harbor seal (Phoca vitulina richardsi) with meningoencephalomyelitis. J Parasitol. 2001a;87:816–822. doi: 10.1645/0022-3395(2001)087[0816:IACOTP]2.0.CO;2. [DOI] [PubMed] [Google Scholar]
  40. Miller MA, Crosbie PR, Sverlow K, Hanni K, Barr BC, Kock N, Murray MJ, Lowenstine LJ, Conrad PA. Isolation and characterization of Sarcocystis from brain tissue of a free-living southern sea otter (Enhydra lutris nereis) with fatal meningoencephalitis. Parasitol Res. 2001b;87:252–257. doi: 10.1007/s004360000340. [DOI] [PubMed] [Google Scholar]
  41. Miller MA, Grigg ME, Kreuder C, James ER, Melli AC, Crosbie PR, Jessup DA, Boothroyd JC, Brownstein D, Conrad PA. An unusual genotype of Toxoplasma gondii is common in California sea otters (Enhydra lutris nereis) and is a cause of mortality. Int J Parasitol. 2004;34:275–284. doi: 10.1016/j.ijpara.2003.12.008. [DOI] [PubMed] [Google Scholar]
  42. Miller MA, Gardner IA, Kreuder C, Paradies DM, Worcester KR, Jessup DA, Dodd E, Harris MD, Ames JA, Packham AE, Conrad PA. Coastal freshwater runoff is a risk factor for Toxoplasma gondii infection of southern sea otters (Enhydra lutris nereis) Int J Parasitol. 2002;32:997–1006. doi: 10.1016/s0020-7519(02)00069-3. [DOI] [PubMed] [Google Scholar]
  43. Miller MA, Conrad PA, Harris M, Hatfield B, Langlois G, Jessup DA, Magargal SL, Packham AE, Toy-Choutka S, Melli AC, Murray MA, Gulland FM, Grigg ME. A protozoal-associated epizootic impacting marine wildlife: mass-mortality of southern sea otters (Enhydra lutris nereis) due to Sarcocystis neurona infection. Vet Parasitol. 2010;172:183–194. doi: 10.1016/j.vetpar.2010.05.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Miller MA, Miller WA, Conrad PA, James ER, Melli AC, Leutenegger CM, Dabritz HA, Packham AE, Paradies D, Harris M, Ames J, Jessup DA, Worcester K, Grigg ME. Type X Toxoplasma gondii in a wild mussel and terrestrial carnivores from coastal California: new linkages between terrestrial mammals, runoff and toxoplasmosis of sea otters. Int J Parasitol. 2008;38:1319–1328. doi: 10.1016/j.ijpara.2008.02.005. [DOI] [PubMed] [Google Scholar]
  45. Moré G, Bacigalupe D, Basso W, Rambeaud M, Beltrame F, Ramirez B, Venturini MC, Venturini L. Frequency of horizontal and vertical transmission for Sarcocystis cruzi and Neospora caninum in dairy cattle. Vet Parasitol. 2009;160:51–54. doi: 10.1016/j.vetpar.2008.10.081. [DOI] [PubMed] [Google Scholar]
  46. Myers P, Lundrigan BL, Hoffman SM, Poor-Haraminac A, Seto SH. Climate induced changes in the small mammal communities of the northern Great Lakes region. Glob. Chang. Biol. 2009;15:1434–1454. [Google Scholar]
  47. Rejmanek D, Miller MA, Grigg ME, Crosbie PR, Conrad PA. Molecular characterization of Sarcocystis neurona strains from opossums (Didelphis virginiana) and intermediate hosts from Central California. Vet Parasitol. 2010;170:20–29. doi: 10.1016/j.vetpar.2009.12.045. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Shapiro K, Miller MA, Mazet J. Temporal association between land-based runoff events and California sea otter (Enhydra lutris nereis) protozoal mortalities. J Wildl Dis. 2012;48:394–404. doi: 10.7589/0090-3558-48.2.394. [DOI] [PubMed] [Google Scholar]
  49. Sibley LD, Ajioka JW. Population structure of Toxoplasma gondii: clonal expansion driven by infrequent recombination and selective sweeps. Annu Rev Microbiol. 2008;62:329–351. doi: 10.1146/annurev.micro.62.081307.162925. [DOI] [PubMed] [Google Scholar]
  50. Sundar N, Asmundsson IM, Thomas NJ, Samuel MD, Dubey JP, Rosenthal BM. Modest genetic differentiation among North American populations of Sarcocystis neurona may reflect expansion in its geographic range. Vet Parasitol. 2008;152:8–15. doi: 10.1016/j.vetpar.2007.12.017. [DOI] [PubMed] [Google Scholar]
  51. Thomas NJ, Cole RA. The risk of disease and threats to the wild population. Endangered Species Update. 1996;13:23–27. [Google Scholar]
  52. Thomas NJ, Dubey JP, Lindsay DS, Cole RA, Meteyer CU. Protozoal meningoencephalitis in sea otters (Enhydra lutris): a histopathological and immunohistochemical study of naturally occurring cases. J Comp Pathol. 2007;137:102–121. doi: 10.1016/j.jcpa.2007.05.001. [DOI] [PubMed] [Google Scholar]
  53. Walker WA, Hanson MB, Baird RW, Guenther TJ. AFSC Processed report 98-10. Silver Spring, USA: Marine Mammal Protection Act and Endangered Species Act Implementation Program, NOAA; 1998. Food habits of the harbor porpoise, Phoceona phocoena, and Dall’s porpoise, Phocenoides dalli, in the inland waters of British Columbia and Washington; pp. 63–76. [Google Scholar]
  54. Wendte JM, Miller MA, Lambourn DM, Magargal SL, Jessup DA, Grigg ME. Self-mating in the definitive host potentiates clonal outbreaks of the apicomplexan parasites Sarcocystis neurona and Toxoplasma gondii . PLoS Genet. 2010a;6:e1001261. doi: 10.1371/journal.pgen.1001261. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Wendte JM, Miller MA, Nandra AK, Peat SM, Crosbie PR, Conrad PA, Grigg ME. Limited genetic diversity among Sarcocystis neurona strains infecting southern sea otters precludes distinction between marine and terrestrial isolates. Vet Parasitol. 2010b;169:37–44. doi: 10.1016/j.vetpar.2009.12.020. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES