Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2016 Jul 1.
Published in final edited form as: J Microbiol Methods. 2015 May 6;114:51–53. doi: 10.1016/j.mimet.2015.05.005

TM7 detection in human microbiome: are PCR primers and FISH probes specific enough?

Maria V Sizova a, Sebastian N Doerfert a, Ekaterina Gavrish a,1, Slava S Epstein a,*
PMCID: PMC4492686  NIHMSID: NIHMS695700  PMID: 25957511

Abstract

TM7 appears important and omnipresent because it is repeatedly detected by molecular techniques in diverse environments. Here we report that most of primers and FISH probes thought to be TM7-specific do hybridize with multiple species from oral and vaginal cavity. This calls for re-examination of TM7 distribution and abundance.

Keywords: microbial cultivation, oral microbiome, TM7


The candidate division TM7 remains one of the most intriguing microbial phyla. Its representatives have been repeatedly detected by the rRNA approach in a number of diverse environments, including the human microbiome. This strongly suggests omnipresence and potential importance of these bacteria. Most recently, two papers reported cultivation of TM7 (He et al 2015, Soro et al 2014), and this will only increase the interest to these organisms, especially since He et al. (He et al 2015) study pointed to curious symbiosis-based aspects of TM7 biology. Earlier, and given the apparent “uncultivability” of TM7, FISH and other DNA-based culture-independent molecular techniques were used to detect and quantify TM7 cells (Brinig et al 2003, Dinis et al 2011, Hugenholtz et al 2001, Kuehbacher et al 2008, Marcy et al 2007). There is little doubt similar attempts will continue in the future. It is therefore important to know how good the available detection methods are, and their limitations.

The purpose of this study was to verify the specificity of previously published TM7 primers and FISH probes used to detect filamentous TM7 cells in oral cavity. This is important to assess the accuracy of the earlier reports and to optimize future efforts. Our choice of bacterial species for testing the specificity of TM7 primers was based on strong resemblance of previously reported TM7 cell morphology - long filamentous cells, short rods and diplococci (Brinig et al 2003, Dinis et al 2011, Hugenholtz et al 2001, Soro et al 2014) - to numerous diverse anaerobic filamentous and rod shaped species isolated in our lab in pure cultures from the human microbiome (Sizova et al 2012, Sizova et al 2013). We used four oral and three vaginal strains: Prevotella denticola 67-4a, Eubacterium infirmum 67-4aa, Stomatobaculum longum ACC2, Lachnoanaerobaculum sp. ICM7 and Prevotella sp. S7-1-8, Prevotella buccalis S7-23-39, Prevotella timonensis S9-PR14. All strains were represented by long rods during exponential and early stationary phase of growth. Prevotella species were also represented by short oval rods and cocci during stationary phase (Fig. 1).

Fig 1.

Fig 1

Fig 1

The UV microscopic images of DTAF stained filamentous and rod shaped anaerobic bacteria that showed false positive results with published TM7-“specific” 16S rDNA primers and FISH probes.

All strains were grown at 37° C for 3–7 days on anaerobic trypticase-yeast extract medium supplemented with 1% of human serum and 0.5 g/L of L-cysteine HCl as a reducing agent. Genomic DNA was extracted with the GenElute Genomic DNA Kit (Sigma St. Louis, MO) according to supplier's instructions. Cell morphology was observed after staining with DTAF (Sizova et al 2003) and by FISH (Srinivasan et al 2013). FISH probe sequence Cy3-AYTGGGCGTAAAGAGTTGC was identical to 580F TM7 primer (Hugenholtz et al 2001). PCR amplification of the 16S rRNA gene was performed with Hot Star Taq DNA Polymerase (Qiagen, Germantown, MD) and eubacterial universal primers 27F and 1492R (Weisburg et al 1991) as well as with primers proposed to be specific to TM7 (Table 1; Brinig et al 2003, Hugenholtz et al 2001, Soro et al 2014). Same primers were used for qPCR and as FISH probes. The pGEM®-T Easy linearized plasmid (Promega) with TM7 1142 bp 16S rDNA insert (TM7 oral clone BBM-10) was used as a positive control; sterile DNA grade water was used as a negative control. Standard PCR conditions were as follows: 15 min at 95 °C for Hot Star Taq DNA Polymerase initial activation; 30 cycles at 94 °C for 30 sec for denaturation, 55 °C for 30 sec for annealing, and 72 °C for 1 min for extension; and a final chain elongation at 72 °C for 10 min. Most primers produced false positives under these conditions. Those that did not were additionally tested at annealing temperature gradient from 55 to 65 °C for P. denticola 67-4a and E. infirmum 67-4aa. All experiments were repeated at least twice with two replicates.

Table 1.

TM7 specific primer or FISH probe sequences

Primer Sequence (5'–3') Reference
314F GAGAGGATGATCAGCCAG Hugenholtz et al., 2001
580F AYTGGGCGTAAAGAGTTGC Hugenholtz et al., 2001
905_FISH TAAAACATAAAGGAATTGACGG Hugenholtz et al., 2001
910F CATAAAGGAATTGACGGGGAC Brinig et al., 2003
TM7-Soro-F GATGAACGCTGGCGGCATG Soro et al., 2014
1093F AGTCCATCAACGAGCGCAACC Brinig et al., 2003
TM7-2_ FISH ATTATTCGAACTCACAAACTC Soro et al., 2014
910R GTCCCCGTCAATTCCTTTATG Soro et al., 2014
1177R GACCTGACATCATCCCCTCCTTCC Brinig et al., 2003
1391R GACGGGCGGTGTGTRCA Soro et al., 2014

Sequences generated in this study have been deposited in GenBank under accession numbers HM120209, HQ616388, KC311735, KC311753, KF007179, KP326380-82.

Comparison of seven bacterial strains’ 16S rRNA gene sequences with ten TM7 primers and FISH probes’ sequences showed up to 12 mismatches in some pairs (Table 2). Specific primer 1391R (Soro et al 2014) revealed no TM7 specificity and no mismatches with P. denticola 67-4a, E. infirmum 67-4aa, S. longum ACC2, Lachnoanaerobaculum sp. ICM7 and Prevotella sp. S7-1-8, and P. timonensis S9-PR14. The sequence of TM7-Soro-F primer as well TM7-2_FISH probe used in the same study (Soro et al 2014) displayed two and four mismatches respectively with TM7 clone BBM-10. We also were unable to compare the sequence of TM7-Soro-F primer (Soro et al 2014) with our bacterial sequences because of their insufficient length. Primer 580F (Hugenholtz et al 2001) showed only one gap with E. infirmum 67-4aa. Low TM7 specificity of 580F primer was confirmed by positive TM7-580 FISH probe bindings to the cells of E. infirmum 67-4aa. Summary of 16S rDNA PCR amplification with TM7 specific and universal primers from seven different filamentous and rod-shaped bacteria is presented in Table 3. Most of TM7 specific primer’s combinations resulted in positive bands with some or all of the tested cultures. The only two pairs of TM7 primers that did not produce false positive results at standard PCR conditions were 314F and 910R (Soro et al 2014) and TM7-314F (Soro et al 2014) and TM7-1177R (Brinig et al 2003). However, we got a false positive result with 314F and 910R at 65 °C with E. infirmum 67-4aa. The pair of TM7-2_FISH and TM7-1177R resulted in no product with either the tested bacteria or positive control (Table 3).

Table 2.

Number of mismatches and gaps between microorganism 16S rDNA sequence and TM7 specific primer or FISH probe

Microorganism GenBank
Accession
Primer
314
F
580F 905_
FISH
910F TM7-
Soro-F
1093F TM7-
2_FISH
910R 1177R 1391
R
Prevotella sp. S7-1-
8
KC311735 5 4/ 1
gap
3 3 NA 4 10 3 4 0
Prevotella buccalis
S7-23-39
KC311753 5 4/ 1
gap
3 3 NA 4 6/ 1
gap
3 NA NA
Prevotella
timonensis S9-PR14
KF007179 5 4/ 1
gap
3 3 NA 4 6/ 1
gap
3 4 0
Prevotella denticola
67-4a
KP326380 5 4/ 1
gap
3 3 NA 2 11 3 4 0
Eubacterium
infirmum 67-4aa
KP326381 3 0/ 1
gap
2 2 NA 2 6 2 4 0
Stomatobaculum
longum ACC2
HM120209 3 2/ 1
gap
3 3 NA 2 10 3 4 0
Lachnoanaerobacul
um sp. ICM7
HQ616388 4 3/ 1
gap
3 2 >1 2 10 2 4 0
TM7 oral clone
BBM-10
KP326382 0 0 0 0 2 0 4 0 0 NA

Table 3.

Summary of 16S rDNA PCR amplification with TM7 specific and universal primers for diverse filamentous and rod-shaped bacteria

Primer 1Microorganism
Forward Reverse 1 2 3 4 5 6 7 8 9
TM7-580F TM7_1177R − − − − ± − − + −
TM7-905_FISH TM7-1177R + + + + + + + + −
TM7-910F TM7-1177R + + + + + + + + −
TM7-1093F TM7-1177R + + + + + + + + −
TM7-314F TM7-1177R − − − − − − − + −
TM7-314F TM7-910R − − − − + − − + −
TM7-Soro-F TM7-1391R + + ± + + + + + −
TM7-314F TM7-1391R − ± − + − − − ± −
TM7-580F TM7-1391R + ± ± + ± − − − −
TM7-1093F TM7-1391R + + + + + + + + −
TM7-2_FISH TM7-1177R − − − − − − − − −
TM7-2_FISH TM7-1391R − + − − − − − − −
Universal 27F Universal 1492R + + + + + + + − −
1

1 - Prevotella sp. S7-1-8; 2 - Prevotella buccalis S7-23-39; 3 - Prevotella timonensis S9-PR14; 4 - Prevotella denticola 67-4a; 5 - Eubacterium infirmum 67-4aa; 6 - Stomatobaculum longum ACC2; 7 - Lachnoanaerobaculum sp. ICM7; 8 – positive control TM7 oral clone BBM10; 9 - negative control

Our data strongly suggest that most of the previously published TM7-specific primers used in culture-independent molecular studies of human oral microbiome are not sufficiently specific to TM7. Positive results of PCR, qPCR and FISH obtained with these primers were likely compromised in the earlier studies by the presence of Prevotella sp., Eubacterium sp., and possibly other species. This calls into question the accuracy of the estimated proportion of TM7 cells in the oral cavity, currently at 1%. It also suggests that the TM7 identity of the isolate obtained by Soro et al. (Soro et al 2014) may need to be reconfirmed, since the original designation was based solely on the use of PCR primers whose specificity is no longer certain. Until primers are designed that are truly TM7 specific, FISH detection may include false positives, and an isolate assignment as TM7 may require sequencing full or nearly full length of the isolate’s16S rRNA gene.

Acknowledgements

This work was supported by NIH Grants 1RC1DE020707-01 and 3 R21 DE018026-02S1.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Conflict of interest

The authors declare no conflict of interest.

References

  1. Brinig MM, Lepp PW, Ouverney CC, Armitage GC, Relman DA. Prevalence of bacteria of division TM7 in human subgingival plaque and their association with disease. Applied and environmental microbiology. 2003;69:1687–1694. doi: 10.1128/AEM.69.3.1687-1694.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Dinis JM, Barton DE, Ghadiri J, Surendar D, Reddy K, Velasquez F, et al. In search of an uncultured human-associated TM7 bacterium in the environment. PloS one. 2011;6:e21280. doi: 10.1371/journal.pone.0021280. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. He X, McLean JS, Edlund A, Yooseph S, Hall AP, Liu SY, et al. Cultivation of a human-associated TM7 phylotype reveals a reduced genome and epibiotic parasitic lifestyle. Proceedings of the National Academy of Sciences of the United States of America. 2015;112:244–249. doi: 10.1073/pnas.1419038112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Hugenholtz P, Tyson GW, Webb RI, Wagner AM, Blackall LL. Investigation of candidate division TM7, a recently recognized major lineage of the domain Bacteria with no known pure-culture representatives. Applied and environmental microbiology. 2001;67:411–419. doi: 10.1128/AEM.67.1.411-419.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Kuehbacher T, Rehman A, Lepage P, Hellmig S, Folsch UR, Schreiber S, et al. Intestinal TM7 bacterial phylogenies in active inflammatory bowel disease. Journal of medical microbiology. 2008;57:1569–1576. doi: 10.1099/jmm.0.47719-0. [DOI] [PubMed] [Google Scholar]
  6. Marcy Y, Ouverney C, Bik EM, Losekann T, Ivanova N, Martin HG, et al. Dissecting biological "dark matter" with single-cell genetic analysis of rare and uncultivated TM7 microbes from the human mouth. Proceedings of the National Academy of Sciences of the United States of America. 2007;104:11889–11894. doi: 10.1073/pnas.0704662104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Sizova MV, Panikov NS, Tourova TP, Flanagan PW. Isolation and characterization of oligotrophic acido-tolerant methanogenic consortia from a Sphagnum peat bog. FEMS microbiology ecology. 2003;45:301–315. doi: 10.1016/S0168-6496(03)00165-X. [DOI] [PubMed] [Google Scholar]
  8. Sizova MV, Hohmann T, Hazen A, Paster BJ, Halem SR, Murphy CM, et al. New approaches for isolation of previously uncultivated oral bacteria. Applied and environmental microbiology. 2012;78:194–203. doi: 10.1128/AEM.06813-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Sizova MV, Muller P, Panikov N, Mandalakis M, Hohmann T, Hazen A, et al. Stomatobaculum longum gen. nov., sp. nov., an obligately anaerobic bacterium from the human oral cavity. International journal of systematic and evolutionary microbiology. 2013;63:1450–1456. doi: 10.1099/ijs.0.042812-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Soro V, Dutton LC, Sprague SV, Nobbs AH, Ireland AJ, Sandy JR, et al. Axenic culture of a candidate division TM7 bacterium from the human oral cavity and biofilm interactions with other oral bacteria. Applied and environmental microbiology. 2014;80:6480–6489. doi: 10.1128/AEM.01827-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Srinivasan S, Morgan MT, Liu CZ, Matsen FA, Hoffman NG, Fiedler TL, et al. More Than Meets the Eye: Associations of Vaginal Bacteria with Gram Stain Morphotypes Using Molecular Phylogenetic Analysis. PloS one. 2013;8 doi: 10.1371/journal.pone.0078633. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Weisburg WG, Barns SM, Pelletier DA, Lane DJ. 16S ribosomal DNA amplification for phylogenetic study. Journal of bacteriology. 1991;173:697–703. doi: 10.1128/jb.173.2.697-703.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES