Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2016 Aug 1.
Published in final edited form as: Antiviral Res. 2015 Apr 30;120:1–6. doi: 10.1016/j.antiviral.2015.04.012

Development of a novel cell-based assay to monitor the transactivation activity of the HSV-1 protein ICP0

Angela M Fowler 1, Heather E Shinogle 2, David J Davido 1,*
PMCID: PMC4492837  NIHMSID: NIHMS693759  PMID: 25936965

Abstract

The herpes simplex virus type 1 (HSV-1) immediate-early phosphoprotein infected cell protein 0 (ICP0) is a potent transcriptional activator of viral genes and is required for efficient viral replication and reactivation from latency. However, it is largely unknown what role specific cellular factors play in the transactivator function of ICP0. With the long-term goal of identifying these factors, we developed a cell-based assay in a 96-well format to measure this activity of ICP0. We designed a system using a set of HSV-1 GFP reporter viruses in which the expression of GFP is potently induced by ICP0 in cell culture. The initial feasibility of this system was confirmed over a 24-hour period by fluorescence microscopy. We adapted this assay to a 96-well plate format, quantifying GFP expression with a fluorescence scanner. Our results indicate that the cell-based assay we developed is a valid and effective method for examining the transactivating activity of ICP0. This assay can be used to identify cellular factors that regulate the transactivating activity of ICP0.

Keywords: HSV, ICP0, GFP, viral transcription, cell-based assay

1. Introduction

Herpes simplex virus type 1 (HSV-1) infects 70–80% of the population and commonly causes cold sores, although many infections are asymptomatic (Roizman, 2007). HSV-1 can also cause ocular infections and is the major cause of infectious blindness in western industrialized countries (Roizman, 2007). Initially, HSV-1 infects epithelial cells at a primary site, resulting in a lytic infection. The virus can then infect the sensory neurons that innervate the infected epithelial cells, where it establishes a life-long latent infection. Reactivation of latent virus can occur by different stresses, which initiates lytic infection in neurons and ultimately epithelial cells at the primary site of infection. This cycle of latent and lytic infections leads to recurrent disease. One viral protein that is important for efficient for viral replication and reactivation from latency is the immediate-early (IE) protein, infected cell protein 0 (ICP0) (Cai and Schaffer, 1989, Harris et al., 1989, Stow and Stow, 1986).

ICP0 is one of the five HSV-1 IE proteins and has RING finger motif (Everett, 1989, Meredith et al., 1995) that allows ICP0 to function as an E3 ubiquitin ligase (Boutell et al., 2002). E3 ubiquitin ligases are components of an E1-E2-E3 biochemical pathway that conjugates and polymerizes chains of ubiquitin onto proteins (Kleiger and Mayor, 2014). This activity of ICP0 directs the degradation of specific cellular proteins (Chelbi-Alix and de The, 1999, Everett et al., 1998a, Lees-Miller et al., 1996, Muller and Dejean, 1999, Parkinson and Everett, 2000, Perusina Lanfranca et al., 2013), which in turn impairs cellular antiviral defenses. The E3 ubiquitin ligase activity of ICP0 is also linked to the ability of ICP0 to act as a potent global transcriptional activator of viral genes (Everett et al., 1998b, O’Rourke et al., 1998). Previous studies have shown that the transactivation activity of ICP0 is important for efficient HSV-1 replication and reactivation from latency (Cai et al., 1993, Cai and Schaffer, 1992, Everett et al., 2009). Although the transactivating activity of ICP0 has been studied in the absence of other IE genes in transient transfection assays (Davido et al., 2005, Everett, 1987, Jordan and Schaffer, 1997, Mostafa et al., 2013), it has not been extensively studied independent of other IE proteins in the context of a viral infection. A limited number of cellular factors have been linked to ICP0’s transactivation activity (Davido et al., 2002, Li et al., 2009); however, the development of a cell-based assay to monitor this activity would allow for the systematic identification of key cellular factors or activities (e.g., via siRNA knockdown) that contribute to this function.

To begin to elucidate cellular factors that affect ICP0’s transactivating activity, we have developed an assay that measures this activity of ICP0 in a 96-well plate format. The assay was developed using two HSV-1 reporter viruses that express only ICP0 of the 5 IE genes (d106) or none of the IE genes (d109). Both viruses have a human cytomegalovirus major immediate early promoter (HCMV MIEp) driven green fluorescent protein (GFP) in the HSV-1 ICP27 locus (Samaniego et al., 1998). Similar to other published reports (Eidson et al., 2002, Everett et al., 2009, Minaker et al., 2005, Preston and Nicholl, 1997), we show here that ICP0 is capable of transactivating the HCMV MIEp; in the case of d106, ICP0 transactivation activity is quantified by measuring GFP fluorescence levels using a Typhoon Imager. To ultimately adapt this screen to use siRNAs against cell targets, we demonstrate that ICP0’s transactivating activity was minimally affected when cells were transfected with an siRNA against the cellular house keeping gene, glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Using a 96-well plate format, we established that d106 (+ICP0) has higher levels of GFP than d109 (-ICP0), which increase from 12 to 24 h post infection (hpi). Lastly, we use this assay in an siRNA library screen and identify that an siRNA against ubiquitin activating enzyme E1-like (UBEL1) impairs the transactivation activity of ICP0, validating the development of our assay.

2. Materials and methods

2.1. Cell culture and viruses

HeLa S3 (human cervical carcinoma) cells (kindly provided by Ira Blader) were utilized in the assay and grown in Dulbecco’s Modified Eagle’s Medium (DMEM) containing 10% fetal bovine serum (FBS), 2 mM L-glutamine, 10 U/mL penicillin, 10 U/mL streptomycin, and 50 μg/mL gentamycin at a temperature of 37°C in 5% CO2.

HSV-1 recombinant viruses, d106 and d109 (Fig 1, modified (Samaniego et al., 1998), kindly provided by Neal DeLuca) were used in our cell-based assay. Of the 5 IE genes, d106 only expresses ICP0 (+ICP0), whereas d109 does not express any IE proteins (-ICP0). Both viruses express the GFP gene from the human cytomegalovirus major IE promoter (HCMV MIEp). Both d106 and d109 viruses were grown on M17 cells, which are a derivative of Vero cells stably transformed with the HSV-1 ICP4 and ICP27 genes (kindly provided by David Leib). Adenoviral vectors, Ad-crtTA and Ad-T-ICP0, were used to infect M17 and transiently express ICP0 to increase titers of d109. Ad-crtTA and Ad-TICP0 were grown and titered as previously described (Halford et al., 2001). d106 was titered on Vero cells and d109 was titered on L7 cells (Vero cells that contain the ICP0 gene) (Samaniego et al., 1997), and fluorescent forming units were counted 24 hpi. M17, Vero, and L7 cells were grown in Dulbecco’s Modified Eagle’s Medium (DMEM) containing 5% fetal bovine serum (FBS), 2 mM L-glutamine, 10 U/mL penicillin, 10 U/mL streptomycin, and 50 μg/mL gentamycin at a temperature of 37°C in 5% CO2.

Fig. 1. HSV-1 recombinant viruses, d106 and d109, utilized in our cell-based assay.

Fig. 1

Open in a new tab

Of the 5 IE genes, d106 only expresses ICP0 (ICP0+), whereas d109 does not express any IE proteins (ICP0-). Both viruses express the GFP gene from the human cytomegalovirus major IE promoter (HCMV MIEp). This figure is modified from Samaniego, et. al., 1998.

2.2. Reverse transfection

HeLa S3 cells were reverse tranfected in BD Falcon black well clear bottom optilux 96-well plates (San Jose, California, catalog # 08-772-104). Ambion siRNAs (Grand Island, NY) were used at a volume of 10 μL per well and final concentration of 10 μM per well. The ubiquitin pathway siRNA library (Ambion, Grand Island, NY, Catalog number #AM80991V3) was used at the same volume and concentration. siRNA was pre-plated in wells of the 96-well plate. 0.2 μL of Lipofectamine 2000 per well was mixed with 9.8 μL Opti-MEM per well for 10–25 min. The Lipofectamine 2000/Opti-MEM mix is added to the pre-plated siRNA and allowed to incubate for 20 minutes. After the 20 min incubation, HeLa S3 cells were added to the wells at 8,000 cells per well in 80 μL per well in penicillin/streptomycin free 10% FBS DMEM. Transfected and mock-transfected wells were washed twice with complete medium 24 h post transfection (hpt) and then 100 μL of HeLa S3 cell medium was added to each well. 48 hpt, medium was removed from the cells and the well was either infected with previously described reporter viruses or harvested for RNA isolation.

2.3. Infection

HeLa S3 cells were infected 48 hpt with d106 or d109 reporter viruses at a multiplicity of infection (MOI) of 1. Viruses were diluted in HeLa S3 medium that did not contain phenol red. Infections were allowed to proceed for 12, 18, and 24 hpi.

2.4. Detection and analysis of fluorescent signals

Plates were scanned using a Typhoon image scanner (General Electric Healthcare) at standard settings according the manufacturer’s recommendations. Settings were chosen to scan green fluorescence at an excitation of 488, emission of 520, and photomultiplier tube (PMT) of 475 and excitation of 633, emission of 670, and photomultiplier tube (PMT) of 475 for the deep red. Scans were done at 12, 18, and 24 hpi. At the 24 h time point for the siRNA screen, cells were stained with deep red mitotracker in FBS-free DMEM at a final concentration of 250 nM as per protocol (Invitrogen, Grand Island, NY, catalog # M22426) to account for cell density. The fluorescence intensity of each scanned well was analyzed in ImageJ by using a circle the size of the well & measuring the intensity of each well. Data was copied into Excel (Microsoft) software for analysis. Wells that contained only cells and medium were used as background controls, and this value was subtracted from values of infected wells. For the siRNA screen, the GFP intensity was normalized to the mitotracker (deep red) intensity. d106 values were set at 100% and mock transfected, GAPDH siRNA transfected d106, d109 values were compared to the 100% value. For the siRNA screen, similar calculations were done, but normalized values were used instead of GFP only values. Lastly, the percent average variation for all d106 signals using the data in presented in Fig. 5 was calculated to be 3% of the mean d106 signal..

Fig. 5. An siRNA against GAPDH has a minimal effect on ICP0’s transactivation activity in a 96-well plate format.

Fig. 5

Open in a new tab

HeLa S3 cells were untransfected, mock transfected, or transfected with an siRNA against GAPDH. At 48 hpt, HeLa S3 cells were mock infected or infected with d106 or d109 at an MOI of 1. (A) The 96-well plate was scanned using a Typhoon Imager at 12 hpi, 18 hpi, and 24 hpi. This experiment was repeated in triplicate 2 times. (B) Comparisons of d106 and d109 samples – untransfected d106 samples were set at 100% for all time points, and mock transfected and siRNA-transfected samples were compared to it. Error bars represent SEMs.

2.5. RNA isolation and reverse transcription real time PCR

Cells were lysed and harvested using Trizol (Invitrogen, Grand Island, NY) according to manufacturer’s recommendations. RNA was isolated using phenol-chlorform extraction. 500 ng of RNA was reverse transcribed to make cDNA using the iScript BioRad cDNA synthesis kit (BioRad, Hercules, CA, catalog # 170-8890) according to manufacturer’s conditions. Real time PCR was done by using SYBR green master mix (Roche) and standard conditions were used for the cellular target, GAPDH (5′ CGGATTTGGTCGTATTGGGCGC 3′ and 5′ TCCCGTTCTCAGCCTTGACGGT 3′), and the normalization control, hTBP (5′-TGCACAGGAGCCAAGAGTGAA-3′ and 5′-CACATCACAGCTCCCCACCA-3′)(Smith et al., 2013). Standard curves were obtained for the target and normalization control. Comparisons were made using the ΔΔ2CT method, setting the untransfected control at 100%.

3. Results

3.1. ICP0 transactivates the HCMV MIEp-GFP

With the long-term goal of identifying cellular factors that play a role in the transactivating activity of ICP0, we sought to develop a 96-well plate cell-based assay. We initially wanted to establish if the replication-defective reporter viruses, d106 (+ICP0) and d109 (-ICP0) (Samaniego et al., 1998), could be used in this format. Specifically, we wanted to use fluorescence as an output of ICP0’s transactivation activity. Both d106 and d109 viruses contain an HCMV MIEp-GFP reporter, and previous studies indicate that ICP0 can transactivate the HCMV MIEp (Fig. 1). We first tested whether the expression of GFP is dependent on ICP0 in HeLa cells, a cell type commonly used to study HSV-1 replication that is highly transfectable for nucleic acids (e.g., siRNA and DNA plasmids) (Everett, 1987, Sarma et al., 2008). HeLa S3 cells were infected with d106 (+ICP0) or d109 (-ICP0), and GFP expression was examined by microscopy at 2, 6, 12, and 24 h post infection (hpi). Activation of the HCMV MIEp-GFP was first detected by 6 hpi for d106 (+ICP0) and steadily increased until 24 hpi (Fig. 2). In contrast, activation of HCMV MIEp-GFP in d109 (-ICP0) became apparent by 12 hpi in a subset of cells (Fig 2), with increased GFP expression by 24 hpi (Fig. 2). Although the GFP is induced in d109 (-ICP0)-infected cells, it does not reach the level, both in relative fluorescence intensity and cell number, as d106 (+ICP0)-infected cells. This experiment indicated that ICP0 potently induced the HCMV MIEp-GFP reporter construct in d106; thus, we established that d106 can be used as a reporter virus for monitoring ICP0 transactivating activity.

Fig. 2. ICP0 transactivates the HCMV MIEp-GFP.

Fig. 2

Open in a new tab

HeLa S3 cells were seeded in a 12-well plate, and mock-infected or infected at an MOI of 1 FFU per cell of d106 or d109 per cell. Cells were examined by fluorescence microscopy at 2, 6, 18, and 24 h post infection (hpi), and images were captured with a digital camera. Light microscopy images are located on the left and fluorescent images are located on the right for each virus

3.2. siRNA depletion of GAPDH does not appear to affect ICP0’s transactivation activity by fluorescence microscopy

We next wanted to know if transfecting an siRNA against a cellular housekeeping gene would affect the transactivating activity of ICP0. For this experiment, HeLa S3 cells were untransfected, mock transfected, or transfected with an siRNA targeted against GAPDH. Mock-transfected cells were included in these experiments to determine if the transfection reagent alone modulated ICP0’s transactivating activity. As indicated in Figure 3, we observed no notable differences in GFP levels of d106 (+ICP0)- or d109 (-ICP0)-infected cells that were untransfected, mock transfected, and GAPDH siRNA-transfected via microscopy.

Fig. 3. siRNA depletion of GAPDH does not affect ICP0’s transactivation activity.

Fig. 3

Open in a new tab

HeLa S3 cells were untransfected, mock transfected or transfected with an siRNA directed against GAPDH. Mock transfected cells were included in these experiments to determine if the transfection reagent alone modulates ICP0’s transactivating activity. All samples were compared to the untransfected control. Forty-eight hpt, HeLa S3 cells were infected with an MOI of 1 with d106 or d109 for 24 h and viewed by fluorescence microscopy. Light microscopy images are located on the left and fluorescent images are located on the right per virus. Images were captured with a digital camera.

3.3. GAPDH transcript levels are depleted in a 96-well plate format

Once we showed that transfection of siRNAs into cells did not appear to affect GFP levels of d106 (+ICP0) or d109 (-ICP0)-infected cells as imaged by microscopy, we next wanted to confirm that we could deplete the transcript levels of a cellular target using an siRNA in a 96-well plate format. HeLa S3 cells were untransfected, mock transfected, or transfected with a siRNA targeting GAPDH in triplicate wells. Forty-eight h post transfection (hpt), RNA from each well was isolated, reverse transcribed into cDNA, and analyzed by Real Time PCR. Transcript levels of GAPDH were significantly reduced to 3.4% of untransfected levels in the siRNA-transfected samples and to 75% in mock-transfected samples compared to untransfected samples, which were given the value of 100% (Fig. 4). This experiment shows that we are able to reduce mRNA levels of a specific cellular target in a 96-well plate substantially.

Fig. 4. GAPDH transcript levels are depleted in a 96-well plate.

Fig. 4

Open in a new tab

HeLa S3 cells were untransfected, mock transfected, or transfected with a siRNA targeting GAPDH in triplicate wells in a 96-well plate. Twenty-four hpt, well were washed as described in materials and methods. Forty-eight hpt, RNA was isolated from each well, reverse transcribed into cDNAs, and analyzed by Real Time PCR. Comparisons were made using the ΔΔ2CT method. GAPDH transcript levels were compared between mock- and GAPDH-transfected cells relative to the untransfected control, which was set at 100%. Error bars represent SEMs. This experiment was repeated in triplicate 3 times.

3.4. An siRNA against GAPDH has a minimal affect on ICP0’s transactivation activity in a 96-well plate

After we established that an siRNA against GAPDH depleted its transcript levels using a 96-well plate, we adapted this assay using the d106 and d109 reporter viruses to a 96-well plate format. HeLa S3 cells were untransfected, mock transfected, or transfected with a siRNA against GAPDH. At 48 hpt, HeLa S3 cells were mock infected in triplicate or infected with d106 or d109 at an MOI of 1. The 96-well plate was scanned for fluorescence using a Typhoon Imager at 12 hpi, 18 hpi, and 24 hpi. GFP expression was detected at 12 hpi for d106 (+ICP0) (Fig. 5A), which gradually increased at 18 and 24 hpi (Fig. 5A). For each time point, d106 (+ICP0) GFP levels are visibly higher than d109 (-ICP0), with d109 GFP intensities were reduced 5–6 fold at 12 hpi, 9.5–12 fold at 18 hpi, and 10.4–14 fold at 24 hpi (Fig. 5B) relative to d106, whether in the absence or presence of the GADPH siRNA. Lastly, there results confirmed our microscopy studies in which an siRNA against GAPDH did not appreciably affect GFP intensities for d106- or d109-infected wells compared their respective untransfected controls (Fig. 5B). These experiments demonstrate that we can examine the transactivation activity of ICP0 using d106 in a cell-based assay in a 96-well plate format.

3.5. An siRNA agajnst UBE1L impairs the transactivation activity of ICP0

Utilizing our 96-well plate cell-based assay, we screened a small siRNA library that targeted components of the ubitiquitin pathway. Wells were reverse-transfected and infected with d106. From this screen, an siRNA against UBE1L, an E1 enzyme of the ubiquitin-proteasome pathway, impaired the transactivation activity of ICP0 5.5-fold at 24 hpi (Fig. 6), which began to approach d109 (-ICP0) GFP levels (Fig. 6). Thus, we demonstrate that this assay can be used in an siRNA screen having identified a target in the ubiquitin-proteasome pathway.

Fig. 6. An siRNA agajnst UBE1L impairs the transactivation activity of ICP0.

Fig. 6

Open in a new tab

HeLa S3 cells were seeded in a 96-well plate. Cells were reverse transfected as described in the protocol. Wells that contained siRNA against the ubiquitin ligase pathway were infected with d106 at an MOI of 1, 48 hpt. Cells were untransfected or transfected with GAPDH siRNA for controls. 48 hpt, control wells were infected d106 or d109 or mock infected. The 96-well plate was scanned using a Typhoon Imager at 24 hpi. Comparisons were made relative to d106-untransfected infection, which was set at 100% (far left bar for each graph). UBEL1 is ubiquitin activating enzyme E1-like. Error bars represent SEMs. This experiment was repeated 3 times.

4. Discussion

In this paper, we have demonstrated, in line with other studies (Everett et al., 2009, Minaker et al., 2005, Preston and Nicholl, 1997), that ICP0 can potently transactivate the HCMV MIEp (Fig. 2). We also found that an siRNA against the housekeeping gene, GAPDH, does not appear to affect the transactivation activity of ICP0 as measured by microscopy (Fig. 3) and that GAPDH transcripts could be depleted to significant levels in a 96-well plate format (Fig. 4). These results indicate that siRNA technology can be used in this cell-based assay in a 96-well plate format. We also established that the Typhoon Imager is a quick and valid method to examine ICP0’s transactivating activity in a 96-well plate format (Fig. 5), and we verified that the assay can be used to screen an siRNA library by identifying an ubiquitin-proteasome pathway target, UBE1L (Fig. 6). Overall, we have concluded that the reporter viruses, d106 and d109, can be utilized in a cell-based assay by using a 96-well plate format and Typhoon image scanner.

While this system is adaptable to siRNA or small molecule inhibitor screens, this method also has several advantages over other established methods used to examine ICP0’s transactivation activity (Davido et al., 2002, Everett, 1987, Jordan and Schaffer, 1997, Mostafa et al., 2013). Specifically, ICP0’s transactivation activity can be monitored in the context of a viral infection, in the absence of other IE proteins, and at multiple time points in one experiment or infection by the assaying of live cells. In contrast, other methods monitor this activity in the context of a viral infection but in the presence of other IE proteins (Davido et al., 2002), which may complicate the interpretation of certain studies. Transient transfection reporter assays have been used to examine ICP0’s transactivation activity independent of other IE proteins, but these assays are not done in the setting of a viral infection (Everett, 1987, Jordan and Schaffer, 1997, Mostafa et al., 2013). Finally, most viral reporter assays and transient transfection assays can only monitor one time point per sample because the cells will either have to be lysed or fixed to analyze the sample, in contrast to our system. Thus, the d106/d109 reporter assay is advantageous because it can be used to monitor multiple time points for one experiment and monitor ICP0’s transactivation activity in the absence of IE proteins while in the context of a viral infection. Furthermore, the inclusion of d109 can also be used in counter-screens to verify that targets or inhibitors are specific for ICP0.

In summary, we have developed a cell-based assay for ICP0 that can use siRNA technology or small molecule inhibitors in a 96-well plate format. This assay can also be modified for use in a high throughput screen with the inclusion of viability indicators such as alamarBlue (Osaka and Hefty, 2013). Notably, this assay will likely increase our knowledge related to the regulation of ICP0’s transactivating activity, which may eventually lead to potential treatments against HSV-1 and its recurrent diseases.

Highlights.

  • HSV-1 ICP0 potently transactivates an HCMV MIEp-GFP reporter construct in the HSV-1 mutant, d106.

  • Using d106, ICP0 transactivation activity increases over time as determined by fluorescence microscopy and scanning.

  • This reporter assay can be adapted to a 96-well plate format and is compatible with siRNA and inhibitor testing.

Acknowledgments

This work was supported in part by Public Health Service grant RO1AI72357 from the National Institute of Allergy and Infectious Diseases. The content of the manuscript is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.

We thank members of the Davido lab for assistance and comments related to this study, and Miles Smith and Steve Benedict for critical review of this manuscript.

Glossary

Ad

adenovirus

CHX

cyclohemiximde

DMEM

Dulbecco’s modified Eagle’s medium

DMSO

dimethylsulfoxide

FBS

fetal bovine serum

FFU

fluorescent forming units

HCMV

human cytomegalovirus

hpi

hours post infection

hpt

hours post transfection

HSV-1

herpes simplex virus type 1

GAPDH

glyceraldehyde 3-phosphate dehydrogenase

GFP

green fluorescent protein

IE

immediate early

ICP0

infected cell protein 0

ICP27

infected cell protein 27

MIEp

major immediate early promoter

MOI

multiplicity of infection

PFU

plaque forming unit

SEM

standard error of the mean

siRNA

small interfering RNA

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Boutell C, Sadis S, Everett RD. Herpes simplex virus type 1 immediate-early protein ICP0 and is isolated RING finger domain act as ubiquitin E3 ligases in vitro. Journal of virology. 2002;76:841–850. doi: 10.1128/JVI.76.2.841-850.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Cai W, Astor TL, Liptak LM, Cho C, Coen DM, Schaffer PA. The herpes simplex virus type 1 regulatory protein ICP0 enhances virus replication during acute infection and reactivation from latency. Journal of virology. 1993;67:7501–7512. doi: 10.1128/jvi.67.12.7501-7512.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Cai W, Schaffer PA. Herpes simplex virus type 1 ICP0 regulates expression of immediate-early, early, and late genes in productively infected cells. Journal of virology. 1992;66:2904–2915. doi: 10.1128/jvi.66.5.2904-2915.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Cai WZ, Schaffer PA. Herpes simplex virus type 1 ICP0 plays a critical role in the de novo synthesis of infectious virus following transfection of viral DNA. Journal of virology. 1989;63:4579–4589. doi: 10.1128/jvi.63.11.4579-4589.1989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chelbi-Alix MK, de The H. Herpes virus induced proteasome-dependent degradation of the nuclear bodies-associated PML and Sp100 proteins. Oncogene. 1999;18:935–941. doi: 10.1038/sj.onc.1202366. [DOI] [PubMed] [Google Scholar]
  6. Davido DJ, Leib DA, Schaffer PA. The cyclin-dependent kinase inhibitor roscovitine inhibits the transactivating activity and alters the posttranslational modification of herpes simplex virus type 1 ICP0. Journal of virology. 2002;76:1077–1088. doi: 10.1128/JVI.76.3.1077-1088.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Davido DJ, von Zagorski WF, Lane WS, Schaffer PA. Phosphorylation site mutations affect herpes simplex virus type 1 ICP0 function. Journal of virology. 2005;79:1232–1243. doi: 10.1128/JVI.79.2.1232-1243.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Eidson KM, Hobbs WE, Manning BJ, Carlson P, DeLuca NA. Expression of herpes simplex virus ICP0 inhibits the induction of interferon-stimulated genes by viral infection. Journal of virology. 2002;76:2180–2191. doi: 10.1128/jvi.76.5.2180-2191.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Everett RD. A detailed mutational analysis of Vmw110, a trans-acting transcriptional activator encoded by herpes simplex virus type 1. The EMBO journal. 1987;6:2069–2076. doi: 10.1002/j.1460-2075.1987.tb02472.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Everett RD. Construction and characterization of herpes simplex virus type 1 mutants with defined lesions in immediate early gene 1. The Journal of general virology. 1989;70(Pt 5):1185–1202. doi: 10.1099/0022-1317-70-5-1185. [DOI] [PubMed] [Google Scholar]
  11. Everett RD, Freemont P, Saitoh H, Dasso M, Orr A, Kathoria M, Parkinson J. The disruption of ND10 during herpes simplex virus infection correlates with the Vmw110- and proteasome-dependent loss of several PML isoforms. Journal of virology. 1998a;72:6581–6591. doi: 10.1128/jvi.72.8.6581-6591.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Everett RD, Orr A, Preston CM. A viral activator of gene expression functions via the ubiquitin-proteasome pathway. The EMBO journal. 1998b;17:7161–7169. doi: 10.1093/emboj/17.24.7161. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Everett RD, Parsy ML, Orr A. Analysis of the functions of herpes simplex virus type 1 regulatory protein ICP0 that are critical for lytic infection and derepression of quiescent viral genomes. Journal of virology. 2009;83:4963–4977. doi: 10.1128/JVI.02593-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Halford WP, Kemp CD, Isler JA, Davido DJ, Schaffer PA. ICP0, ICP4, or VP16 expressed from adenovirus vectors induces reactivation of latent herpes simplex virus type 1 in primary cultures of latently infected trigeminal ganglion cells. Journal of virology. 2001;75:6143–6153. doi: 10.1128/JVI.75.13.6143-6153.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Harris RA, Everett RD, Zhu XX, Silverstein S, Preston CM. Herpes simplex virus type 1 immediate-early protein Vmw110 reactivates latent herpes simplex virus type 2 in an in vitro latency system. Journal of virology. 1989;63:3513–3515. doi: 10.1128/jvi.63.8.3513-3515.1989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Jordan R, Schaffer PA. Activation of gene expression by herpes simplex virus type 1 ICP0 occurs at the level of mRNA synthesis. Journal of virology. 1997;71:6850–6862. doi: 10.1128/jvi.71.9.6850-6862.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Kleiger G, Mayor T. Perilous journey: a tour of the ubiquitin-proteasome system. Trends in cell biology. 2014;24:352–359. doi: 10.1016/j.tcb.2013.12.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Lees-Miller SP, Long MC, Kilvert MA, Lam V, Rice SA, Spencer CA. Attenuation of DNA-dependent protein kinase activity and its catalytic subunit by the herpes simplex virus type 1 transactivator ICP0. Journal of virology. 1996;70:7471–7477. doi: 10.1128/jvi.70.11.7471-7477.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Li W, Cun W, Liu L, Hong M, Wang L, Wang L, Dong C, Li Q. The transactivating effect of HSV-1 ICP0 is enhanced by its interaction with the PCAF component of histone acetyltransferase. Archives of virology. 2009;154:1755–1764. doi: 10.1007/s00705-009-0516-4. [DOI] [PubMed] [Google Scholar]
  20. Meredith M, Orr A, Elliott M, Everett R. Separation of sequence requirements for HSV-1 Vmw110 multimerisation and interaction with a 135-kDa cellular protein. Virology. 1995;209:174–187. doi: 10.1006/viro.1995.1241. [DOI] [PubMed] [Google Scholar]
  21. Minaker RL, Mossman KL, Smiley JR. Functional inaccessibility of quiescent herpes simplex virus genomes. Virology journal. 2005;2:85. doi: 10.1186/1743-422X-2-85. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Mostafa HH, Thompson TW, Davido DJ. N-terminal phosphorylation sites of herpes simplex virus 1 ICP0 differentially regulate its activities and enhance viral replication. Journal of virology. 2013;87:2109–2119. doi: 10.1128/JVI.02588-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Muller S, Dejean A. Viral immediate-early proteins abrogate the modification by SUMO-1 of PML and Sp100 proteins, correlating with nuclear body disruption. Journal of virology. 1999;73:5137–5143. doi: 10.1128/jvi.73.6.5137-5143.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. O’Rourke D, Elliott G, Papworth M, Everett R, O’Hare P. Examination of determinants for intranuclear localization and transactivation within the RING finger of herpes simplex virus type 1 IE110k protein. The Journal of general virology. 1998;79(Pt 3):537–548. doi: 10.1099/0022-1317-79-3-537. [DOI] [PubMed] [Google Scholar]
  25. Osaka I, Hefty PS. Simple resazurin-based microplate assay for measuring Chlamydia infections. Antimicrobial agents and chemotherapy. 2013;57:2838–2840. doi: 10.1128/AAC.00056-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Parkinson J, Everett RD. Alphaherpesvirus proteins related to herpes simplex virus type 1 ICP0 affect cellular structures and proteins. Journal of virology. 2000;74:10006–10017. doi: 10.1128/jvi.74.21.10006-10017.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Perusina Lanfranca M, Mostafa HH, Davido DJ. Two overlapping regions within the N-terminal half of the herpes simplex virus 1 E3 ubiquitin ligase ICP0 facilitate the degradation and dissociation of PML and dissociation of Sp100 from ND10. Journal of virology. 2013;87:13287–13296. doi: 10.1128/JVI.02304-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Preston CM, Nicholl MJ. Repression of gene expression upon infection of cells with herpes simplex virus type 1 mutants impaired for immediate-early protein synthesis. Journal of virology. 1997;71:7807–7813. doi: 10.1128/jvi.71.10.7807-7813.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Roizman B, Knipe DM, Whitley RJ. Herpes simplex viruses. Lippincott Williams & Wilkins; New York, NY: 2007. [Google Scholar]
  30. Samaniego LA, Neiderhiser L, DeLuca NA. Persistence and expression of the herpes simplex virus genome in the absence of immediate-early proteins. Journal of virology. 1998;72:3307–3320. doi: 10.1128/jvi.72.4.3307-3320.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Samaniego LA, Wu N, DeLuca NA. The herpes simplex virus immediate-early protein ICP0 affects transcription from the viral genome and infected-cell survival in the absence of ICP4 and ICP27. Journal of virology. 1997;71:4614–4625. doi: 10.1128/jvi.71.6.4614-4625.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Sarma N, Agarwal D, Shiflett LA, Read GS. Small interfering RNAs that deplete the cellular translation factor eIF4H impede mRNA degradation by the virion host shutoff protein of herpes simplex virus. Journal of virology. 2008;82:6600–6609. doi: 10.1128/JVI.00137-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Smith MC, Goddard ET, Perusina Lanfranca M, Davido DJ. hTERT extends the life of human fibroblasts without compromising type I interferon signaling. PloS one. 2013;8:e58233. doi: 10.1371/journal.pone.0058233. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Stow ND, Stow EC. Isolation and characterization of a herpes simplex virus type 1 mutant containing a deletion within the gene encoding the immediate early polypeptide Vmw110. The Journal of general virology. 1986;67(Pt 12):2571–2585. doi: 10.1099/0022-1317-67-12-2571. [DOI] [PubMed] [Google Scholar]

RESOURCES