Abstract
In response to cardiac damage, a mesothelial tissue layer enveloping the heart called the epicardium is activated to proliferate and accumulate at the injury site. Recent studies have implicated the epicardium in multiple aspects of cardiac repair: a source of paracrine signals for cardiomyocyte survival or proliferation; a supply of perivascular cells and possibly other cell types like cardiomyocytes; and, a mediator of inflammation1-9. Yet, the biology and dynamism of the adult epicardium is poorly understood. Here, we created a transgenic line to ablate this cell population in adult zebrafish. We find that genetic depletion of epicardium after myocardial loss inhibits cardiomyocyte proliferation and delays muscle regeneration. The epicardium vigorously regenerates after its ablation, through proliferation and migration of spared epicardial cells as a sheet to cover the exposed ventricular surface in a wave from the chamber base toward its apex. By reconstituting epicardial regeneration ex vivo, we show that extirpation of the bulbous arteriosus (BA), a distinct, smooth muscle-rich tissue structure that distributes outflow from the ventricle, prevents epicardial regeneration. Conversely, experimental repositioning of the BA by tissue recombination initiates epicardial regeneration and can govern its direction. Hedgehog (Hh) ligand is expressed in the BA, and treatment with Hh signaling antagonist arrests epicardial regeneration and blunts the epicardial response to muscle injury. Transplantation of Shh-soaked beads at the ventricular base stimulates epicardial regeneration after BA removal, indicating that Hh signaling can substitute for the BA influence. Thus, the ventricular epicardium has pronounced regenerative capacity, regulated by the neighboring cardiac outflow tract and Hh signaling. These findings extend our understanding of tissue interactions during regeneration and have implications for mobilizing epicardial cells for therapeutic heart repair.
Keywords: heart regeneration, epicardium, ventricle, outflow tract, zebrafish, Hedgehog
To assess homeostatic properties of the epicardium, we employed an inducible cell ablation system in adult zebrafish. Targeted expression of bacterial Nitroreductase (NTR) depletes specific cell types via conversion of a non-toxic substrate metronidazole (Mtz) to a cytotoxin10-12. We used tcf21 regulatory sequences, which in zebrafish drive the most widespread epicardial expression of known DNA elements2, to create an NTR transgenic line for lesioning this tissue without direct myocardial damage. After treatment of adult tcf21:NTR; tcf21:nucEGFP animals with Mtz, ~90% of EGFP+ epicardial nuclei on average were ablated from the ventricular surface in large patches (Fig. 1a, b, f).
To determine whether epicardial depletion impacts the well-documented capacity of the zebrafish heart to regenerate13, we transiently incubated tcf21:NTR zebrafish with Mtz after resection of the ventricular apex. Mtz treatment reduced epicardial cell number in the 7 days post-amputation (dpa) injury site by ~45%, while reducing cardiomyocyte proliferation indices by ~33% (Fig. 1c, d, Extended Data Figs. 1a, b and 3c). Myofibroblasts were represented similarly in vehicle- and Mtz-treated clutchmates by 14 dpa (Extended Data Fig. 1c). Injured ventricles of Mtz-treated animals displayed reduced vascularization and muscularization by 30 dpa (Fig. 1e and Extended Data Fig. 1d, e), associated with fibrin and collagen retention (Fig. 1e). By 60 dpa, ventricles from Mtz-treated animals consistently showed normal muscularization and a large complement of tcf21-positive cells, along with minor collagen deposits (Extended Data Fig. 1f). Thus, depletion of epicardial tissue inhibits cardiomyocyte proliferation and vascularization after resection injury, reducing the efficacy of heart regeneration.
These experiments suggested a high capacity of epicardial cells to regenerate after major depletion. To test this directly, we examined otherwise uninjured hearts at different times after epicardial ablation. Ventricular epicardial cells typically have a low proliferation index (Extended Data Fig. 2a). However, within 3 days of Mtz treatment (3 dpi), many spared epicardial cells entered the cell cycle (Extended Data Fig. 2b, c). At 7 dpi, ventricles displayed quantifiable epicardial recovery that was more prominent at the chamber base (Fig. 1b). By 14 dpi, and as early as 7 dpi, ventricles were fully covered to their apices with tcf21:nucEGFP+ epicardial cells (Fig. 1b, f). The temporal variation in recovery likely reflects variation in location/pattern of epicardial cells spared by ablation among clutchmates, or in chamber size (Extended Data Fig. 3a). To examine origins of regenerated epicardium, we employed inducible Cre-based genetic fate-mapping to permanently label tcf21-expressing cells and their progeny prior to injury2. Labeling and subsequent fate-mapping experiments indicated that pre-existing epicardial cells, and not a tcf21-negative precursor, are a primary source for regeneration (Fig. 1g, h). In total, these experiments reveal that adult epicardium regenerates after substantial genetic ablation, through a mechanism of expansion by spared epicardial cells.
To expand our range of experimental manipulations, we refined protocols such that freshly dissected hearts contracted for several weeks ex vivo (Supplementary Video 1)14,15. When Mtz was added transiently to culture medium for one day, ventricular epicardial cells were potently ablated. Epicardial layers of the atrium and the BA (alternatively referred to as outflow tract) were less effectively depleted (Fig. 2a), likely due to differential expression of the NTR transgene among cardiac chambers (Extended Data Fig. 3b). Daily imaging of these hearts confirmed observations from in vivo experiments, demonstrating regeneration of the epicardium from base to apex that is typically completed in 2 weeks (Fig. 2a). Hearts from animals given partial ventricular resections injuries in vivo showed a similar pattern of epicardial regeneration after ex vivo ablation (Extended Data Fig. 4a). Cardiac muscle regeneration was ineffective in explanted hearts in our experiments. Increases in cell number occurred concomitantly with movement across the myocardial surface during epicardial regeneration, with spared epicardial cell patches away from the leading edge eventually incorporated into the sheet (Fig. 2a).
To identify possible intrinsic differences in epicardial cells from different ventricular regions, we examined behaviors of basal or apical epicardial tissue patches transplanted to ablated ventricles. In these experiments, transplanted cells of either origin consistently repopulated the ventricular surface in a base-to-apex direction after transplantation (Extended Data Fig. 5a-d), revealing no proliferative bias in ventricular epicardial cells that could explain the directional flow of regeneration. To assess potential extrinsic influences on epicardial regeneration, we removed the atrium or BA from its attachment at the ventricular base prior to epicardial ablation. Atrial extirpation did not noticeably affect regeneration of ventricular epicardium (Fig. 2b and Supplementary Video 2). By contrast, removal of outflow tissue blocked epicardial cell recovery, an arrest that persisted for at least two weeks (Fig. 2c, d and data not shown). To test whether this arrest was solely a consequence of mechanical tissue disruption, we ablated the epicardium after host BA removal, before grafting a non-transgenic BA to the ventricular base 2 days later. In most of these tissue recombination procedures (13 of 21), host tcf21:nucEGFP+ epicardium regenerated to cover the ventricle (Fig. 3a). This effect was not observed when a portion of donor ventricular apex was inverted and transplanted to the host ventricular base (Extended Data Fig. 5e). Complementary grafting experiments indicated that BA could contribute epicardial cells to the ventricular surface, as a potential supplement to expansion of the ventricular epicardial cell pool (Extended Data Fig. 5f). Thus, our experiments indicate that outflow tissue provides an essential interaction for regeneration from existing ventricular epicardial cells.
To test if outflow tract tissue is sufficient to stimulate epicardial regeneration, we ectopically positioned experimentally manipulated cardiac structures. Co-culture of several BAs in a transwell assay with an epicardially ablated ventricle did not restore regeneration in the absence of host BA (Extended Data Fig. 6a). Similarly, a BA graft placed at the ventricular apex showed no evidence of directing regeneration of basally located host epicardial cells toward the apex (Extended Data Fig. 6b). Thus, we could not detect BA effects requiring long-range diffusion through tissue or culture medium. Next, we transplanted an tcf21:nucEGFP+ epicardial cell patch to the apex of an ablated host ventricle, after which we grafted a wild-type BA to the apex (Fig. 3b). Remarkably, the apical BA was capable of stimulating apex-to-base regeneration from the nearby epicardial patch in a high proportion (21 of 32) of experiments, effectively reversing the stereotypic direction of recovery (Fig. 3c, d). Together, these experiments indicate that the cardiac outflow tract is necessary and sufficient for epicardial regeneration, and that this neighboring tissue provides a short-range influence(s) that directs regeneration from base to apex.
What is the molecular nature of interactions between outflow tract and ventricular epicardium? To address this, we applied a small panel of signaling pathway effectors to epicardially ablated hearts cultured ex vivo. Among several compounds (Extended Data Fig. 7), the Smoothened (Smo) antagonist cyclopamine (CyA) blocked regeneration; yet, regeneration initiated normally after drug washout (Fig. 4a). CyA treatment reduced spontaneous epicardial cell EdU incorporation occurring in the first 2 days of explant culture, suggesting that intact Hh signaling promotes epicardial proliferation (Extended Data Fig. 8a, b). CyA also disrupted in vivo epicardial regeneration, not only in adults but in larvae, an additional developmental setting in which we identified base-to-apex regeneration (Fig. 4b, c and Extended Data Fig. 9a-c). CyA treatment from 2 to 4 dpf also reduced the initial epicardial occupancy of the larval ventricle (Extended Data Fig. 9d-f), indicating that epicardial regeneration recapitulates at least one pathway influential in morphogenesis. Finally, we observed inhibitory effects of CyA on the epicardial proliferative response to muscle resection in vivo, and in coverage of these injuries ex vivo (Extended Data Fig. 4b and Extended Data Fig. 8c, d).
Smo is an effector for several Hh family ligands, which have potent short-range effects in multiple contexts of embryonic development16-21. Quantitative PCR revealed shha, ihhb and dhh ligand transcripts in adult atrium, ventricle, and BA, where in situ hybridization detected shha and dhh transcript signals in smooth muscle tissue (Extended Data Fig. 10a-d). Epicardial ablation injury boosted BA and ventricular shha levels, as well as levels of ptch1 and gli2a in purified epicardial cells (Fig. 4d, e). Moreover, a shha:EGFP reporter strain visualized shha regulatory sequence-driven fluorescence in smooth muscle and epicardial tissues of the BA (Extended Data Fig. 10e). No additional in situ hybridization or shha:EGFP fluorescence patterns were detectable after epicardial ablation; however, apical resection injury induced fluorescence in ventricular epicardial tissue by 2 dpa (Extended Data Fig. 10d, f). To test whether local Hh ligand delivery is sufficient to substitute for the BA, we removed atrium and BA from cardiac explants, ablated epicardial cells, and applied beads soaked with Shh protein to the exposed ventricular base. Shh-soaked beads stimulated epicardial regeneration (one-half or greater coverage) in 9 of 32 ventricles, whereas this level of recovery never occurred after transplantation of BSA-soaked beads ((0 of 27) ventricles; Fig. 4f). We speculate that these effects of Hh on the epicardial sheet might involve cytoplasmic extensions or a factor transport system22,23. Together, our findings support a model in which Hh ligand from outflow tract, and possibly additional tissues, guides the base-to-apex regeneration of ventricular epicardium.
In conclusion, we have identified a requirement for the mesothelial covering of the zebrafish heart in the proficiency of muscle regeneration. Moreover, we show that the ventricular epicardium itself has high endogenous renewal capacity, vigorously regenerating as a sheet from the base of the chamber to its apex after genetic depletion. Our results point to the outflow tract as an unexpected signaling center and source of Hh, and possibly additional influences, that can promote epicardial regeneration. It is likely that tissue regeneration is similarly regulated in trans in other contexts; for example, to maintain the mesothelium lining abdominal organs. As a mediator of epicardial regeneration, Hh signaling can be integrated into new strategies to modulate repair of the damaged heart.
METHODS
Zebrafish maintenance and procedures
Adult zebrafish of the Ekkwill and Ekkwill/AB strains were maintained as described and resection injuries were performed as described24,13. Animals between 4 and 12 months of both sexes were used. Transgenic lines used in this study were Tg(tcf21:mCherry-NTR)pd108 (tcf21:NTR, described below), Tg(tcf21:nucEGFP)pd41 24, Tg(tcf21:CreER)pd42 2, Tg(gata5:loxpmCherry-loxp-nucEGFP)pd40 25, Tg(fli1a:EGFP)y1 26 and Tg(shha:EGFP)sb15 27. All transgenic strains were analyzed as hemizygotes. For epicardial ablation experiments in adults, animals were bathed for 24 hours in 10 mM Mtz (Sigma) as described and returned to water12. If ablation was performed after ventricular resection, we used a protocol of daily changes of 1 mM Mtz solution for 3 days that had similar ablation effects (Extended Data Fig. 3c). This period corresponds with the early epicardial proliferative response to resection injury (ref #7 and data not shown), and was intended to extend the ablation window and improve animal survival. For larval epicardial ablation, 6 hpf embryos were bathed for 48 hours in 10 mM Mtz before washout. For ex vivo epicardial ablation, dissected hearts were bathed for 24 hours in 1 mM Mtz before washout. Cyclopamine (CyA, Selleckchem) was dissolved in ethanol to a final concentration of 20 mM. CyA was used at 10 μM for in vivo treatment of adult animals and 5 μM for ex vivo culture and embryo treatments. For EdU incorporation experiments that followed epicardial ablation, animals were injected with 10 mM EdU 4 hours prior to collection. Experiments with uninjured animals used 3 daily 10 mM EdU injections. For lineage tracing, strains carrying tcf21:NTR; tcf21:CreER, and gata5:loxp-mCherry-loxp-nucEGFP transgenes were placed in a small beaker of aquarium water containing 5 μM tamoxifen. Fish were maintained for 24 hours, rinsed with fresh aquarium water, and returned to a recirculating aquatic system for 24 hours, before repeating this incubation twice. After 3 days of rinsing, Mtz was added for an additional 24 hours. As is common when using Cre-based tools, we could not genetically label all epicardial cells in these experiments or rule out minor contributions by tcf21-negative cells. Animal procedures were performed in accordance with Duke University guidelines.
Construction of tcf21:NTR zebrafish
The translational start codon of tcf21 in the BAC clone DKEYP-79F12 was replaced with the mCherry-NTR cassette by Red/ET recombineering technology (Gene Bridges)12. The 5’ and 3’ homologous arms for recombination were a 50-base pair (bp) fragment upstream and downstream of the start codon, and were included in PCR primers to flank the mCherry-NTR cassette. To avoid aberrant recombination between the mCherry-NTR cassette and the endogenous loxp site in the BAC vector, we replaced the vector-derived loxp site with an I-SceI site using the same technology. The final BAC was purified with Nucleobond BAC 100 kit (Clontech) and co-injected with I-SceI into one-cell-stage zebrafish embryos.
Ex vivo cardiac explants
Adult hearts were rinsed several times in PBS after collection and cultured in dishes with DMEM medium plus 10% fetal bovine serum, 1% non-essential amino acids, 100 U/ml penicillin, 100 μg/ml streptomycin, and 50 μM 2-Mercaptoethanol, while rotating at 150 rpm. Primocin™ (InvivoGen) was added to prohibit microbial contaminants during the first 3 days primary culture. For transplantation experiments, outflow tract or ventricular tissues were grafted by mounting in 1% low-melting point agarose with ablated hearts in culture dishes, and covering with medium. After 2 days of culturing, attached tissues were released from the agarose; if transplanting an epicardial patch, the ventricular donor tissue was removed carefully using forceps. Fluorescent transgenes in these cardiac explants were monitored using a Leica MZ05FA stereofluorescence microscope.
Recombinant mouse Sonic Hedgehog (C25II), N-terminus protein (R & D Systems) was reconstituted at 100 μg/ml in phosphate buffered saline (PBS) containing 0.1% bovine serum albumin (BSA). Affi-Gel Blue beads (Bio-Rad) were prepared by thoroughly washing the beads in PBS, then incubating them in the Shh solution for 2 hours at room temperature. A solution with the same concentration of BSA protein was used as the control. The beads were then applied to the base of ventricular explants that were settled in low-melting point agarose in serum-free DMEM supplemented as above. After 24 hours, the ventricles were released from the agarose with the attached beads and cultured in supplemented, serum-free DMEM. Under these ex vivo culture conditions we observed no increase in cardiomyocyte proliferation upon resection injury.
Preparation of outflow tract and ventricular epicardial cells and RT-qPCR
Adult hearts were dissected from tcf21:NTR or tcf21:NTR; tcf21:nucEGFP animals 3 and 7 days post-treatment with vehicle or Mtz. Outflow tracts were frozen in liquid nitrogen. Ventricular nucEGFP+ epicardial cells were isolated as described previously28 with modifications. Briefly, ventricles were collected on ice and washed several times to remove blood cells. Ventricles were digested in an Eppendorf tube with 0.5 ml HBSS plus 0.13 U/ml Liberase DH (Roche) and 1% sheep serum at 37°C, while stirring gently with a Spinbar® magnetic stirring bar (Bel-Art Products). Supernatants were collected every 5 min and neutralized with sheep serum. Dissociated cells were spun down and sorted using a BD FACSVantage SE sorter for EGFP-positive cells. Total RNA was extracted using an RNAqueous®-Micro isolation kit (Ambion) according to the manufacturer's instructions. Reverse transcription was carried out using a SuperScript III First-Strand synthesis kit (Life Technologies). qPCR was carried out in triplicate using an Roche LightCycler® 480 II system with the LightCycler® 480 Probes Master Mix and the Universal Probe Library (UPL) (Roche). rpl13a served as the control. Primers and the UPL# used in this study were:
shha-f aagcccacattcattgctct and shha-r ccttctgtcctccgtcctg, UPL #54;
shhb-f gcaagtatgggatgctatccag and shhb-r tcctgatttagcagccactg, UPL #16;
ihha-f tgggtctactatgagtccaaagc and ihha-r ggttttagcagccacagagtg, UPL #86;
ihhb-f tcttgttatgctgcggtgaa and ihhb-r aagcgtagaggtgcaaaagc, UPL #140;
dhh-f cgtgcactgctctgtcaaa and dhh-r aaacatgacatgggcttttgt, UPL #156;
ptch1-f tggcttaagggcagctaatc and ptch1-r gccgtgtgtacttgagttcct, UPL #87;
ptch2-f ccatgacatcaactggaatga and ptch2-r gaatgctcccatgaacaacc, UPL #6;
gli1-f ctgcagcaaagagttcgaca and gli1-r ctccgtggatgtgctcatta, UPL #68;
gli2a-f cctcacccaccacagcat and gli2a-r cgatcgggattggtgtgt, UPL #39;
gli2b-f cctgccagaatacttcacatca and gli2b-r ctcaacctgggcgtcatac, UPL #48;
rpl13a-f gcggaccgattcaataagg and rpl13a-r gaaagacgaccgaggagatg, UPL #147.
Histology
Analyses of cardiomyocyte proliferation were performed as previously described by counting Mef2+ and PCNA+ nuclei in wound sites14. To quantify vascular endothelial cells in the wound site by 30 dpa with fli1a:EGFP or tcf21NTR; fli1a:EGFP animals, three medial, longitudinal sections were selected from each heart. Images of single optical slices of green fluorescence in the wound site were acquired using a 20× objective (1024×1024 pixels). EGFP+ areas were quantified in pixels by ImageJ software, and the ratio of EGFP+ area versus the length of the outlined apical wound was calculated for each heart. To quantify tcf21+ epicardial cells in the wound site at 7 and 30 dpa with tcf21:nucEGFP or tcf21:NTR; tcf21:nucEGFP animals, three medial, longitudinal sections were selected from each heart. EGFP+ cells were counted in the wound area, and the ratio of EGFP+ cells versus the length of the outlined apical wound was calculated for each heart. Acid Fuchsin-Orange G and immunostaining were performed as described13. Primary antibodies used in this study were anti-Myosin heavy chain (MHC; F59, mouse; Developmental Studies Hybridoma Bank), anti-GFP (rabbit; Invitrogen), anti-Mef2 (rabbit; Santa Cruz Biotechnology), anti-MLCK (mouse, K36; Sigma), and anti-PCNA (mouse; Sigma). Secondary antibodies (Invitrogen) used in this study were: Alexa Fluor 488 goat anti-rabbit; Alexa Fluor 594 goat anti-rabbit, goat anti-rat and goat anti-mouse; and Alexa 633 goat anti-mouse. EdU was detected through a click reaction as described previously29 with fluorescent azide (Alexa Fluor® 594 or 647, Invitrogen). Whole-mounted and sectioned ventricular tissues were imaged used a Zeiss 700 confocal microscope.
Data collection and statistics
Clutchmates (or hearts collected from clutchmates) were randomized into different treatment groups for each experiment. No animal or sample was excluded from the analysis unless the animal died during the procedure. All experiments were performed with at least 2 biological replicates, using appropriate numbers of samples for each replicate. Sample sizes were chosen based on previous publications and experiment types, and are indicated in each figure legend. For expression patterns, at least 6 fish were examined. For assessment of epicardial ablation and consequences on muscle regeneration, at least 9 fish were examined. At least 12 hearts of each group were pooled for RNA purification and subsequent RT-qPCR. For ex vivo epicardial ablation experiments, at least 6 hearts were used for each treatment. An exception was the small compound screen, where at least 4 hearts were used for each drug. Quantification of cell proliferation and calculation of statistical outcomes were assessed by a person blinded to the treatments. All statistical values are displayed as Mean +/- Standard Deviation. Sample sizes, statistical tests, and P values are indicated in the figures or the legends. Student's t-tests (two-tailed) were applied when normality and equal variance tests were passed. The Mann-Whitney Rank Sum test was used when these failed. Fisher Irwin exact tests or Chi-square tests were used where appropriate.
Extended Data
Supplementary Material
Acknowledgments
We thank J. Burris, N. Lee, A. Dunlap, and S. Davies for fish care, and M. Bagnat, B. Hogan, J. Kang, and R. Karra for comments on the manuscript. This work was funded by postdoctoral fellowships from the American Heart Association to J.W. and J.C., and grants from NIH (HL081674) and American Federation for Aging Research to K.D.P.
Footnotes
Author Contributions. J.W., J.C., and K.D.P. designed experimental strategy, analyzed data, and prepared the manuscript. J.W. generated the transgenic system for epicardial cell ablation and performed in vivo regeneration experiments and analysis. J.C. developed the ex vivo culture assay and performed ex vivo regeneration experiments and analysis. A.D. performed histology and data analysis. All authors commented on the manuscript.
Author Information. The authors declare no competing financial interests. Readers are welcome to comment on the online version of the paper.
References
- 1.Huang GN, et al. C/EBP transcription factors mediate epicardial activation during heart development and injury. Science. 2012;338:1599–1603. doi: 10.1126/science.1229765. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Kikuchi K, et al. tcf21+ epicardial cells adopt non-myocardial fates during zebrafish heart development and regeneration. Development. 2011;138:2895–2902. doi: 10.1242/dev.067041. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Smart N, et al. De novo cardiomyocytes from within the activated adult heart after injury. Nature. 2011;474:640–644. doi: 10.1038/nature10188. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Zhou B, et al. Adult mouse epicardium modulates myocardial injury by secreting paracrine factors. J. Clin. Invest. 2011;121:1894–1904. doi: 10.1172/JCI45529. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Wang J, Karra R, Dickson AL, Poss KD. Fibronectin is deposited by injury-activated epicardial cells and is necessary for zebrafish heart regeneration. Dev. Biol. 2013;382:427–435. doi: 10.1016/j.ydbio.2013.08.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Smart N, et al. Thymosin beta4 induces adult epicardial progenitor mobilization and neovascularization. Nature. 2007;445:177–182. doi: 10.1038/nature05383. [DOI] [PubMed] [Google Scholar]
- 7.Lepilina A, et al. A dynamic epicardial injury response supports progenitor cell activity during zebrafish heart regeneration. Cell. 2006;127:607–619. doi: 10.1016/j.cell.2006.08.052. [DOI] [PubMed] [Google Scholar]
- 8.Song K, et al. Heart repair by reprogramming non-myocytes with cardiac transcription factors. Nature. 2012;485:599–604. doi: 10.1038/nature11139. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Qian L, et al. In vivo reprogramming of murine cardiac fibroblasts into induced cardiomyocytes. Nature. 2012;485:593–598. doi: 10.1038/nature11044. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Pisharath H, Rhee JM, Swanson MA, Leach SD, Parsons MJ. Targeted ablation of beta cells in the embryonic zebrafish pancreas using E. coli nitroreductase. Mech. Dev. 2007;124:218–229. doi: 10.1016/j.mod.2006.11.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Curado S, et al. Conditional targeted cell ablation in zebrafish: a new tool for regeneration studies. Dev. Dyn. 2007;236:1025–1035. doi: 10.1002/dvdy.21100. [DOI] [PubMed] [Google Scholar]
- 12.Singh SP, Holdway JE, Poss KD. Regeneration of amputated zebrafish fin rays from de novo osteoblasts. Dev. Cell. 2012;22:879–886. doi: 10.1016/j.devcel.2012.03.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Poss KD, Wilson LG, Keating MT. Heart regeneration in zebrafish. Science. 2002;298:2188–2190. doi: 10.1126/science.1077857. [DOI] [PubMed] [Google Scholar]
- 14.Kikuchi K, et al. Retinoic acid production by endocardium and epicardium is an injury response essential for zebrafish heart regeneration. Dev. Cell. 2011;20:397–404. doi: 10.1016/j.devcel.2011.01.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Kim J, Rubin N, Huang Y, Tuan TL, Lien CL. In vitro culture of epicardial cells from adult zebrafish heart on a fibrin matrix. Nat. Protoc. 2012;7:247–255. doi: 10.1038/nprot.2011.440. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Riddle RD, Johnson RL, Laufer E, Tabin C. Sonic hedgehog mediates the polarizing activity of the ZPA. Cell. 1993;75:1401–1416. doi: 10.1016/0092-8674(93)90626-2. [DOI] [PubMed] [Google Scholar]
- 17.Roelink H, et al. Floor plate and motor neuron induction by different concentrations of the amino-terminal cleavage product of sonic hedgehog autoproteolysis. Cell. 1995;81:445–455. doi: 10.1016/0092-8674(95)90397-6. [DOI] [PubMed] [Google Scholar]
- 18.Fan CM, Tessier-Lavigne M. Patterning of mammalian somites by surface ectoderm and notochord: evidence for sclerotome induction by a hedgehog homolog. Cell. 1994;79:1175–1186. doi: 10.1016/0092-8674(94)90009-4. [DOI] [PubMed] [Google Scholar]
- 19.Roelink H, et al. Floor plate and motor neuron induction by vhh-1, a vertebrate homolog of hedgehog expressed by the notochord. Cell. 1994;76:761–775. doi: 10.1016/0092-8674(94)90514-2. [DOI] [PubMed] [Google Scholar]
- 20.Echelard Y, et al. Sonic hedgehog, a member of a family of putative signaling molecules, is implicated in the regulation of CNS polarity. Cell. 1993;75:1417–1430. doi: 10.1016/0092-8674(93)90627-3. [DOI] [PubMed] [Google Scholar]
- 21.Johnson RL, Laufer E, Riddle RD, Tabin C. Ectopic expression of Sonic hedgehog alters dorsal-ventral patterning of somites. Cell. 1994;79:1165–1173. doi: 10.1016/0092-8674(94)90008-6. [DOI] [PubMed] [Google Scholar]
- 22.Guerrero I, Kornberg TB. Hedgehog and its circuitous journey from producing to target cells. Sem. Cell Dev. Biol. 2014;33:52–62. doi: 10.1016/j.semcdb.2014.06.016. [DOI] [PubMed] [Google Scholar]
- 23.Sanders TA, Llagostera E, Barna M. Specialized filopodia direct long-range transport of SHH during vertebrate tissue patterning. Nature. 2013;497:628–632. doi: 10.1038/nature12157. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Wang J, et al. The regenerative capacity of zebrafish reverses cardiac failure caused by genetic cardiomyocyte depletion. Development. 2011;138:3421–3430. doi: 10.1242/dev.068601. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Kikuchi K, et al. Primary contribution to zebrafish heart regeneration by gata4(+) cardiomyocytes. Nature. 2010;464:601–605. doi: 10.1038/nature08804. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Lawson ND, Weinstein BM. In vivo imaging of embryonic vascular development using transgenic zebrafish. Dev. Biol. 2002;248:307–318. doi: 10.1006/dbio.2002.0711. [DOI] [PubMed] [Google Scholar]
- 27.Shkumatava A, Fischer S, Muller F, Strahle U, Neumann CJ. Sonic hedgehog, secreted by amacrine cells, acts as a short-range signal to direct differentiation and lamination in the zebrafish retina. Development. 2004;131:3849–3858. doi: 10.1242/dev.01247. [DOI] [PubMed] [Google Scholar]
- 28.Zhou B, Pu WT. Isolation and characterization of embryonic and adult epicardium and epicardium-derived cells. Meth. Mol. Biol. 2012;843:155–168. doi: 10.1007/978-1-61779-523-7_15. [DOI] [PubMed] [Google Scholar]
- 29.Salic A, Mitchison TJ. A chemical method for fast and sensitive detection of DNA synthesis in vivo. Proc. Natl. Acad. Sci. U.S.A. 2008;105:2415–2420. doi: 10.1073/pnas.0712168105. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.