Skip to main content
BMC Plant Biology logoLink to BMC Plant Biology
. 2015 May 23;15:126. doi: 10.1186/s12870-015-0504-7

Linkage mapping, molecular cloning and functional analysis of soybean gene Fg3 encoding flavonol 3-O-glucoside/galactoside (1 → 2) glucosyltransferase

Shaokang Di 1, Fan Yan 1, Felipe Rojas Rodas 1,5, Tito O Rodriguez 1, Yoshinori Murai 2, Tsukasa Iwashina 2, Satoko Sugawara 3, Tetsuya Mori 3, Ryo Nakabayashi 3, Keiko Yonekura-Sakakibara 3, Kazuki Saito 3, Ryoji Takahashi 1,4,
PMCID: PMC4494776  PMID: 26002063

Abstract

Background

Flavonol glycosides (FGs) are major components of soybean leaves and there are substantial differences in FG composition among genotypes. The first objective of this study was to identify genes responsible for FG biosynthesis and to locate them in the soybean genome. The second objective was to clone the candidate genes and to verify their function. Recombinant inbred lines (RILs) were developed from a cross between cultivars Nezumisaya and Harosoy.

Results

HPLC comparison with authentic samples suggested that FGs having glucose at the 2″-position of glucose or galactose that is bound to the 3-position of kaempferol were present in Nezumisaya, whereas FGs of Harosoy were devoid of 2″-glucose. Conversely, FGs having glucose at the 6″-position of glucose or galactose that is bound to the 3-position of kaempferol were present in Harosoy, whereas these FGs were absent in Nezumisaya. Genetic analysis suggested that two genes control the pattern of attachment of these sugar moieties in FGs. One of the genes may be responsible for attachment of glucose to the 2″-position, probably encoding for a flavonol 3-O-glucoside/galactoside (1 → 2) glucosyltransferase. Nezumisaya may have a dominant whereas Harosoy may have a recessive allele of the gene. Based on SSR analysis, linkage mapping and genome database survey, we cloned a candidate gene designated as GmF3G2″Gt in the molecular linkage group C2 (chromosome 6). The open reading frame of GmF3G2″Gt is 1380 bp long encoding 459 amino acids with four amino acid substitutions among the cultivars. The GmF3G2″Gt recombinant protein converted kaempferol 3-O-glucoside to kaempferol 3-O-sophoroside. GmF3G2″Gt of Nezumisaya showed a broad activity for kaempferol/quercetin 3-O-glucoside/galactoside derivatives but it did not glucosylate kaempferol 3-O-rhamnosyl-(1 → 4)-[rhamnosyl-(1 → 6)-glucoside] and 3-O-rhamnosyl-(1 → 4)-[glucosyl-(1 → 6)-glucoside].

Conclusion

GmF3G2″Gt encodes a flavonol 3-O-glucoside/galactoside (1 → 2) glucosyltransferase and corresponds to the Fg3 gene. GmF3G2″Gt was designated as UGT79B30 by the UGT Nomenclature Committee. Based on substrate specificity of GmF3G2″Gt, 2″-glucosylation of flavonol 3-O-glycoside may be irreconcilable with 4″-glycosylation in soybean leaves.

Electronic supplementary material

The online version of this article (doi:10.1186/s12870-015-0504-7) contains supplementary material, which is available to authorized users.

Keywords: Fg3 gene, Flavonol glycoside, Flavonol 3-O-glucoside/galactoside (1 → 2) glucosyltransferase, Glycine max, Soybean

Background

Leaves of soybean (Glycine max (L.) Merr.) contain a variety of flavonol glycosides (FGs) that are derivatives of quercetin and kaempferol [1]. Buzzell and Buttery [2] proposed four flavonol glycoside alleles, viz., Fg1 (β(1–6)-glucoside present), Fg2 (α(1–6)-rhamnoside present), Fg3 (β(1–2)-glucoside present), and Fg4 (α(1–2)-rhamnoside present). These alleles are defined by their ability to bind glucose or rhamnose at either position 2″ or 6″ to the glucose moiety that is bound to the 3-position of flavonols. Later, Buzzell and Buttery [3] reported a new allele of the Fg2 locus, resulting in a series of alleles, Fg2-a, Fg2-b and fg2. Fg3 and Fg4 are linked with a recombination frequency of 12% in the molecular linkage group C2 (chromosome 6) [4]. Plants with the Fg1Fg3 alleles have a lower rate of photosynthesis, lower leaf chlorophyll concentration, lower leaf weight, and lower seed yield [5]. Further, Fg1 and Fg3 control waviness of leaf margins in soybean [6].

Glycosyltransferases (GTs) catalyze the transfer of sugar moieties from activated donor molecules to specific acceptor molecules, forming glycosidic bonds [7]. GTs are classified into at least 96 families (GT1-GT96, http://www.cazy.org/GlycosylTransferases.html). The family 1 glycosyltransferase, referred to as UDP glycosyltransferases (UGTs), comprise the largest group in plants. UGTs catalyze the transfer of a glycosyl moiety from UDP sugars to a wide range of acceptor molecules including flavonoids [8].

Rojas Rodas et al. [9] performed genetic analysis using RILs derived from a cross between Koganejiro and Kitakomachi which are soybean cultivars with gray pubescence. FGs of Koganejiro had rhamnose at the 6″-position of glucose or galactose that is bound to the 3-position of kaempferol, whereas FGs of Kitakomachi were devoid of rhamnose. The presence of 6″-rhamnose was controlled by a single gene. They cloned a candidate gene, GmF3G6″Rt, in the molecular linkage group O (chromosome 10). The recombinant GmF3G6″Rt protein converted UDP-rhamnose and kaempferol 3-O-glucoside or kaempferol 3-O-galactoside to kaempferol 3-O-rutinoside or kaempferol 3-O-robinobioside, proving that GmF3G6″Rt encodes a flavonol 3-O-glucoside/galactoside (1 → 6) rhamnosyltransferase and corresponds to the Fg2 gene. Thus, either glucose or galactose was attached to the 3-position of kaempferol partially contradicting Buttery and Buzzell [10] who reported that only glucose was attached to the 3-position. In addition, FGs having rhamnose at the 4″-position of 3-O-galactose, kaempferol 3-O-rhamnosyl-(1 → 4)-[rhamnosyl-(1 → 6)-galactoside] and kaempferol 3-O-rhamnosyl-(1  4)-[glucosyl-(1  6)-galactoside] have been identified in the leaves of soybean [9,11], suggesting the existence of flavonol 3-O-galactoside (1 → 4) rhamnosyltransferase in soybean. Hence, the genetic control of FG biosynthesis proposed by Buttery and Buzzell [10] should be revised. Overall, glucose or galactose is attached to the 3-position of kaempferol or quercetin in the biosynthesis of FGs in soybean leaves. Glucose can be attached to the 2″- or 6″-positions of glucose or galactose whereas rhamnose can be attached to the 2″-, 4″- or 6″-positions, resulting in a wide variety of FGs [9].

Preliminary experiments suggested that a Japanese landrace, Nezumisaya, and a Canadian cultivar Harosoy, both with gray pubescence, had different FG compositions in leaves (T. Iwashina et al., unpublished results, 2010). The first objective of this study was to identify genes for FG biosynthesis and locate them in the soybean genome using RILs derived from a cross between Nezumisaya and Harosoy. The second objective was to clone and verify their function.

Methods

Plant materials

Nezumisaya with yellow hilum, yellow seed coats, gray pubescence and purple-blue flowers (IIttW1W1w2w2w3w3W4W4WmWmWpWp) was crossed with Harosoy with yellow hilum, yellow seed coats, gray pubescence and purple flowers (IIttW1W1W2W2w3w3W4W4WmWmWpWp). Flowers of Nezumisaya were emasculated one day before opening and fertilized with pollen from Harosoy in 2004. Hybridity of F1 plants was ascertained based on the presence of purple flowers. A total of 120 RILs of F6 generation were developed without any selection by the single-seed descent method. Seeds were planted at the National Institute of Crop Science, Tsukuba, Japan (36°06′N, 140°05′E) on June 9, 2011. N, P, and K were applied at 3.0, 4.4, and 8.3 g m−2, respectively. Plants were individually planted 10 cm apart within rows that were spaced 70 cm apart. On average, nine plants were grown for each parent and RIL.

Extraction of FGs

A total of 94 RILs was randomly selected and used for analysis because PCR reaction plates and electrophoresis apparatus were designed for multiples of 96 samples (94 RILs and 2 parents). Trifoliolate leaves were collected in bulk from 4 plants from the parents and the RILs at R6 stage [12]. Sampling of leaves and preparation of HPLC samples were performed as previously described [9]. Ten μl from each sample was subjected to high performance liquid chromatography (HPLC) analysis.

HPLC and genetic analyses

Quantitative HPLC separation of the extracts was performed with the Agilent 1100 HPLC System (Agilent Technologies) using L-column 2 ODS [I.D. 6.0 × 150 mm (Chemicals Evaluation and Research Institute)] at a flow rate of 1.0 ml/min, detection wavelengths from 190–700 nm and phosphoric acid/acetonitrile/H2O (0.2:18:82) as eluent. FGs were detected at 350 nm wavelength and their corresponding amounts were estimated from the pertinent peak areas in the HPLC chromatogram. The genetic model for FG composition was hypothesized based on the HPLC chromatogram of the parents and the RILs, and the chemical structure of the pertinent peaks. Likelihood of the genetic model was estimated by Chi-square test.

SSR analysis and linkage mapping

Genomic DNA of the parents and the four plants from each of the RILs used for FG analysis were isolated from trifoliolate leaves by the CTAB method [13]. A total of 465 SSR markers developed by USDA [14] and by the Kazusa DNA Research Institute [15] were used for screening of polymorphisms among the parents. SSR analysis was performed as previously described [9]. The markers were tested by Chi-square analyses for segregation in 1:1 ratio. A linkage map of the genotypic data for the 94 RILs was constructed using the MAPMAKER/EXP. ver. 3.0 [16] with the threshold LOD score of 3.0. Designation of linkage groups followed Cregan et al. [17].

Molecular cloning

Total RNA was extracted from 200 mg of trifoliolate leaves of Harosoy and Nezumisaya using the TRIZOL Reagent (Invitrogen) according to the manufacturer’s instructions. cDNA was synthesized by reverse transcription of 5 μg of total RNA using the Superscript III First-Strand Synthesis System (Invitrogen) and an oligo(dT) primer according to the manufacturer’s instructions. The full-length cDNA was cloned by end-to-end PCR from Harosoy and Nezumisaya using a pair of PCR primers (Table 1) based on the genome sequence of US cultivar Williams 82 deposited in the soybean genome database (Phytozome, http://www.phytozome.net/soybean.php). The PCR mixture contained 0.5 μg of cDNA, 10 pmol of each primer, 5 pmol of nucleotides and 1 unit of ExTaq in 1 × ExTaq Buffer in a total volume of 25 μl. A 30 sec denaturation at 94°C was followed by 30 cycles of 30 sec denaturation at 94°C, 1 min annealing at 59°C and 1 min extension at 72°C. A final 7 min extension at 72°C completed the program. The 5′ upstream region of about 1.8 kb was amplified from Harosoy and Nezumisaya using GenomeWalker (Invitrogen) according to the manufacturer’s instructions. Primers used for nested PCR are shown in Table 1. The PCR products were cloned into the pCR 2.1 vector (Invitrogen) and sequenced.

Table 1.

PCR primers used in this study

Purpose Target gene Forward primer (5′-3′) Reverse primer (5′-3′)
Cloning of cDNA for sequencing GmF3G2″Gt AATCACGTCCTTTGCACATA CAAAACCATTGCCATTCATG
Sequencing of cDNA GmF3G2″Gt AGGCTGTGCACTATTGTACT TCACAATGCTCACAGCTTTA
CCATATATGGATTACATTGG CACTTCCAAAGCAACAATAA
TTCTTGCACACCCTTCTGTA GACAGAGCTAGCAGTACAAT
Cloning of 5′ upstream regiona GmF3G2″Gt GTGTGTGTCTCTGGTGTAGTAATCATG
CTCACACAAAACAGAGGTTCAATACGAGG
Sequencing of 5′ upstream region GmF3G2″Gt ACAACGGTCATATATGCATG TGGCGGAGAGGAAGAAGATA
ACAACGGTCATTTCTGCATG CTCTCTGAAATGGATCCCAA
GTCAACAATGAAGGACATGG TAGAAATGCACGTAGTAGGT
TCCACCACAATATGCTATGT
dCAPS analysis GmF3G2″Gt CCAAACTCACGAGGCTGGT TCCTCCAAATCTAAAGTTGG
Cloning for functional analysisb GmF3G2″Gt GCCGGAGCTCATGAAATCACGTCCTTTGC GCCGCTCGAGTCAAATTCCCTCTACAATCTC
Real-time PCR GmF3G2″Gt AGAACCAAAGGATCTCCGTT GTTTTTGCCAAGGAGATAAGT
actin GTCCTTTCAGGAGGTACAACC CCACATCTGCTGGAAGGTGC

aGene-specific primers for genome walking.

bRestriction sites incorporated in primers, SacI site in forward primer and XhoI site in reverse primer are italicized.

Sequencing analysis

Nucleotide sequences were determined with the BigDye terminator cycle method using an ABI3100 Genetic Analyzer (Applied Biosystems). Nucleotide sequences and the putative amino acid translations were analyzed with the BLAST program [18]. Intron/exon structure of the gene was estimated based on the comparison between the cDNA sequence and the corresponding genome sequences of Williams 82 deposited in the soybean genome database. Sequence alignment was performed with ClustalW (http://clustalw.ddbj.nig.ac.jp/index.php?lang=ja) using default settings. The amino acid sequences were aligned using ClustalW and the alignment was used to construct a phylogenetic tree using the neighbor-joining method with MEGA5 version 5.2.2 (http://www.megasoftware.net/) [19]. Bootstrap test of 1000 replications was performed. Using the structure of the grape flavonoid 3-O-glucosyltransferase (VvGT1, protein ID: 2C1Z) [20] as a template, homology modeling was conducted using GASH (Genetic-algorithm ASH) [21] program at the Protein Data Bank Japan (http://sysimm.ifrec.osaka-u.ac.jp/ash_service/). A model of GmF3G2"Gt-b was superimposed on 2C1Z using CueMol software (http://www.cuemol.org/en/).

dCAPS analysis

A pair of PCR primers flanking a two-base substitution was designed (Table 1). A mismatched base G was incorporated in the forward primer to produce a KpnI site in the amplified product of Harosoy. The base substitution in Nezumisaya eliminates the restriction site to generate a polymorphism. The PCR mixture contained 30 ng of genomic DNA, 5 pmol of each primer, 10 pmol of nucleotides and 1 unit of ExTaq in 1 x ExTaq Buffer in a total volume of 25 μl. After an initial 30 sec denaturation at 94°C, there were 30 cycles of 30 sec denaturation at 94°C, 1 min annealing at 56°C and 1 min extension at 72°C. A final 7 min extension at 72°C completed the program. The amplified products were digested with KpnI, and the digests were separated on 8% nondenaturing polyacrylamide gels. After electrophoresis, the gel was stained with ethidium bromide and the DNA fragments were visualized under UV light.

Heterologous expression and purification of recombinant GmF3G2″Gt protein

The entire coding region of GmF3G2″Gt was amplified from cDNA of Harosoy and Nezumisaya by PCR using the KOD -Plus- DNA polymerase (Toyobo) with high PCR fidelity and primers containing enzyme sites for SacI and XhoI (Table 1). The PCR mixture contained 30 ng of genomic DNA, 10 pmol of each primer, 5 pmol of nucleotides, 2 mM of MgSO4 and 0.5 unit of KOD –Plus- in 1 × KOD –Plus- Buffer supplied by the manufacturer in a total volume of 25 μl. PCR conditions were identical to those in a previous report [9]. The PCR amplicon was digested with SacI and XhoI and was cloned into the pCold ProS2 vector (Takara Bio). GmF3G2″Gt proteins were expressed and purified as described previously [22].

Enzyme assay and MS/MS analysis

Enzyme assays, and MS and MS/MS analyses were conducted as previously described [9,23]. The ESI source was operated in negative ionization mode.

Gene expression assays

cDNA was synthesized by reverse-transcription of 5 μg of total RNA from the parents at R6 stage in three replications using the Superscript III First-Strand Synthesis System and an oligo d(T) primer. Primer sequences are exhibited in Table 1. PCR conditions were identical to those in a previous report [9]. Expression levels of the soybean actin gene (GenBank accession number: J01298) [24] were used to normalize target gene expression and compared by t-test using Statistica 03J (StatSoft). PCR products were cloned into the pCR 2.1 vector. The nucleotide sequence of eight clones from each of the cultivars was determined.

Results

Flavonol glycoside composition

HPLC chromatograms of Harosoy and Nezumisaya are shown in Figure 1A. Harosoy had eight primary peaks corresponding to FGs, viz., 4.5 (F1), 6.1 (F2), 6.7 (F3), 7.4 (F4), 9.6 (F5), 11.2 (F6), 13.7 (F7) and 16.3 min (F8). Nezumisaya had seven primary peaks, viz., 4.9 (F9), 5.0 (F10), 6.1 (F2), 6.4 (F11), 6.6 (F12), 9.6 (F5) and 11.2 (F6). Based on comparison with authentic specimens, the peaks correspond to the followings FGs: F1, kaempferol 3-O-rhamnosyl-(1  4)-[glucosyl-(1  6)-galactoside]; F2, kaempferol 3-O-rhamnosyl-(1  4)-[rhamnosyl-(1  6)-galactoside]; F3, kaempferol 3-O-glucosyl-(1 → 6)-galactoside; F4: kaempferol 3-O-glucosyl-(1 → 6)-glucoside; F5, kaempferol 3-O-rhamnosyl-(1  6)-galactoside; F6, kaempferol 3-O-rhamnosyl-(1  6)-glucoside; F7, kaempferol 3-O-glucoside; F8, apigenin 7-O-glucoside; F9, kaempferol 3-O-glucosyl-(1  2)-[rhamnosyl-(1  6)-galactoside]; F10, kaempferol 3-O-glucosyl-(1  2)-[rhamnosyl-(1  6)-glucoside]; F11, kaempferol glycoside; F12, kaempferol 3-O-glucosyl-(1  2)-glucoside; F13, kaempferol glycoside (Figure 1B).

Figure 1.

Figure 1

HPLC chromatogram of MeOH extracts from leaves of soybean cultivars Nezumisaya, Harosoy and recombinant inbred lines derived from a cross of the cultivars, and chemical structure of flavonol glycosides corresponding to HPLC peaks. (A) HPLC chromatogram. 100 mg of trifoliolate leaves was extracted with 1 ml of MeOH. Eluent: phosphoric acid/acetonitrile/H2O (0.2:18:82). Flow-rate: 1.0 ml/min. Injection: 10 μl. Detection: 350 nm. (B) Chemical structure.

The peaks F9, F10 and F12 that were specific to Nezumisaya corresponded to FGs having glucose at the 2″-position of glucose or galactose that is bound to the 3-position of kaempferol, whereas FGs with 2″-glucose were absent in Harosoy. The peaks F1, F3 and F4 that were specific to Harosoy corresponded to FGs having glucose at the 6″-position of glucose or galactose that is bound to the 3-position of kaempferol, whereas FGs with 6″-glucose were absent in Nezumisaya.

Inheritance of flavonol glycoside composition

Among the 94 RILs cultivated in field, 3 RILs matured too early for sampling. The remaining 91 RILs were subjected to HPLC analysis. Among the RILs, 22 RILs had peaks of the Harosoy-type, and 23 RILs had peaks of the Nezumisaya-type. 18 RILs had a peak distribution designated as ‘type 3’; this lacked three peaks (F1, F3 and F4) compared with the Harosoy-type (Figure 1A). Further, 28 RILs were designated as ‘type 4’; these had a mixture of peaks from both cultivars in addition to a unique peak, F13. The segregation fitted to a 1:1:1:1 ratio, suggesting that two genes control the FG pattern in the RIL (χ2 = 2.23, P = 0.53).

One of the genes may be responsible for attachment of glucose to the 2″-position and it probably encodes a flavonol 3-O-glucoside/galactoside (1 → 2) glucosyltransferase. Nezumisaya may have a dominant while Harosoy may have a recessive allele of the gene. The other gene may be involved in the attachment of glucose to the 6″-position and probably encodes a flavonol 3-O-glucoside/galactoside (1 → 6) glucosyltransferase. Harosoy may have a dominant while Nezumisaya may have a recessive allele of the gene. RILs of ‘type 3’, in which FGs with 2″-glucose and FGs with 6″-glucose were absent, may have double-recessive alleles of the two genes. RILs of ‘type 4’, in which FGs with 2″-glucose and FGs with 6″-glucose were present, may have double-dominant alleles.

Linkage mapping of flavonol glycoside gene

Among the 465 SSR markers tested, 185 markers that exhibited polymorphism between the parents and distinctly segregated in the RILs were used for linkage mapping. A total of 99 markers were classified into 28 linkage groups spanning 2,172 cM. For mapping of the gene responsible for attachment of glucose to the 2″-position, RILs having FG composition of the Nezumisaya type and ‘type 4’ were considered to have the genotype of Nezumisaya, whereas RILs having FG composition of the Harosoy type and ‘type 3’ were considered to have the genotype of Harosoy. Linkage mapping revealed that the gene responsible for attachment of glucose to the 2″-position was located in the molecular linkage group C2 (chromosome 6) between Satt307 and Sat_202 (Figure 2).

Figure 2.

Figure 2

Linkage mapping of F3G2″Gt using recombinant inbred lines derived from a cross between soybean cultivars Nezumisaya and Harosoy. The name of the linkage group is indicated at the top followed by the chromosome number in parenthesis. Distances (cM) of markers from the top of the linkage group are shown on the left.

Molecular cloning of flavonol glycoside gene

Survey of the genome sequence of a US cultivar Williams 82 suggested the existence of a gene similar to the GT gene, Glyma06g43880 between Satt307 and Sat_202. The entire coding region of Glyma06g43880 was amplified by PCR and cloned. Sequence analysis revealed that the open reading frame of Glyma06g43880 is 1380 bp long encoding 459 amino acids. We designated the gene as GmF3G2″Gt. GmF3G2"Gt belongs to the family 1 glycosyltransferase, and it was designated as UGT79B30 by the UGT Nomenclature Committee [25]. The flavonoid glycosyltransferase phylogenetic tree suggested that GmF3G2″Gt belongs to the flavonoid glycoside glycosyltransferase (GGT) gene cluster (Figure 3). BLAST analysis suggested that it had a 55% amino acid similarity with Ip3GGT of morning glory encoding anthocyanin 3-O-glucoside (1 → 2) glucosyltransferase [26] and 45% similarity with Arabidopsis UGT79B6 that was recently identified to function as a flavonol 3-O-glucoside (1 → 2) glucosyltransferase [22] (Figure 3). Comparison with the genome sequence of Williams 82 suggested that GmF3G2″Gt had one intron (Figure 4A). Eight nucleotides were polymorphic between Harosoy and Nezumisaya; consisting of six single nucleotide polymorphisms (SNPs) and one two-nucleotide substitution. The nucleotide polymorphism resulted in four amino acid substitutions between the cultivars (amino acid positions, 20, 142, 149 and 183) (Figure 4B). The cDNA fragments generated from Nezumisaya and Harosoy were designated as GmF3G2″Gt-a and GmF3G2″Gt-b, respectively. The 5′ upstream region of about 1.8 kb was amplified by PCR from Harosoy, whereas the corresponding region could not be amplified from Nezumisaya. So we cloned the 5′ upstream region of both cultivars by genome walking. The nucleotide sequences of the 5′ upstream region, exons and introns of Harosoy were identical with those of Williams 82. In contrast, Nezumisaya had many indels and substitutions in the 5′ upstream region compared with Harosoy (Additional file 1: Figure S1).

Figure 3.

Figure 3

Unrooted molecular phylogenetic tree of some flavonoid glycosyltransferases. Bar represents 0.1 amino acid substitutions/site. The GenBank accession numbers for the sequences are shown in parentheses: At3Rt (NM_102790); At3Gt (NM_121711); Vv3Gt (AF000371); Ph3Gt (AB027454); Pf3Gt (AB002818); Hv3Gt (X15694); Zm3Gt (X13501); At5Gt (NM_117485); Pf5Gt (AB013596); Vh5Gt (BAA36423); Ph5Gt (AB027455); Db7Gt (CAB56231); Nt7Gt (AAB36653); Sb7Gt (BAA83484); At7Rt (AY093133); CmF7G2Rt (AAL06646); CsF7G6″Rt (ABA18631); IpA3G2″Gt (AB192315); PhA3G6″Rt (X71059); BpA3G2″Glt (AB190262); AcA3Ga2″Xt (FG404013); AtF3G2″Gt (Q9FN26). Gt, glucosyltransferase; Rt, rhamnosyltransferase; Xt, xylosyltransferase; Glt, glucuronosyltransferase. Ac, Actinidia chinensis; At, Arabidopsis thaliana; Bp, Bellis perennis; Cm, Citrus maxima; Cs, Citrus sinensis; Db, Dorotheanthus bellidiformis; Gm, Glycine max; Hv, Hordeum vulgare; Ip, Ipomoea purpurea; Nt, Nicotiana tabacum; Pf, Perilla frutescens; Ph, Petunia hybrida; Sb, Scutellaria baicalensis; Vh, Verbena hybrida; Vv, Vitis vinifera; Zm, Zea mays.

Figure 4.

Figure 4

Gene structure and amino acid alignment of GmF3G2″Gt. (A) Intron-exon structure of GmF3G2″Gt gene. (B) Amino acid alignment of soybean GmF3G2″Gt-a, morning glory Ip3GGT encoding anthocyanin 3-O-glucoside (1 → 2) glucosyltransferase and Arabidopsis UGT79B6 that functions as a flavonol 3-O-glucoside (1 → 2) glucosyltransferase. Identical amino acids are in white font highlighted in black, similar amino acids are in white font highlighted in gray. Four amino acids that differed in GmF3G2″Gt-b are exhibited below the aligned sequence in red font.

dCAPS analysis

PCR products with molecular size of 230 bp were amplified with the dCAPS primers in Nezumisaya and Harosoy (Figure 5). KpnI digestion generated a band of 213 bp in Harosoy, whereas the PCR amplicon of Nezumisaya was unaffected. Banding patterns co-segregated with FG patterns; RILs with FGs of the Harosoy type and ‘type 3’ had bands of Harosoy type, whereas RILs with FGs of the Nezumisaya type and ‘type 4’ had bands of Nezumisaya type (Figure 5).

Figure 5.

Figure 5

Outline and results of dCAPS analysis of GmF3G2″Gt in soybean. (A) Schematic presentation of dCAPS analysis. Partial nucleotide sequences around the region polymorphic between Harosoy and Nezumisaya are exhibited. A mismatched base in the forward primer is highlighted in gray. Polymorphic nucleotides are highlighted in black. (B) Results of dCAPS analysis of the parents and the recombinant inbred lines derived from a cross between Nezumisaya and Harosoy. PCR products amplified with dCAPS primers were digested by KpnI and the digests were separated on an 8% polyacrylamide gel. ϕ, molecular marker ϕx174/HaeIII; N, Nezumisaya; H, Harosoy. FG pattern of the recombinant inbred lines is exhibited below the gel. H, Harosoy-type; N, Nezumisaya-type, 3, type 3; 4, type 4. The migration of size markers (bp) is shown to the left of the gel.

In vitro characterization of recombinant GmF3G2″Gt

The GmF3G2″Gt recombinant protein of Nezumisaya (GmF3G2″Gt-a) and Harosoy (GmF3G2″Gt-b) were expressed in E. coli as a His/ProS2 fusion and purified. The GmF3G2″Gt proteins were used for enzymatic assays after cleavage of the His/ProS2 tag. GmF3G2″G-a and GmF3G2″G-b converted kaempferol 3-O-glucoside to kaempferol 3-O-sophoroside as confirmed by comparison of retention time, UV spectra and MS/MS ionization with the standard compound (Figure 6, Additional file 2: Figure S2). GmF3G2″Gt-a showed a broad activity for kaempferol/quercetin 3-O-glucoside/galactoside derivatives (Table 2). However, GmF3G2″Gt-a did not glucosylate kaempferol 3-O-rhamnosyl-(1 → 4)-[rhamnosyl-(1 → 6)-glucoside] and 3-O-rhamnosyl-(1 → 4)-[glucosyl-(1 → 6)-glucoside]. GmF3G2″Gt-a had a higher preference for UDP-glucose than UDP-galactose, with only 3% activity relative to that for UDP-galactose. No UGT activity was detected for UDP-arabinose and UDP-glucuronic acid. GmF3G2″Gt-b also showed similar substrate specificity (Additional file 3: Table S1). Accordingly, GmF3G2″Gt-a and GmF3G2″Gt-b were defined as flavonol 3-O-glucoside/galactoside (1 → 2) glucosyltransferases.

Figure 6.

Figure 6

Identification of reaction product of GmF3G2″Gt-a (cultivar Nezumisaya). (A) Elution profiles of the standards (kaempferol 3-O-glucoside and kaempferol 3-O-sophoroside) and reaction product of GmF3G2″Gt-a protein. (B) UV spectra of the standard (kaempferol 3-O-sophoroside) and reaction product of GmF3G2″Gt-a protein. Mass spectra (C) and MS/MS spectra (D) of the standard (kaempferol 3-O-sophoroside) and reaction product of GmF3G2″Gt-a protein. E, The MS/MS fragmentation for kaempferol 3-O-sophoroside. K3Glc, kaempferol 3-O-glucoside; K3Glc2″Glc, kaempferol 3-O-sophoroside.

Table 2.

Substrate specificity of GmF3G2″Gt in cultivar Nezumisaya

Relative activity (%)
Sugar acceptor a
Kaempferol (Kae) 3-O-glucosideb 100.0 ± 5.3
Kae 3-O-galactoside 73.7 ± 0.5
Kae 3-O-rhamnosyl-(1 → 6)-glucoside 42.4 ± 3.7
Kae 3-O-rhamnosyl-(1 → 4)-[rhamnosyl-(1 → 6)-glucoside] N.D.
Kae 3-O-rhamnosyl-(1 → 4)-[glucosyl-(1 → 6)-glucoside] N.D.
Kae 3-O-glucoside-7-O-rhamnoside 23.8 ± 1.1
Quercetin (Que) 3-O-glucoside 75.2 ± 4.9
Que 3-O-galactoside 78.9 ± 2.4
Que 3-O-rhamnosyl-(1 → 6)-glucoside 25.4 ± 1.3
Sugar donor c
UDP-glucose 100.0 ± 5.2
UDP-galactose 3.3 ± 0.1
UDP-arabinose N.D.
UDP-glucuronic acid N.D.

N.D., not detected.

aThe reactions were performed with UDP-glucose as the sugar donor.

bThe product was identified based on comparison with the pertinent standard.

cThe reactions were performed with kaempferol 3-O-glucoside.

Gene expression

The accumulation of GmF3G2″Gt transcript in leaves of Nezumisaya and Harosoy was analyzed by real-time PCR. Survey of soybean genome sequence revealed the existence of a gene similar to GmF3G2″Gt, Glyma12g14050 with nucleotide similarity of 93% in chromosome 12 (molecular linkage group H). It was difficult to design primers for GmF3G2″Gt based on the nucleotide sequence of its coding region. So, we designed primers for real-time PCR based on distinct sequences from the 5' untranslated region. At the R6 stage, the transcript level of GmF3G2″Gt in leaves of Harosoy was 14.6% of that in Nezumisaya (t = 3.60*). The PCR products from Nezumisaya and Harosoy were ascertained to be derived from the expected genome region by sequencing.

Discussion

Harosoy and Nezumisaya are soybean cultivars that have gray pubescence and they both have significant deposits of kaempferol derivatives in their leaves. However, these cultivars differ in their FG composition. HPLC comparison with authentic samples suggested that FGs having glucose at the 2″-position of glucose or galactose that is bound to the 3-position of kaempferol were present in Nezumisaya, whereas FGs of Harosoy were devoid of 2″-glucose. Conversely, FGs having glucose at the 6″-position of glucose or galactose that is bound to the 3-position of kaempferol were present in Harosoy, whereas these FGs were absent in Nezumisaya. Apigenin 7-O-glucoside almost exclusively deposits in the cytoplasm of gray pubescence [27], suggesting that the peak F8 may have been derived from pubescence on leaves.

Genetic analysis suggested that two genes control the FG pattern. One of the genes may be responsible for attachment of glucose to the 2″-position, and it probably encodes a flavonol 3-O-glucoside/galactoside (1 → 2) glucosyltransferase. Nezumisaya may have a dominant, whereas Harosoy may have a recessive allele of the gene. The gene was mapped in molecular linkage group C2 (chromosome 6) between Satt307 and Sat_202. Judging from the relative location with SSR markers, its position was similar to that of Fg3 reported by Buzzell [28]. The other gene may be involved in the attachment of glucose to the 6″-position, and it probably encodes a flavonol 3-O-glucoside/galactoside (1 → 6) glucosyltransferase. The gene may correspond to the Fg1 gene reported previously [2]. Harosoy may have a dominant whereas Nezumisaya may have a recessive allele of the gene. The ‘type 3’ may have double-recessive alleles whereas the ‘type 4’ may have double-dominant alleles for the two FG genes. F13 probably corresponds to a kaempferol glycoside having both 2″-glucose and 6″-glucose.

A survey of the genome sequence of US cultivar Williams 82 suggested that a putative GT gene, Glyma06g43880 existed between Satt307 and Sat_202. We cloned the cDNA and designated it as GmF3G2″Gt. The open reading frame of GmF3G2″Gt is 1380 bp long encoding 459 amino acids. GmF3G2″Gt belongs to the GGT gene cluster. GmF3G2″Gt of Nezumisaya had an amino acid similarity of 55% with the Ip3GGT of morning glory encoding a 3-O-glucoside (1 → 2) glucosyltransferase that also attaches glucose to the 2″-position of glucose that is bound to the 3-position of anthocyanidins [26]. It also has 45% similarity with Arabidopsis UGT79B6 that functions as a flavonol 3-O-glucoside (1 → 2) glucosyltransferase [22]. The genome sequence of Williams 82 suggests the existence of a gene (Glyma12g14050) having 93% of nucleotide identity with Glyma06g43880 in chromosome 12. However, the gene responsible for the attachment of glucose to the 2″-position was not mapped to chromosome 12 in the current as well as in a previous study [28]. Thus, based on our experimental data, Glyma12g14050 may not be responsible for the attachment of glucose to the 2″-position.

In the coding region of GmF3G2″Gt, six SNPs and one two-base substitution existed between Harosoy and Nezumisaya, resulting in four amino acid substitutions. The dCAPS marker that was used to discriminate the two-base substitution co-segregated with the FG patterns, suggesting that GmF3G2″Gt might correspond to a flavonol 3-O-glucoside/galactoside (1 → 2) glucosyltransferase (Fg3) gene.

The recombinant GmF3G2″Gt-a protein converted UDP-glucose and kaempferol 3-O-glucoside to kaempferol 3-O-sophoroside, proving that GmF3G2″Gt encodes a flavonol 3-O-glucoside/galactoside (1 → 2) glucosyltransferase. The protein did not discriminate between glucose and galactose attached to the 3-position of kaempferol based on the results of HPLC analysis. Hence, it is similar to the soybean flavonol 3-O-glucoside/galactoside (1 → 6) rhamnosyltransferase [9]. GmF3G2″Gt-a protein showed a broad activity for kaempferol/quercetin 3-O-glucoside/galactoside derivatives, but it did not glucosylate kaempferol 3-O-rhamnosyl-(1 → 4)-[rhamnosyl-(1 → 6)-glucoside] and 3-O-rhamnosyl-(1 → 4)-[glucosyl-(1 → 6)-glucoside]. This suggests that 2″-glucosylation of flavonol 3-O-glycoside is irreconcilable with 4″-glycosylation. This hypothesis is supported by the flavonoid profiles of Nezumisaya and ‘type 4’ in which FGs with 2″ and 4″-double glycosylation are lacking. Further, leaves of seven soybean accessions contained FGs with double glycosylation of 2″ and 6″, or 4″ and 6″, but lacked FGs with double glycosylation of 2″ and 4″ [11].

Though four amino acids were substituted, the recombinant GmF3G2″Gt-b protein also had a flavonol 3-O-glucoside/galactoside (1 → 2) glucosyltransferase activity. A structural modeling of GmF3G2″Gt using the 3D structure of a grape flavonoid 3-O-glucosyltransferase, VvGT1, as a template indicated that three substituted amino acids (V142, S149, T183 in GmF3G2″Gt-b) were located far from the enzyme active sites. The other amino acid (T20) was relatively close to the uracil ring of UDP-2-deoxy-2-fluoro-glucose (6.55 Å) but far from the active center. The threonine residues corresponding to T20 in GmF3G2″Gt-b were also conserved in flavonoid 3-O-glucoside: (1-2) glucosyltransferase, such as AtF3G2″Gt and IpA3G2″Gt. These data suggest that four substituted amino acid residues in GmF3G2″Gt-b are unlikely to affect enzyme activity. The transcript level of GmF3G2″Gt in leaves of Harosoy was about 15% of that in Nezumisaya. GmF3G2″Gt protein possibly have a threshold for catalysis and that of Harosoy is lower than the threshold. To confirm the hypothesis, further studies such as association analysis between gene expression and FG amounts among tissues or developmental stages may be necessary. Indels and substitutions in the 5′ upstream region may be responsible for the differences in expression level. Promoter assays may be necessary to determine which polymorphism is critical for gene expression.

The nucleotide sequences in the 5′ upstream region, exons and intron of GmF3G2″Gt from Harosoy were identical to those of Williams 82. The HPLC chromatogram of leaf methanol extracts of Williams 82 was identical to that of US cultivar Clark which has an allelic combination of fg1Fg2fg3Fg4 [6], suggesting that Williams 82, Clark and Harosoy might have a recessive allele at the Fg3 locus (Di et al., unpublished results, 2014). The results are consistent with our hypothesis that Nezumisaya has a dominant and Harosoy has a recessive allele for the Fg3 gene. Based on the HPLC profiles, Harosoy may have an allelic combination of Fg1Fg2fg3Fg4 while Nezumisaya may have a combination of fg1Fg2Fg3Fg4. This is consistent with a previous report that Harosoy has an allelic combination of either Fg1Fg2fg3 or fg1Fg2fg3 depending on the line [29].

Multiple alignment of GGTs (three G6″GTs and six G2″GTs) suggested 32 amino acids specific to G6″GTs and 4 amino acids specific to G2″GTs (Additional file 4: Figure S3). There are characteristic amino acids in position 36 (V in G6″GTs and I in G2″GTs) and amino acid position 347 (Y in G6″GTs and F in G2″GTs) in the plant secondary product glycosyltransferase motif around the C-terminal region [30]. Site-directed mutagenesis may reveal which amino acids are responsible for glycosylation of specific positions of the sugar moiety in flavonoids. Amino acids responsible for sugar donor specificity (Ser-138 or Gly-138) were identified in a GGT gene involved in saponin biosynthesis [31]. Multiple alignment indicated that all three flavonoid G2″GTs had Thr at this position, suggesting a possibility that the amino acid is also involved in sugar donor specificity in flavonoid GGTs (Additional file 4: Figure S3). The GmF3G2″Gt had only one intron, consistent with FG genes of other plant species, where either existence of no or one intron is predominant [32].

Cloning of Fg1 encoding flavonol 3-O-glucoside/galactoside (1 → 6) glucosyltransferase and Fg4 encoding flavonol 3-O-glucoside/galactoside (1 → 2) rhamnosyltransferase may help clarify the recognition mechanisms for the hydroxyl group of the sugar moiety (at 2″- or 6″-position), ability to specify the nature of the sugar (glucose or rhamnose), and molecular evolution of UGT genes. In addition, another gene having the function of flavonol 3-O-galactoside (1 → 4) rhamnosyltransferase remains to be cloned. Cloning of the entire gene set may be necessary to understand FG biosynthesis in soybean. Development of near-isogenic lines by incorporating various combinations of alleles for Fg genes into common genetic backgrounds may be necessary to obtain information on the dosage effect of Fg genes in relation to morphology, productivity and other agronomic characters in soybean.

Conclusions

FGs having glucose at the 2″-position of glucose or galactose that is bound to the 3-position of kaempferol were present in Nezumisaya, whereas FGs of Harosoy were devoid of 2″-glucose. Conversely, FGs having glucose at the 6″-position of glucose or galactose that is bound to the 3-position of kaempferol were present in Harosoy, whereas these FGs were absent in Nezumisaya. Two genes control the FG pattern; the first is responsible for the attachment of glucose to the 2″-position, and encodes a flavonol 3-O-glucoside/galactoside (1 → 2) glucosyltransferase. Nezumisaya has a dominant whereas Harosoy has a recessive allele of the gene. A candidate gene GmF3G2″Gt was located in the molecular linkage group C2 (chromosome 6). The open reading frame of GmF3G2″Gt is 1380 bp long encoding 459 amino acids with four amino acid substitutions among the cultivars. The GmF3G2″Gt recombinant protein converted kaempferol 3-O-glucoside to kaempferol 3-O-sophoroside. Hence, GmF3G2″Gt encodes a flavonol 3-O-glucoside/galactoside (1 → 2) glucosyltransferase and corresponds to the Fg3 gene. Based on substrate specificity, 2″-glucosylation of flavonol 3-O-glycoside may be irreconcilable with 4″-glycosylation in soybean leaves.

Availability of supporting data

Sequence data from this article have been deposited at the DDBJ Data Libraries under accession numbers LC017844 (cDNA of GmF3G2″Gt-a), LC017845 (cDNA of GmF3G2″Gt-b), LC017916 (5′ upstream region of GmF3G2″Gt-a) and LC017917 (5′ upstream region of GmF3G2″Gt-b).

Acknowledgements

The authors are grateful to Dr. Joseph G. Dubouzet (New Zealand) for critical reading of the manuscript. This study was partially supported by the scholarship from the China Scholarship Council to SD and FY, the Japanese Government (MEXT) Scholarship to FRR and TOR, and the JSPS KAKENHI Grant Number 25440148 to KY-S.

Abbreviations

FG

Flavonol glycoside

GGT

Flavonoid glycoside glycosyltransferase

GT

Glycosyltransferase

HPLC

High performance liquid chromatography

RIL

Recombinant inbred line

SNP

Single nucleotide polymorphism

UGT

UDP glycosyltransferase

Additional files

Additional file 1: Figure S1. (1.2MB, pdf)

Alignment of the 5′ upstream region of GmF3G2″Gt gene in soybean cultivars Harosoy and Nezumisaya. Polymorphic nucleotides are shown in red font. Coding sequence is underlined.

Additional file 2: Figure S2. (2.1MB, pdf)

Identification of reaction product of GmF3G2″Gt-b (cultivar Harosoy). (A) Elution profiles of the standards (kaempferol 3-O-glucoside and kaempferol 3-O-sophoroside) and reaction product of GmF3G2″Gt-b protein. (B) UV spectra of the standard (kaempferol 3-O-sophoroside) and reaction product of GmF3G2″Gt-b protein. Mass spectra (C) and MS/MS spectra (D) of the standard (kaempferol 3-O-sophoroside) and reaction product of GmF3G2″Gt-b protein. K3Glc, kaempferol 3-O-glucoside; K3Glc2″Glc, kaempferol 3-O-sophoroside.

Additional file 3: Table S1. (485.9KB, pdf)

Substrate specificity of GmF3G2″Gt in cultivar Harosoy.

Additional file 4: Figure S3. (1.2MB, pdf)

Multiple alignment of flavonoid glycoside glycosyltransferases (GGTs). The plant secondary product glycosyltransferase motif is underlined. Amino acid residues conserved in flavonoid GGTs are in white font highlighted in black. Amino acid residues conserved in flavonoid G6″GTs and G2″GTs are in white font highlighted in red and blue, respectively. Position of amino acid responsible for sugar specificity in Sg-1 glycosyltransferase is shown by white triangle. Thr residues conserved in G2″GTs are in white font highlighted in green.

Footnotes

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

RT designed experiments and together with SD, FY, FRR and TOR, carried out genetic analysis, linkage mapping, molecular cloning and gene expression assays. YM and TI carried out chemical analysis. SS, TM, RN, KY-S and KS performed functional analysis. All authors read and approved the final manuscript.

Contributor Information

Shaokang Di, Email: dishaokang@affrc.go.jp.

Fan Yan, Email: yanfan@affrc.go.jp.

Felipe Rojas Rodas, Email: felipe-r@hotmail.es.

Tito O Rodriguez, Email: rodtor@gmail.com.

Yoshinori Murai, Email: murai@kahaku.go.jp.

Tsukasa Iwashina, Email: iwashina@kahaku.go.jp.

Satoko Sugawara, Email: satoko.sugawra@riken.jp.

Tetsuya Mori, Email: tetsuya.mori@riken.jp.

Ryo Nakabayashi, Email: ryo.nakabayashi@riken.jp.

Keiko Yonekura-Sakakibara, Email: yskeiko@riken.jp.

Kazuki Saito, Email: kazuki.saito@riken.jp.

Ryoji Takahashi, Email: masako@affrc.go.jp.

References

  • 1.Buttery BR, Buzzell RI. Varietal differences in leaf flavonoids of soybeans. Crop Sci. 1973;13:103–106. [Google Scholar]
  • 2.Buzzell RI, Buttery BR. Flavonol glycoside genes in soybeans. Can J Genet Cytol. 1974;16:897–899. doi: 10.1139/g74-098. [DOI] [Google Scholar]
  • 3.Buzzell RI, Buttery BR. Inheritance of an anomalous flavonol glycoside gene in soybean. Genome. 1992;35:636–638. doi: 10.1139/g92-095. [DOI] [Google Scholar]
  • 4.Buzzell RI. Soybean linkage tests. Soyb Genet Newsl. 1974;1:11–14. [Google Scholar]
  • 5.Buttery BR, Buzzell RI. Flavonol glycoside genes and photosynthesis in soybeans. Crop Sci. 1976;16:547–550. doi: 10.2135/cropsci1976.0011183X001600040028x. [DOI] [Google Scholar]
  • 6.Buzzell RI, Buttery BR. Genetics of leaf waviness in soybean. Soyb Genet Newsl. 1998;25:23–24. [Google Scholar]
  • 7.Lairson LL, Henrissat B, Davies GJ, Withers SG. Glycosyltransferases: structures, functions, and mechanisms. Annu Rev Biochem. 2008;77:521–555. doi: 10.1146/annurev.biochem.76.061005.092322. [DOI] [PubMed] [Google Scholar]
  • 8.Yonekura-Sakakibara K, Hanada K. An evolutionary view of functional diversity in family 1 glycosyltransferases. Plant J. 2011;66:182–193. doi: 10.1111/j.1365-313X.2011.04493.x. [DOI] [PubMed] [Google Scholar]
  • 9.Rojas Rodas F, Rodriguez TO, Murai Y, Iwashina T, Sugawara S, Suzuki M, et al. Linkage mapping, molecular cloning and functional analysis of soybean gene Fg2 encoding flavonol 3-O-glucoside (1 → 6) rhamnosyltransferase. Plant Mol Biol. 2014;84:287–300. doi: 10.1007/s11103-013-0133-1. [DOI] [PubMed] [Google Scholar]
  • 10.Buttery BR, Buzzell RI. Soybean flavonol glycosides: identification and biochemical genetics. Can J Bot. 1975;53:219–224. doi: 10.1139/b75-026. [DOI] [Google Scholar]
  • 11.Murai Y, Takahashi R, Rodas FR, Kitajima J, Iwashina T. New flavonol triglycosides from the leaves of soybean cultivars. Natl Prod Commun. 2013;8:453–456. [PubMed] [Google Scholar]
  • 12.Fehr WR, Caviness CE, Burmood DT, Pennington JS. Stage of development descriptions for soybeans, Glycine max (L.) Merrill. Crop Sci. 1971;11:929–931. doi: 10.2135/cropsci1971.0011183X001100060051x. [DOI] [Google Scholar]
  • 13.Murray MG, Thompson WF. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 1980;8:4321–4325. doi: 10.1093/nar/8.19.4321. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Song QJ, Marek LF, Shoemaker RC, Lark KG, Concibido VC, Delannay X, et al. A new integrated genetic linkage map of the soybean. Theor Appl Genet. 2004;109:122–128. doi: 10.1007/s00122-004-1602-3. [DOI] [PubMed] [Google Scholar]
  • 15.Hisano H, Sato S, Isobe S, Sasamoto S, Wada T, Matsuno A, et al. Characterization of the soybean genome using EST-derived microsatellite markers. DNA Res. 2007;14:271–281. doi: 10.1093/dnares/dsm025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Lander ES, Green P, Abrahamson J, Barlow A, Daly MJ, Lincoln SE, et al. MAPMAKER: an interactive computer package for constructing primary genetic linkage maps of experimental and natural populations. Genomics. 1987;1:174–181. doi: 10.1016/0888-7543(87)90010-3. [DOI] [PubMed] [Google Scholar]
  • 17.Cregan PB, Jarvik T, Bush AL, Shoemaker RC, Lark KG, Kahler AL, et al. An integrated genetic linkage map of the soybean genome. Crop Sci. 1999;39:1464–1490. doi: 10.2135/cropsci1999.3951464x. [DOI] [Google Scholar]
  • 18.Altschul SF, Madden TL, Schaffer AA, Zhang JH, Zhang Z, Miller W, et al. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 1997;25:3389–3402. doi: 10.1093/nar/25.17.3389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol. 2011;28:2731–2739. doi: 10.1093/molbev/msr121. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Offen W, Martinez-Fleites C, Yang M, Kiat-Lim E, Davis BG, Tarling CA, et al. Structure of a flavonoid glucosyltransferase reveals the basis for plant natural product modification. EMBO J. 2006;25:1396–1405. doi: 10.1038/sj.emboj.7600970. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Standley DM, Toh H, Nakamura H. GASH: an improved algorithm for maximizing the number of equivalent residues between two protein structures. BMC Bioinformatics 2005;6:221. [DOI] [PMC free article] [PubMed]
  • 22.Yonekura-Sakakibara K, Nakabayashi R, Sugawara S, Tohge T, Ito T, Koyanagi M, et al. A flavonoid 3-O-glucoside:2″-O-glucosyltransferase responsible for terminal modification of pollen-specific flavonols in Arabidopsis thaliana. Plant J. 2014;79:769–782. doi: 10.1111/tpj.12580. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Yang Z, Nakabayashi R, Okazaki Y, Mori T, Takamatsu S, Kitanaka S, et al. Toward better annotation in plant metabolomics: isolation and structure elucidation of 36 specialized metabolites from (rice) by using MS/MS and NMR analyses. Metabolomics. 2014;10:543–555. doi: 10.1007/s11306-013-0619-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Shah DM, Hightower RC, Meagher RB. Genes encoding actin in higher plants: intron positions are highly conserved but the coding sequences are not. J Mol Appl Genet. 1983;2:111–126. [PubMed] [Google Scholar]
  • 25.Mackenzie PI, Owens IS, Burchell B, Bock KW, Bairoch A, Belanger A, et al. The UDP glycosyltransferase gene superfamily: recommended nomenclature update based on evolutionary divergence. Pharmacogenetics. 1997;7:255–269. doi: 10.1097/00008571-199708000-00001. [DOI] [PubMed] [Google Scholar]
  • 26.Morita Y, Hoshino A, Kikuchi Y, Okuhara H, Ono E, Tanaka Y, et al. Japanese morning glory dusky mutants displaying reddish-brown or purplish-gray flowers are deficient in a novel glycosylation enzyme for anthocyanin biosynthesis, UDP-glucose : anthocyanidin 3-O-glucoside-2″'-O-glucosyltransferase, due to 4-bp insertions in the gene. Plant J. 2005;42:353–363. doi: 10.1111/j.1365-313X.2005.02383.x. [DOI] [PubMed] [Google Scholar]
  • 27.Iwashina T, Benitez ER, Takahashi R. Analysis of flavonoids in pubescence of soybean near-isogenic lines for pubescence color loci. J Hered. 2006;97:438–443. doi: 10.1093/jhered/esl027. [DOI] [PubMed] [Google Scholar]
  • 28.Buzzell RI. Soybean linkage tests. Soyb Genet Newsl. 1977;472–3.
  • 29.Buzzell RI, Palmer RG. Soybean linkage group 1 tests. Soyb Genet Newsl. 1985;12:32–33. [Google Scholar]
  • 30.Masada S, Terasawa K, Mizukami H. A single amino acid in the PSPG-box plays an important role in the catalytic function of CaUGT2 (Curcumin glucosyltransferase), a Group D Family 1 glucosyltransferase from Catharanthus roseus. FEBS Lett. 2007;581:2605-10. [DOI] [PubMed]
  • 31.Sayama T, Ono E, Takagi K, Takada Y, Horikawa M, Nakamoto Y, et al. The Sg-1 glycosyltransferase locus regulates structural diversity of triterpenoid saponins of soybean. Plant Cell. 2012;24:2123–2138. doi: 10.1105/tpc.111.095174. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Paquette S, Moller BL, Bak S. On the origin of family 1 plant glycosyltransferases. Phytochemistry. 2003;62:399–413. doi: 10.1016/S0031-9422(02)00558-7. [DOI] [PubMed] [Google Scholar]

Articles from BMC Plant Biology are provided here courtesy of BMC

RESOURCES