Integration of Fourier Transform Infrared Spectroscopy, Fluorescence Spectroscopy, Steady-state Kinetics and Molecular Dynamics Simulations of Gα_i1 Distinguishes between the GTP Hydrolysis and GDP Release Mechanism

Background: Multiple turnover GTPase assays of Gα are dominated by nucleotide exchange.

Results: FTIR elucidates single turnover rates and individual phosphate vibrations.

Conclusion: Gα_i1-R178S is slowed down in single turnover hydrolysis by 2 orders of magnitude, Gα_i1-Asp²²⁹ and -Asp²³¹ are key players in Ras-like/all-α domain coordination.

Significance: With FTIR on Gα established, detailed information on the reaction mechanism can be obtained.

Abstract

Gα subunits are central molecular switches in cells. They are activated by G protein-coupled receptors that exchange GDP for GTP, similar to small GTPase activation mechanisms. Gα subunits are turned off by GTP hydrolysis. For the first time we employed time-resolved FTIR difference spectroscopy to investigate the molecular reaction mechanisms of Gα_i1. FTIR spectroscopy is a powerful tool that monitors reactions label free with high spatio-temporal resolution. In contrast to common multiple turnover assays, FTIR spectroscopy depicts the single turnover GTPase reaction without nucleotide exchange/Mg²⁺ binding bias. Global fit analysis resulted in one apparent rate constant of 0.02 s⁻¹ at 15 °C. Isotopic labeling was applied to assign the individual phosphate vibrations for α-, β-, and γ-GTP (1243, 1224, and 1156 cm⁻¹, respectively), α- and β-GDP (1214 and 1134/1103 cm⁻¹, respectively), and free phosphate (1078/991 cm⁻¹). In contrast to Ras·GAP catalysis, the bond breakage of the β-γ-phosphate but not the P_i release is rate-limiting in the GTPase reaction. Complementary common GTPase assays were used. Reversed phase HPLC provided multiple turnover rates and tryptophan fluorescence provided nucleotide exchange rates. Experiments were complemented by molecular dynamics simulations. This broad approach provided detailed insights at atomic resolution and allows now to identify key residues of Gα_i1 in GTP hydrolysis and nucleotide exchange. Mutants of the intrinsic arginine finger (Gα_i1-R178S) affected exclusively the hydrolysis reaction. The effect of nucleotide binding (Gα_i1-D272N) and Ras-like/all-α interface coordination (Gα_i1-D229N/Gα_i1-D231N) on the nucleotide exchange reaction was furthermore elucidated.

Introduction

Heterotrimeric G proteins are interaction partners of G protein-coupled receptors (GPCRs)⁴ and deliver external signals into the cell (1). They are switched on by exchange of GDP for GTP induced by the GPCR as exchange factor and switched off by GTP hydrolysis. The nucleotide is bound between two domains of the Gα-subunit, namely the Ras-like domain, which is similar to the G-domain of small GTPases, and the all-α domain. In its inactive state Gα_i1βγ exists GDP bound in its heterotrimeric form. Activation by guanosine nucleotide exchange factors, like GPCRs or non-receptor guanosine nucleotide exchange factors (2–4), leads to nucleotide exchange in the α-subunit. Incorporation of GTP alters the protein conformation in the switch I-III regions (5), which causes separation of the Gα_i1 and βγ subunits and signal transduction, e.g. by binding of Gα_i1 to adenylate cyclase isoforms that in turn inhibit the production of cAMP from ATP (6). GTPase activity of Gα_i1 leads to hydrolysis of GTP to GDP and P_i, inactivation, and reassociation with its βγ subunits. Heterotrimeric G proteins are equipped with an intrinsic arginine finger (Arg¹⁷⁸ in Gα_i1) usually provided in case of small GTPases by the GAP protein, which is known to function as a key residue for catalyzing the hydrolysis reaction. Therefore intrinsic GTPase rates of Gα_i1 are rather comparable with Ras·GAP than to Ras. The hydrolysis mechanism taking place in Gα_i1 thereby determines the duration of its active state, which can be pathogenic when hindered, e.g. by ADP-ribosylation catalyzed by pertussis toxin (7). As for Ras, the intrinsic hydrolysis activity of Gα_i1 can be further accelerated by GTPase activating proteins (GAPs), which are called regulators of G protein signaling (RGS), e.g. RGS4 in case of Gα_i1 (8). It is generally known that GDP/GTP exchange is the rate-limiting step in multiple turnover measurements of Gα isoforms (9–12). Therefore, beside steady-state assays using γ-³²P labeling (13) or malachite green (14), pre-steady-state assays are used to characterize the hydrolysis reaction of Gα isoforms (15–18). We present here for the first time single turnover measurements of Gα_i1 using time-resolved FTIR spectroscopy, an ultrasensitive method that can be applied in solution and has been successfully used for photoactivable proteins like bacteriorhodopsin (19, 20), channelrhodopsin (21), and other rhodopsins (22). Adenylyltransferases (23), ATPases (24–27), and GTPases (28–31) can also be investigated by usage of caged nucleotides (28). The resulting photolysis and hydrolysis difference spectra depict the label-free GTP and GDP states of Gα_i1 and are able to reflect environmental changes in the sub-Å range (32) and the dynamics at a time resolution of milliseconds. Bridging the gap between single turnover and steady-state kinetics, we also applied a multiple turnover GTPase assay using reversed phase HPLC and additionally measured the nucleotide exchange rate using tryptophan fluorescence of Trp²¹¹ at 280/340 nm as extensively described elsewhere (15, 18, 33) and molecular dynamics simulations. GDP release and GTP uptake is a complex mechanism determined by the movement of the all-α domain, which was shown by structural studies (34). The Ras-like/all-α interface thereby depicts a complex interaction network including both amino acids and the nucleotide. By orchestration of different methods we were able to determine the effect of point mutations and distinguish their role in hydrolysis and nucleotide exchange.

Materials and Methods

Gα_i1-WT and mutant proteins were expressed, isolated, and characterized by various biophysical and biochemical methods (Fig. 1).

FIGURE 1.

Gα_i1 is switched on by the exchange of GDP for GTP (k_off/k_on), then GTP hydrolysis proceeds (k_hyd) and P_i is released. Multiple turnover kinetics were measured via HPLC, which cannot distinguish between the three processes. Nucleotide exchange kinetics (k_off/k_on) were monitored via tryptophan fluorescence spectroscopy. Single turnover kinetics (k_hyd) were measured via time-resolved FTIR difference spectroscopy.

Michaelis-Menten multiple turnover kinetics were monitored via reversed phase HPLC. The kinetics include both the catalytic reaction and the dissociation/association kinetics depicted as time per turnover. The isolated single turnover hydrolysis reaction was obtained via FTIR spectroscopy as half-life values of the global fit. The isolated nucleotide exchange kinetics were investigated via tryptophan fluorescence spectroscopy and depicted as half-life values of the intensity change. Experiments were accompanied by molecular dynamics simulations to decode the molecular reactions at the atomic level.

Chemicals

Lyophilized GDP, GTP, and GTPγS were purchased from Jena Bioscience (Jena, Germany). The photolabeled nucleotide para-hydroxyphenacyl (pHP) cgGTP and the isotopologues α-¹⁸O₂- and β-¹⁸O₃-pHPcgGTP were synthesized as described previously (29, 35–37). 1-Ortho-nitrophenyl ethyl (NPE) cgGTP and γ-¹⁸O₄-NPEcgGTP were synthesized as described previously (38). Alkaline phosphatase coupled to agarose beads was purchased from Sigma (Munich, Germany).

Cloning

The gene for the human GNAI1 (UniProtKB accession number P63096-1; kind gift from C. Wetzel, University of Regensburg, Germany (39)) was amplified by polymerase chain reaction using the oligonucleotide primers GCGCCCATGGGCTGCACGCTGAGC and GCGCGGATCCTTAAAAGAGACCACAATCTTTTAG (restriction sites for NcoI and BamHI are underlined). Resulting fragments were cut with NcoI and BamHI and ligated into the vector pET27bmod (kind gift from M. Engelhard, MPI Dortmund, Germany (40)) with a N-terminal ×10 histidine tag and tobacco etch virus (TEV) site. The plasmid was transformed into Escherichia coli DH5α for amplification. Gα_i1 mutants R178S, D229N, D231N, and D272N were created by overlap PCR using appropriate primers. Integrity of each construct was confirmed by sequencing. cDNA encoding human RGS4 was acquired from the Missouri cDNA Resource Center (Rolla, MO), tagged with a N-terminal ×10 histidine tag and TEV site, and also ligated into the vector pET27bmod. Amplification was performed similar to Gα_i1.

Protein Expression

The plasmid encoding Gα_i1 was transformed into E. coli Rosetta 2 (DE3) (Novagen®, Merck, Darmstadt, Germany) and incubated overnight at 37 °C on LB agar plates containing 0.2% (w/v) glucose as well as 50 μg/ml of kanamycin and 20 μg/ml of chloramphenicol for plasmid and strain selection. A preculture (LB medium, 50 μg/ml of kanamycin, 20 μg/ml of chloramphenicol, 0.2% (w/v) glucose) was inoculated and incubated overnight at 37 °C and 160 rpm. The plasmid encoding RGS4 was transformed into E. coli BL21(DE3) under identical conditions using only kanamycin for plasmid selection. For the main culture, 18 liters of LB medium supplemented with 50 μg/ml kanamycin and 0.2% glucose were inoculated with the preculture and grown at 37 °C, 100 rpm, and 20 liters/min airflow in a Biostat® C20-3 Fermenter (Sartorius, Göttingen, Germany). At an A₆₀₀ of 0.5–0.6 the culture was cooled to 18 °C and protein expression was induced by addition of 0.25 mm isopropyl 1-thio-β-d-galactopyranoside. After 15–18 h the cells were harvested by centrifugation at 5000 × g and 4 °C, suspended in buffer A (20 mm Tris, pH 8, 300 mm NaCl, 1 mm MgCl₂, 0.5 mm EDTA, 5 mm d-norleucine for Gα_i1 or 50 mm Tris, pH 8, 150 mm NaCl, 0.5 mm EDTA, 5 mm d-norleucine for RGS4), flash frozen, and stored at −80 °C.

Protein Isolation

Frozen cells were thawed, supplemented with 0.3 mm PMSF, 5 mm β-mercaptoethanol, DNase (Gα_i1 containing cells were additionally supplemented with 0.1 mm GDP), and disrupted using a microfluidizer M-110L (Microfluidics Corp., Newton, MA) at 800 bar. To spin down cell fragments and not disrupted cells, the suspension was centrifuged for 45 min at 45,000 × g and 4 °C. RGS4 containing cells were centrifuged with an additional low-speed step for 15 min at 18,000 × g and 4 °C followed by high-speed centrifugation for 45 min at 75,000 × g and 4 °C. The supernatant was applied to a 25-ml nickel-nitrilotriacetic acid superflow (Qiagen, Hilden, Germany) column, equilibrated with buffer B (buffer A + 0.3 mm PMSF + 5 mm β-mercaptoethanol + 20 mm imidazole), using a ÄKTApurifier 100 system (GE Healthcare Life Sciences, Freiburg, Germany) at 6 °C with a flow rate of 1–2 ml/min. After a washing step with buffer C (buffer B + 4 mm MgCl₂, 400 mm KCl, 1 mm ATP) for 8–10 column volumes and a subsequent step with buffer B + 50 mm imidazole for another 8–10 column volumes, the proteins were eluted with buffer B + 200 mm imidazole. The fractions containing Gα_i1 or RGS4 were selected after SDS-PAGE, pooled, supplemented with 5 mm DTT, and concentrated to 5 ml using a 10,000 MWCO concentrator (Amicon Ultra-15, Merck Millipore, Darmstadt, Germany). For gel filtration chromatography, the pool was applied to an illustra HiLoad 26/600 Superdex 200 pg column (GE Healthcare Life Sciences, Freiburg, Germany) equilibrated with buffer D (20 mm Tris, pH 8, 300 mm NaCl, 1 mm MgCl₂, 2 mm DTT, 0.1 mm GDP for Gα_i1 or 50 mm Hepes, pH 8, 100 mm KCl, 2 mm DTT for RGS4). Peak fractions were analyzed by SDS-PAGE. Purest fractions containing Gα_i1 or RGS4 were mixed 1:2 with buffer E (20 mm Tris, pH 8, 1 mm MgCl₂, 0.1 mm GDP for Gα_i1 or 50 mm Hepes, pH 8, 100 mm KCl for RGS4), pooled, and concentrated to ∼20 mg/ml for Gα_i1 or ∼10 mg/ml for RGS4 using a 10,000 MWCO concentrator. Protein concentration was determined using Bradford reagent as triplicate. The concentrated pool was aliquoted, flash frozen, and stored at −80 °C until utilization. Coomassie-stained gels after SDS-PAGE of purified proteins are depicted in Fig. 2.

FIGURE 2.

SDS-PAGE of wild type and mutant Gα_i1 and wild type RGS4 proteins after purification. 2.5 μg of wild type and mutant Gα_i1 and wild type RGS4 was loaded on a 12.5% polyacrylamide SDS gel together with Page Ruler Unstained Protein Ladder (Thermo Fisher Scientific, Waltham, MA) as size standard. Chromatography runs were performed with 60 mA for 30 min and staining was performed using Coomassie Brilliant Blue.

Multiple Turnover GTPase Measurements

For determination of the GTPase activity under multiple turnover conditions, the samples contained 10 μm Gα_i1 in 20 mm Tris, pH 8, 150 mm NaCl, 0.5 mm MgCl₂, and 0.1 mm DTT. After tempering for 5 min at 30 °C, 0.1 mm GTP (Gα_i1-WT, -R178S, -D229N, -D231N) or 2.5 mm GTP (Gα_i1-D272N) was added and immediately the first aliquot of the sample was analyzed by reversed phase HPLC at 254 nm (Beckman Coulter System Gold, Pasadena CA) (mobile phase: 50 mm P_i, pH 6.5, 5 mm tetrabutylammonium bromide, 7.5% AcN; stationary phase: ODS-Hypersil C18 column). After a 10-min incubation at 30 °C, a second aliquot was analyzed by HPLC. The amount of GTP was chosen to guarantee a substantial excess of GTP during the whole time of the measurements. Evaluation of the data were done by integration of the GDP and GTP peaks followed by normalization (sum of the areas A_GDP + A_GTP = 1). Determination of the time for one turnover per molecule Gα_i1, including exchange of GDP for GTP and GTP hydrolysis, was done according to the calculation of turnover times formula,

with time points t₀ and t₁ [min], the areas of the GTP peak at the time points t₀ and t₁ A_GTP,_t0 and A_GTP,_t1 (normalized area), and the concentration of Gα_i1 and GTP c(Gα_i1/GTP). Calculated values were averaged and the standard deviation was calculated from three experiments for each wild type and mutant protein.

Monitoring the Nucleotide Exchange Rate Using Fluorescence Spectroscopy

The nucleotide exchange rate of wild type and mutant Gα_i1 was measured via tryptophan fluorescence of Trp²¹¹ (41, 42) using a Jasco FP 6500 Spectrofluorometer (Easton, MD). 500 nm wild type or mutant protein was supplemented with 20 mm Tris, pH 8, 150 mm NaCl, 1 mm MgCl₂, and 1 mm DTT and tempered 5 min to 30 °C. After monitoring the fluorescence baseline for another 5 min, nucleotide exchange was initiated by the addition of 2.5 μm GTPγS and the reaction was monitored with λ_exc = 280 nm and λ_em = 340 nm for at least 60 min. Mixing was ensured by constant stirring with a stirring bar and the temperature was controlled by an external water bath.

Data were fitted in OriginPro 9 (OriginLab Corp., Northampton, MA) using a monoexponential formula with a linear correction, which accounts for bleaching,

with the rate constant k, the amplitude coefficient a, the slope m, and the offset n. Half-life values were calculated using (t_½ = ln(2)/k). Half-life values were averaged and the standard deviation was calculated from three experiments for each wild type and mutant protein.

Nucleotide Exchange of Wild Type and Mutant Gα_i1 to Caged GTP

The exchange of bound GDP to photolabile pHPcgGTP or NPEcgGTP was performed in the presence of alkaline phosphatase coupled to agarose beads, which is unable to hydrolyze caged compounds. Phosphatase beads were washed 5 times in buffer 1 (50 mm Tris, pH 7.5, 100 μm ZnSO₄) to remove free phosphatase. Each washing step was followed by centrifugation at 10,000 × g and the supernatant was checked for free phosphatase using a colorimetric assay with para-nitrophenylphosphate (43). 5 mg of wild type or mutant Gα_i1 were supplemented with 50 mm Tris, pH 7.5, 10 μm ZnSO₄ and a 2× molar excess of the caged nucleotide. Hydrolysis of free and protein-bound GDP to guanosine was monitored via HPLC. After 3 h at room temperature >95% of GDP was hydrolyzed. Samples were centrifuged at 10,000 × g for 2 min and the supernatant was re-buffered through a Nap5 column (GE Healthcare Life Sciences) that was equilibrated with 10 mm Hepes, pH 7.5, 7.5 mm NaCl, 0.25 mm MgCl₂, 1 mm DTT at 7 °C. Protein fractions were pooled and concentrated in a 10,000 MWCO concentrator (Amicon Ultra-0.5, Merck Millipore, Darmstadt, Germany). Concentrations were determined using Bradford reagent as triplicate and the nucleotide exchange rate of bound caged nucleotide was again determined via HPLC (>95%). Samples were aliquoted into 107.5 μg portions (5 mm final concentration in FTIR measurements), flash frozen in liquid nitrogen, and stored at −80 °C. Subsequently samples were lyophilized for 3 h at −55 °C/0.05 mbar in a Christ Alpha-1–2 LDPlus Lyophilizer (Martin Christ GmbH, Osterode am Harz, Germany) and stored light protected in parafilm and aluminum foil at −20 °C.

FTIR Measurements on Gα_i1

FTIR measurements were performed using 5 mm Gα_i1·cgGTP in 200 mm Hepes, pH 7.5, 150 mm NaCl, 5 mm MgCl₂, 20 mm DTT, 0.1% (v/v) ethylene glycol at 15 °C. RGS4 catalyzed measurements were performed by the addition of 5 mm RGS4 to establish a 1:1 complex with Gα_i1. Sample preparation was done under red light to protect the photolabile caged group. Composition of the required residual buffer depends on the protein concentration of the samples after nucleotide exchange to achieve the above named ion concentrations. FTIR samples were prepared between two CaF₂ windows (Ø 2 cm, 2 mm thickness, one of them with a 10-μm deepened area 1 cm in diameter). One lyophilisate of Gα_i1·cgGTP was dissolved in 0.5 μl of the appropriate residual buffer at the center of the deepened window and subsequently covered with the second window, whose rim had been lubricated with a thin ∼1 mm wide silicon grease film. The windows were fixed in a metal cuvette and mounted in the spectrometer (Bruker IFS 66v/S or Vertex 80 v (Bruker, Ettlingen, Germany)). After sample equilibration, background spectra were taken (400 scans) and photolysis of the caged compounds was carried out with an LPX 240 XeCl excimer laser (Lambda Physics, Göttingen, Germany) by 12 flashes within 24 ms (pHPcgGTP) or 40 flashes within 80 ms (NPEcgGTP) at 308 nm (100–200 mJ/flash, 20 ns pulse duration) (28). Measurements were performed in the rapid-scan mode of the spectrometer for 30 min (Gα_i1-WT, -D229N, -D231N, -D272N) or 3 h (Gα_i1-R178S) using a liquid nitrogen-cooled mercury cadmium telluride detector. Data between 1800 and 950 cm⁻¹ was collected with a spectral resolution of 4 cm⁻¹ using an aperture of 5 mm in the double-sided forward-backward data acquisition mode with a scanner speed of 120 kHz. Data were analyzed via global fit (44). The absorbance change (ΔA(ν,t)) was fitted with a sum of exponential functions n describing the apparent rate constants k₁ and amplitudes a₁ of the hydrolysis reaction and the amplitudes a₀ of the photolysis reaction for every wavenumber ν.

In the figures disappearing bands face downward and appearing bands face upward. Data were averaged over at least 3 measurements. Half-lives were calculated as arithmetic means, variation was calculated as standard deviations.

Molecular Dynamics Simulation and Evaluation

Molecular dynamics (MD) simulations were performed starting with the Gα_i1·Mg²⁺·GTPγS structure of Protein Data Bank (PDB) code 1GIA (5) that depicts the truncated (Δ1–32 Δ345–354) active state of Gα_i1. Structure preparation was performed in Moby (45) and included correction of dihedrals, angles, and bonds according to the UA amber84 forcefield (46), protonation of ionizable side chains using the PKA,MAX,UH,JAB3 algorithm as well as replacement of the GTPγS for a GTP molecule (total charge: −4) and initial solvation by the Vedani algorithm (47). Point mutations were realized in Moby and were followed by a short headgroup optimization. Simulation systems were set up in GROMACS 4.0.7 (48–52). The prepared structures were thoroughly solvated in a cubic simulation cell filled with 154 mm NaCl in explicit TIP4P water. Simulations were carried out in the all atom OPLS forcefield (53) with GTP parameters from T. Rudack (54) at 310 K using the berendsen thermo- and barostat and a time step of 1 fs. Long range electrostatics were calculated using PME (cutoff 0.9 nm), short range electrostatics were calculated using a VDW cutoff of 1.4 nm. Bonds were constrained using LINCS. Systems were energy minimized and equilibrated for 25 ps with restrained protein positions followed by three free MD runs, each to a simulation time of 100 ns (total simulation time 1.5 μs).

Structure analysis was performed using the GROMACS evaluation tools and the contact matrix algorithm implemented in Moby. Pictures were created using PyMOL 1.7.1.1 (Schrödinger LLC, Portland, OR) and Gnuplot 4.4 (55).

Results

FTIR Measurements of Gα_i1

Time-resolved FTIR spectroscopy enables label-free detection of the GTP/GDP vibrations as well as determination of the apparent kinetics of the hydrolysis reaction. The protein was loaded with caged GTP and the sample was excited at 308 nm with a laser flash to remove the caged group (28) that cleaves rapidly (10⁷ s⁻¹ for pHPcgGTP (36)). The resulting difference spectrum is referred to as photolysis spectrum. Subsequently the intrinsic hydrolysis reaction in Gα_i1 takes place (Fig. 3).

FIGURE 3.

Three-dimensional spectrum (global fit) of Gα_i1-WT. The first spectrum represents the photolysis spectrum, subsequently hydrolysis takes place and was monitored. Time dependence of the bands at 1155 cm⁻¹ (gray) and 1078 cm⁻¹ (blue) is indicated. The absorbance change of these bands is shown in Fig. 4.

The reaction (Scheme 1) is observed in FTIR. Global fit analysis of the absorbance changes revealed a monoexponential function that describes the hydrolysis (Fig. 4). No intermediate enrichment was observed in the measurements of Gα_i1-WT. Global fit analysis of five independent Gα_i1-WT measurements at 15 °C resulted in a half-life of 32.7 ± 2.5 s (k_hyd = 0.02 s⁻¹). Data analysis according to Equation 3 resulted in photolysis and hydrolysis spectrums that represent the transition from the pHPcgGTP to the GTP bound active state of Gα_i1 and the transition from the active GTP bound state to the inactive GDP bound state, respectively. Bands facing downward represent the educt state, bands facing upward represent the product state. Both spectra show numerous highly reproducible bands in the protein (1680–1350 cm⁻¹) and the phosphate (1350–950 cm⁻¹) region (Fig. 5). Surprisingly a band at 1784 cm⁻¹ appeared in the photolysis and disappeared in the hydrolysis reaction, indicating a protonation of a carboxyl group from an Asp or Glu (56) in the GTP state (Fig. 5). To our knowledge this is the first time a protonation change has been observed in GTPases. For a clear cut assignment further studies with site-directed mutations have to be performed.

SCHEME 1.

Reaction scheme observed in FTIR measurements.

FIGURE 4.

Kinetics of FTIR measurements of the hydrolysis reaction in Gα_i1 at 15 °C on the basis of the bands for disappearing γ-GTP (1155 cm⁻¹) and appearing as free phosphate (1078 cm⁻¹) (see band assignment (Fig. 6)). Solid lines represent the monoexponential global fit, dots represent data points.

FIGURE 5.

Photolysis and hydrolysis spectrum of Gα_i1. Bands facing downward in the photolysis spectrum represent the pHPcgGTP state of Gα_i1, bands facing upward depict the GTP bound state. Bands facing downward and upward in the hydrolysis spectrum represent the educt and product state of the hydrolysis reaction that takes place in Gα_i1, respectively. The spectral region between 1680 and 1620 cm⁻¹ is superimposed by water absorptions and not further regarded.

Phosphate vibrations were assigned using isotopically labeled nucleotides, namely α-¹⁸O₂-pHPcgGTP, β-¹⁸O₃-pHPcgGTP, and γ-¹⁸O₄-NPEcgGTP. Double difference spectra of FTIR measurements using unlabeled and labeled nucleotides showed exclusively band shifts caused by the isotopes and allow band assignments of the phosphate region. In the photolysis spectrum the bands at 1240, 1224, and 1155 cm⁻¹ were assigned to the asymmetric stretching vibrations of α-, β-, and γ-GTP (Fig. 6, A and B). The vibrations for β- and γ-GTP appear as clear bands, the α-band appears as a shoulder only in the photolysis spectrum but is more distinct in the hydrolysis spectrum. Band assignments of the hydrolysis reaction confirmed α-, β-, and γ-GTP vibrations at 1243, 1224, and 1156 cm⁻¹. The vibrations of the product state were assigned to 1214 cm⁻¹ for α-GDP, 1134 and 1103 cm⁻¹ for β-GDP, and 1078 and 991 cm⁻¹ for the cleaved free phosphate (Fig. 6, C and D). The cleaved phosphate is not protein bound, as the vibrations at 1078 and 991 cm⁻¹ are typical for free phosphate. Protein-bound phosphate intermediates are blue-shifted, e.g. in case of Ras·GAP an intermediate band appears at 1192 cm⁻¹ (57). Because a protein-bound phosphate intermediate was not observed as in case of the Ras·GAP catalyzed reaction, bond breakage is the rate-limiting step in the hydrolysis reaction of Gα_i1 (Fig. 4). Summarizing, the hydrolysis reaction of Gα_i1-bound GTP to GDP and P_i was monitored label free at atomic resolution and in the millisecond time scale. Individual asymmetric stretching modes of GTP and GDP bound to Gα_i1 and P_i were assigned clear cut.

FIGURE 6.

Band assignment via isotopically labeled α-¹⁸O₂-pHPcgGTP, β-¹⁸O₃-pHPcgGTP, and γ-¹⁸O₄-NPEcgGTP of the photolysis (A) and hydrolysis (C) reaction of Gα_i1 at 15 °C. Measurements with NPEcgGTP were scaled by the factor of 5 (photolysis) or 10 (hydrolysis). Arrows indicate band shifts caused by the ¹⁸O isotopes. Double differences (B and D) represent measurements with labeled minus unlabeled nucleotides and reveal the band shift only. The positions of ¹⁸O labeling are depicted in panel E. The ¹⁸O-labeled phosphoester in γ-¹⁸O₄-NPEcgGTP leads to β-¹⁸O₁-GDP, corresponding band shifts are marked in cyan.

In addition, we performed the same experiments with the Gα_i1·RGS4 1:1 complex at 5 °C. Addition of RGS4 further catalyzed the hydrolysis reaction by almost 2 additional orders of magnitude (Fig. 7). As for the intrinsic measurements, global fit analysis resulted in one exponential rate, which demonstrates that again bond breakage is rate-limiting. No protein-bound phosphate intermediate was observed and the absorptions of protein-bound GTP disappeared with the same rate as the absorptions of free P_i developed. RGS4 contributed numerous protein bands and altered the GTP/GDP binding modes. Assignments of these bands by isotopic labeling and site-specific mutagenesis will be part of future work.

FIGURE 7.

Kinetics of the GTPase reactions of intrinsic Gα_i1 and Gα_i1·RGS4 measured via FTIR spectroscopy (β-GDP band at 5 °C)

In the following, various Gα_i1 residues were investigated to determine their role in nucleotide exchange and hydrolysis using site-directed mutagenesis. Investigations included the intrinsic arginine finger mutant Gα_i1-R178S that is known to have a slowed down hydrolysis rate (58), as well as mutations affecting the interface of the Ras-like and the all-α domain (Gα_i1-D229N/Gα_i1-D231N), and a residue that is participating in nucleotide binding (Gα_i1-D272N) (Fig. 8). Multiple turnover measurements via reversed phase HPLC, nucleotide exchange experiments via fluorescence spectroscopy, and single turnover measurements via time-resolved FTIR spectroscopy were used to investigate these mutants.

FIGURE 8.

Positions of the investigated mutants in Gα_i1 (PDB code 1GIA) (5). The Ras-like domain is depicted in beige, the all-α domain in yellow, and the nucleotide in gray. Switch regions are colored red (switch I, residues 178–188), dark green (switch II, residues 202–218), and light green (switch III, residues 230–241). The p-loop (residues 40–47) is colored in cyan. Investigated mutants are located in the interface of the two domains (D229, blue; D231, orange), the phosphate binding region (R178, magenta), and the guanosine binding region (D272, green). Direct binding partners are colored by domain and by element; black dashed lines represent H-bonds. Switch definitions were adapted from Ref. 63. Colors of the mutants are retained hereafter.

Steady-state Measurements

The multiple turnover GTPase reaction of wild type and mutant Gα_i1, consisting of nucleotide exchange (k_off,GDP and k_on,GTP) and the hydrolysis rate k_hyd, was investigated by reversed phase HPLC at 30 °C according to Equation 1. Results can be grouped into four classes. One turnover is a cycle consisting of GDP release, GTP binding, and GTP hydrolysis that took 12.7 ± 0.2 min for Gα_i1-WT. The arginine finger mutant Gα_i1-R178S was slowed down to 29.6 ± 1.6 min per turnover. Gα_i1-D229N and -D231N shared an accelerated turnover time of 3.9 ± 0.03 min and Gα_i1-D272N was accelerated even more to 0.5 ± 0.02 min per turnover (Fig. 9A). It is generally accepted that the GDP release step is rate-limiting in multiple turnover measurements of Gα-proteins (59). To further investigate the underlying rate constants we additionally performed nucleotide exchange and single turnover hydrolysis experiments.

FIGURE 9.

Summary of the results of multiple turnover measurements via HPLC at 30 °C (A), nucleotide exchange experiments via fluorescence spectroscopy at 30 °C (B) and single turnover hydrolysis measurements via FTIR spectroscopy at 15 °C (C) of wild type and mutant Gα_i1.

Nucleotide Exchange Experiments

In contrast to multiple turnover experiments, tryptophan fluorescence spectroscopy can monitor solely the nucleotide exchange reaction from GDP to GTPγS of Gα_i1 as Trp²¹¹ is sensitive for binding of the third phosphate group (Fig. 10). Hydrolysis cannot proceed as GTPγS is a non-hydrolyzable GTP analogue. The results of nucleotide exchange can be grouped into three classes. In contrast to multiple turnover measurements, the half-life value for nucleotide exchange to GTPγS of Gα_i1-R178S was similar to Gα_i1-WT (12.8 ± 0.9 and 10.7 ± 0.2 min, respectively). Nucleotide exchange was accelerated by a factor of about 3 in Gα_i1-D229N and -D231N to 3.3 ± 0.2 and 3.7 ± 0.1 min and even more accelerated in Gα_i1-D272N (0.8 ± 0.03 min) (Fig. 9B). Hence it can be concluded that the acceleration in multiple turnover measurements of Gα_i1-D229N, -D231N, and -D272N can be explained by accelerated dissociation times for GDP and/or association times for GTP. On the other hand the decelerated multiple turnover time for Gα_i1-R178S is not caused by nucleotide exchange, indicating that nucleotide exchange is not the rate-limiting step for this mutant.

FIGURE 10.

Negative control of the mutant Gα_i1-W211A in fluorescence spectroscopy. After baseline monitoring for 5 min, 2.5 μm GTPγS (×5 molar excess) was added to trigger nucleotide exchange.

Single Turnover Hydrolysis Measurements Using FTIR

In contrast to multiple turnover measurements, time-resolved FTIR spectroscopy can determine the hydrolysis reaction label free under actual single turnover conditions with high spatio-temporal resolution. The half-life value was obtained from the results of the global fit procedure (44). The measured kinetics can again be grouped into three classes. Gα_i1-WT and Gα_i1-D231N had similar half-life values of 32.7 ± 2.5 and 27.8 ± 2.6 s, respectively. The single turnover hydrolysis reaction of Gα_i1-D229N and -D272N was slightly slowed down to 50.2 ± 4.5 or 49.8 ± 4.1 s. The hydrolysis reaction of Gα_i1-R178S was noticeably slowed down by 2 orders of magnitude to 3400 ± 400 s (Fig. 9C). Thereby the deceleration of Gα_i1-R178S in multiple turnover measurements can be explained solely by the slowed down single turnover hydrolysis reaction. Due to the change of the rate-limiting step, the slowdown in the multiple turnover assay appears to be only about 2-fold, whereas the single turnover FTIR assay yield the true slowdown by 2 orders of magnitude.

Molecular Dynamics Simulations

To further examine the molecular interactions taking place in the interface between the Ras-like and all-α domain of Gα_i1, molecular dynamics simulations were performed to elucidate the role of Asp²²⁹ and Asp²³¹ at atomic detail. Simulations of wild type Gα_i1 and mutants Gα_i1-D229N and -D231N were performed for 100 ns each. Subsequently contact matrix analysis was carried out for every simulation. Contacts were sampled in time windows of 1 ns and the interaction partners of Asp/Asn²²⁹ and Asp/Asn²³¹ were depicted in Fig. 11. Polar contacts of the side chain groups are indicated by black bars.

FIGURE 11.

Contact matrix analysis of the molecular interactions taking place in the surrounding of Asp²²⁹ (D229) (WT) and the mutant D229N (A) or Asp²³¹ (D231) (WT) and its mutant D231N (B) during a MD simulation. Black bars indicate H-bonds, white spaces indicate no H-bond formation.

Asp²²⁹ formed a stable interdomain contact to the all-α domain through Arg²⁴² that bound Gln¹⁴⁷ in wild type Gα_i1 (Fig. 11A). When mutated to Asn²²⁹, this interdomain contact triad was interrupted after the first 30 ns. Thereby the contact loss between Asn²²⁹ and Arg²⁴² happened simultaneously to the contact loss of Arg²⁴² to Glu⁴³ and Gln¹⁴⁷. Hence Asp²²⁹ seems to position Arg²⁴² allosterically, so that Arg²⁴² forms an interdomain contact that tightly binds and stabilizes the Ras-like and the all-α domain.

Similar to Asp²²⁹, Asp²³¹ formed an interdomain contact to Arg¹⁴⁴ within a 100-ns MD simulation (Fig. 11B). It is notable, that the contact Asp²³¹-Arg¹⁴⁴ does neither exist in the starting structure generated from PDB code 1GIA, nor in the original crystal structure, but formed de novo in the simulation. The initial contact to Lys²⁷⁷ persisted through the simulation time. When mutated to Asn²³¹ the initial contact to Lys²⁷⁷ was weakened, but the contact to Arg¹⁴⁴ was completely lost.

Summarizing the results from multiple and single turnover measurements, nucleotide exchange experiments and simulation data, we understand the effects of the point mutations in Gα_i1. Gα_i1-R178S was slowed down in multiple turnover measurements, but even slower in single turnover measurements that depict only the hydrolysis reaction itself. Its nucleotide exchange ability appeared unaltered. Slowdown of multiple turnover is solely from hydrolysis in this case. Thus Arg¹⁷⁸ only participates in the hydrolysis reaction as described elsewhere (5, 58).

The interface mutations D229N and D231N were both accelerated in multiple turnover measurements. Investigations of the nucleotide exchange reaction showed that the exchange time for both mutants was accelerated. Simulation data suggest an allosteric (Asp²²⁹) and direct (Asp²³¹) interdomain binding mode of both amino acids. Mutations affecting the guanosine binding moiety Asp²⁷² resulted in accelerated half-life values in multiple turnover measurements that can be originated to an accelerated nucleotide exchange behavior as shown via fluorescence spectroscopy.

Discussion

Molecular mechanisms that take place in Gα_i1 have been investigated by numerous studies including structural (5, 34, 60), computational (61), and biochemical (13, 14, 33) assays. In particular, multiple turnover GTPase assays like malachite green or radiometric phosphate tests using [γ-³²P]GTP are widely used even though it is commonly known that GDP/GTP exchange is the rate-limiting step in intrinsic multiple turnover measurements (9–12) and thereby determines k_obs. Pre-steady-state measurements using GTP or [γ-³²P]GTP pre-loaded Gα subunits that are triggered via Mg²⁺ addition are also able to depict single turnover conditions, but the percentage of nucleotide loading (Gα·GTP versus Gα·GDP) and the altered GTP binding affinity due to Mg²⁺-binding (62) may cause systematic errors such as side reactions like nucleotide exchange. However, in FTIR measurements the percentage of loaded cgGTP versus GDP does not influence the kinetics due to the method of phototriggered difference spectroscopy. Additionally we checked the loading rate via HPLC (always >95% cgGTP) and removed non protein-bound nucleotides. The determined single turnover rate for wild type Gα_i1 measured via FTIR spectroscopy (0.02 s⁻¹ at 15 °C) is in good agreement to the literature (0.03 s⁻¹ at 30 °C (58) and 0.03 s⁻¹ to 0.04 s⁻¹ at 20 °C (13, 64)). In addition the ensemble of methods enables a classification of effects caused by point mutations in high detail. Effects caused by the intrinsic arginine finger mutant Gα_i1-R178S were quantified correctly in single turnover measurements (2 orders of magnitude) but not in multiple turnover measurements (factor of 2). The unaltered nucleotide exchange rate of Gα_i1-R178X mutants has already been described elsewhere (5).

Single turnover FTIR spectroscopy unravels for the first time the rate-limiting step of the intrinsic GTP hydrolysis in Gα_i1. Analogue experiments with small GTPases revealed that in some cases the bond breakage and in others the P_i release is rate-limiting (57). For Gα_i1 no protein-bound cleaved phosphate intermediate could be observed, thus bond breakage is the rate-limiting step in this reaction. This is surprising due to the tight coordination of the nucleotide by Gα_i1. The narrow protein environment is still able to release free phosphate to the periphery, probably through a small channel located near the γ-phosphate. The measured IR bands for GTP and GDP are very sensitive to changes in the protein environment and depict for the first time the coordination of the natural nucleotides GDP and GTP in Gα_i1 in contrast to GTP analogues, which were described to have poor affinities for Gα_i1 (65). After we have successfully assigned the α-, β-, γ-, and the free phosphate vibrations it will be possible to assess the effect of point mutations in the binding pocket of Gα_i1 in the future supported by theoretical IR spectra calculation from QM/MM simulations as performed for the small GTPase Ras (66) to further decode the experimental spectra. In addition to the phosphate bands, various bands caused by the protein itself were nicely resolved, which will enable investigations of the hydrolysis mechanism taking place in Gα proteins with improved spatio-temporal resolution. The observed band at 1784 cm⁻¹ is the first protonation change observed in GTPases to our knowledge. In fact, heterotrimeric G proteins have been speculated to function as pH sensors (67) and a protonation change close to the surface of Gα_i1 could function as a key player in this reaction.

In addition to the intrinsic GTPase reaction of Gα_i1 we were also able to measure the hydrolysis reaction catalyzed by RGS4 via FTIR spectroscopy. Hydrolysis was thereby accelerated by almost 2 orders of magnitude (Fig. 7). As for intrinsic Gα_i1, bond breakage is the rate-limiting step.

We were able to show with our orchestration of different methods that two point mutations in the Gα_i1 Ras-like/all-α interface (Gα_i1-D229N/Gα_i1-D231N) are able to weaken the coordination in the protein domain interface. Our measurements together with MD simulations demonstrate the importance of the amino acid triad Asp²²⁹-Arg²⁴²-Gln¹⁴⁷ for the interface coordination in Gα_i1. Asp²²⁹ holds Arg²⁴² in a position to bridge the interface to Gln¹⁴⁷. Investigations on the mutant Gα_i1-R242A confirmed its role (nucleotide exchange: 3.09 ± 0.21 min/single turnover hydrolysis: 32.5 ± 3.5 s) and resulted in similar values as Gα_i1-D229N. In agreement, accelerated nucleotide exchange for Gα_i1-R242A has recently been described for the analogue R243H in Gα_o (68). Our findings on the other amino acid in the domain interface, Asp²³¹, suggest a direct binding mode of the side chain of Asp²³¹ across the interface to Arg¹⁴⁴. This contact is not observable in any of the deposited structures of Gα_i1 in the Protein Data Bank, except structure 4PAQ where the side chain of Arg¹⁴⁴ is slightly tilted toward Asp²³¹ with occupancy of 0.46 (69). In contrast to tightly packed crystal structures, the dynamics of Gα_i1 in our experiments and in our simulations are much more comparable with physiological conditions, so we hereby demonstrate the importance of the salt bridge Asp²³¹-Arg¹⁴⁴, which is not observable in the crystal structures. Our findings are summarized in an advanced interface binding model of Gα_i1 as shown in Fig. 12.

FIGURE 12.

Advanced Ras-like/all-α interdomain binding model of Gα_i1. In contrast to the crystal structures, Asp²³¹ (D231) forms an interdomain H-bond to Arg¹⁴⁴ (D144). Arg²⁴² (R242) is stabilized by Asp²²⁹ (D229) and thereby forms an H-bond to Gln¹⁴⁷ (Q147). Ras-like domain is shown in beige, all-α domain in yellow, and GTP in gray balls and sticks.

In summary, we were able to measure the isolated rates of nucleotide exchange and GTP hydrolysis, which both contribute to the signaling state of Gα_i1. In addition we identified the individual phosphate vibrations of GTP, GDP, and P_i during the hydrolysis reaction of Gα_i1. We demonstrated the importance of the intrinsic arginine finger for the hydrolysis reaction and the relevance of Asp²⁷² for nucleotide binding. Furthermore, we identified novel key players in the coordination of the Ras-like/all-α interface. Asp²²⁹ stabilizes the interface allosterically via Arg²⁴² and Asp²³¹ forms a direct H-bond to Arg¹⁴⁴. Orchestration of our methods will further elucidate the molecular mechanisms taking place in Gα_i1 in the future.