Summary
Many acute and chronic anemias, including hemolysis, sepsis, and genetic bone marrow failure diseases such as Diamond-Blackfan Anemia (DBA), are not treatable with erythropoietin (Epo), because the colony-forming unit erythroid progenitors (CFU-Es) that respond to Epo are either too few in number or are not sensitive enough to Epo to maintain sufficient red blood cell production 1,2,3–5,6,7,8,9. Treatment of these anemias requires a drug that acts at an earlier stage of red cell formation and enhances the formation of Epo-sensitive CFU-E progenitors. Recently we showed that glucocorticoids specifically stimulate self-renewal of the early erythroid progenitor, the burst-forming unit erythroid (BFU-E), and increase the production of terminally differentiated erythroid cells 10,11. Here we demonstrate that activation of the peroxisome proliferator-activated receptor alpha (PPARα) by PPARα agonists, GW7647 and fenofibrate, synergizes with glucocorticoid receptor (GR) to promote BFU-E self-renewal. Over time these agonists greatly increase production of mature red blood cells in cultures both of mouse fetal liver BFU-Es and of mobilized human adult CD34+ peripheral blood progenitors, the latter employing a new and effective culture system that generates normal enucleated reticulocytes. While PPARα−/− mice show no hematological difference from wild-type mice in both normal and phenylhydrazine (PHZ)-induced stress erythropoiesis, PPARα agonists facilitate recovery of wild-type mice, but not PPARα−/− mice, from PHZ-induced acute hemolytic anemia. We also showed that PPARα alleviates anemia in a mouse model of chronic anemia. Finally, both in control and corticosteroid-treated BFU-E cells PPARα co-occupies many chromatin sites with GR; when activated by PPARα agonists, additional PPARα is recruited to GR-adjacent sites and presumably facilitates GR-dependent BFU-E self-renewal. Our discovery of the role of PPARα agonists in stimulating self-renewal of early erythroid progenitor cells suggests that the clinically tested PPARα agonists we used may improve the efficacy of corticosteroids in treating Epo resistant anemias.
The therapeutic effect of GCs in treating Epo-resistant anemias such as DBA is well documented, though steroid therapy is known for its severe side effects that limit its use 12,13. Given the physiological importance and attractive drug targets of nuclear receptors (NRs) 14–17, and in the hope of identifying other small molecule drugs that can either individually or in combination with GCs expand BFU-E progenitors, we analyzed the expression of 49 NR genes during mouse BFU-E self-renewal promoted by dexamethasone (DEX) 10. While expression of most NR genes was unchanged, seven were up-regulated and three down-regulated by more than 2-fold (Supplementary Table 1). Amongst these PPARα changed the most: a 5-fold induction (Extended Data Fig. 1a). While most NR agonists and antagonists had no significant effects on erythroid production in cultures of primary mouse BFU-Es, two PPARα agonists, GW7647 and fenofibrate, synergized with DEX to increase the output of erythroid cells (Supplementary Table 2 and Fig. 1a). In the absence of corticosteroids, neither GW7647 nor fenofibrate affected erythropoiesis. Fenofibrate is an FDA proved drug primarily used to treat hypercholesterolemia and hypertriglyceridaemia 18, and GW7647 is a PPARα agonist with higher receptor binding affinity and specificity (EC50 = 6 nM) 19.
When added together with DEX, either GW7647 or fenofibrate led to a ~150-fold increase in erythroblast production, 3–5 fold greater than DEX alone (Fig. 1a). At the end of the culture, virtually all of the cells are erythroblast cells (Extended Data Fig. 1b). Importantly, the expression of PPARα declines markedly from the BFU-E stage to the CFU-E, consistent with the decline of DNase I hypersensitivity (DHS) of the PPARα promoter (Extended Data Fig. 1c, d).
Neither GW7647 nor fenofibrate was able to increase erythroblast production from isolated mouse CFU-E cells, suggesting a specific function of PPARα agonists on BFU-Es (Extended Data Fig. 1e). GW7647 also synergized with lower doses of DEX in promoting erythroid cell production (Fig. 1b). Importantly, the effects of GW7647 and fenofibrate require the PPARα receptor since BFU-E cells isolated from PPARα−/− mice 20 failed to respond to their treatment (Fig. 1a).
Added together with DEX, 10 μM of either GW7647 or fenofibrate significantly increased BFU-E colony numbers and maintained high BFU-E numbers over one additional day relative to that achieved by DEX alone (Fig. 1c). Concentrations of GW7647 as low as 100 nM effectively synergized with 100 nM DEX in promoting BFU-E self-renewal (Extended Data Fig.1f).
Blood from PPARα−/− mice exhibits no hematological abnormalities, indicating that PPARα is not necessary for normal erythropoiesis (Supplementary Table 3). Consistent with this, the PPARα antagonist GW6471 does not interfere with DEX promoted BFU-E self-renewal, indicating that DEX does not promote BFU-E self-renewal through activating the transcriptional activity of PPARα (Extended Data Fig. 1g).
Adding GW7647 increases total cell number by an additional 4-fold, yielding a 120,000-fold expansion in our newly developed synchronized human CD34+ erythroid culture system (Supplementary Discussion and Fig. 2a). In these cultures the numbers of BFU-Es and CFU-Es are highest during days 5–8 (Fig. 2b, Extended Data Fig. 2a). Addition of GW7647 with DEX increased total BFU-E numbers, which in turn subsequently increased total CFU-E numbers in the culture. Similar to mouse BFU-E cultures, GW7647 synergized with very low concentrations of DEX in stimulating erythroid expansion of human CD34+ cells (Extended Data Fig. 2b). Addition of DEX and GW7647 affect expression of many erythroid-important genes (Supplementary Discussion).
As expected, knocking down PPARα abrogated the ability of GW7647 to stimulate production of BFU-E cells or the total number of erythroid cells at the end of the culture (Fig. 2c, Extended Data Fig. 2c). Consistent with the absence of a role for PPARα in normal hematopoiesis, knocking down PPARα in human CD34+ cells did not affect the ability of DEX to stimulate BFU-E production or production of erythroid cells. Thus, in the human as well as in the mouse only ligand-activated, not unactivated, PPARα synergizes with DEX to promote BFU-E self-renewal during erythroid differentiation. We note that our cultures are highly synchronous based on cell surface marker expression (Extended Data Fig. 2e) as well as morphology (Fig. 2d). Neither DEX nor GW7647 had any effects on terminal differentiation or enucleation (Extended Data Fig. 2h).
GW7647 significantly increased the number of both BFU-E and CFU-Es in our CD34+ cell culture system following RPS19 knockdown, which recapitulates RPS19 haploinsufficiency in DBA patients 21,22 (Extended Data Fig. 3a). Addition of GW7647 substantially increased the fraction of CD71+ cells at day 9 of culture following RPS19 knockdown as well as total cell numbers and the fraction of CD235a+ cells at day 21 (Extended Data Figs. 3b, c). Taken together, our data suggest that GW7647 facilitates BFU-E self-renewal and production of immature erythroid progenitors in both wild-type and RPS19 knockdown human cells.
We next tested the function of GW7647 in a PHZ-induced hemolytic anemia mouse model where the endogenous corticosteroid level becomes markedly increased 11. Wild-type mice were treated with either DMSO or GW7647 for 3 days followed by treatment with PHZ; they were then injected with DMSO or GW7647 for another 7 days (Supplementary Discussion and Extended Data Fig. 4a). Treatment of GW7647 resulted in significantly higher levels of hemoglobin (HGB), RBC numbers, and hematocrit (HCT) after PHZ injection compared to those in control mice (Fig. 3a). In contrast, white blood cell (WBC) counts were similar in the two groups (data not shown). Importantly, the function of GW7647 during stress erythropoiesis was dependent on PPARα, as PPARα−/− mice failed to respond to GW7647 treatment (Extended Data Fig. 4b).
We also tested the ability of PPARα agonists to stimulate red cell production in a mouse model of chronic anemia, Nan (“neonatal anemia”) mice (Supplementary Discussion). While BFU-E numbers in spleens of Nan/+ mutant mice are similar to or slightly higher than that in wild-type mice, the average number of BFU-Es in the spleens of GW7647 injected Nan/+ mutant mice are higher than that in untreated mice (Extended Data Fig. 5b). Importantly, GW7647 injection increased hemoglobin level, hematocrits and red blood cell numbers in these anemic mice (Fig. 3b), suggesting that the PPARα agonist alleviates anemia in Nan/+ mutant mice by increasing BFU-E numbers in the spleen. GW7647 does not have any significant effects on either platelet or WBC numbers in peripheral blood from Nan/+ mice (Extended Data Fig. 5c).
To understand the molecular mechanism by which PPARα synergizes with GR to promote BFU-E self-renewal, we conducted ChIP-Seq analysis to interrogate the genome-wide chromatin occupancy of GR and PPARα in mouse BFU-E cells. Compared to untreated cells, GR and PPARα occupancy were both induced upon DEX treatment alone; addition of GW7647 further enhanced PPARα but not GR occupancy (Fig. 4a). These results indicate that GW7647 enhances the recruitment of PPARα to GR binding sites in BFU-Es. In BFU-Es co-treated with GW7647 and DEX, our ChIP-Seq detected 1058 GR peaks and 1623 PPARα peaks. GR and PPARα both predominantly occupied distal intergenic (> 63%) and intronic chromatin sites (> 25%) (Extended Data Fig. 6a). Importantly, in 719 peaks GR and PPARα localize in close proximity (Extended Data Fig. 6b); 67.9% of total GR peaks and 44.3% of PPARα peaks co-localize. The DNA sequences underlying these overlap peaks are enriched for DNA binding motifs for several transcription factors including PU.1, YY1, Smad3, Tal1, Klf4, Hif2α and Myb (Extended Data Fig. 6c); most of these transcription factors are known to play important roles in stem cell self-renewal 23. In addition, co-treatment of DEX and GW7647 also up-regulates many genes critical for stem cell self-renewal (Supplementary Discussion and Extended Data Figs. 7, 8).
Treatment of BFU-E cells with DEX leads to a slight increase in the level of the PPARα protein, and this is further increased to 1.6 times that of control cells by treatment with DEX and GW7647 (Fig. 4c). In contrast, the GR protein level is not altered in BFU-Es under these conditions. Consistent with these observations, addition of DEX to BFU-E cells induced the binding both of GR and PPARα to a chromatin site ~ 5 kb upstream of TSS of PPARα, presumably part of a PPARα gene enhancer, and the binding of PPARα to this chromatin site was further enhanced by addition of GW7647 (Fig. 4b). Our data suggest that there is a positive autoregulatory feedback loop of PPARα expression during BFU-E self-renewal promoted by DEX and GW7647.
Co-immunoprecipitation experiments demonstrated an interaction of GR and PPARα only in BFU-E cells treated with DEX together or not with GW7647 (Fig. 4d). While addition of DEX to cultures of BFU-E cells stimulated binding of PPARα to the GR, interactions between PPARα and GR were more pronounced following treatment with both DEX and GW7647. These results extend our ChIP-Seq data, indicating that there is a physical interaction between GR and PPARα and likely other proteins, that underlie DEX and GW7647 enhanced BFU-E self-renewal (Supplementary Discussion and Extended Data Fig. 9).
Given that little is known concerning endogenous PPARα ligands, the precise role of the PPARα in hematopoiesis, erythropoiesis in particular, remains elusive. Nonetheless, our finding that agonists of the PPARα lead to enhanced binding of PPARα to many chromatin sites and to an increase in corticosteroid-induced BFU-E self renewal and erythroid expansion, point to a previously unappreciated role for this nuclear receptor in hematopoiesis (Extended Data Fig. 10). The function of PPARα has been mainly studied in nutrient metabolism and energy homeostasis, and fenofibrate is already an FDA-approved drug for dyslipidemia treatment 18. Given that there is a very limited number of drugs that can be used to treat Epo-resistant anemias, the discovery of new drugs or repurposing current drugs to treat these diseases is challenging. Our surprising discovery suggests a novel function of PPARα in self-renewal of early committed erythroid progenitors, which potentially can lead to new therapeutics to treat Epo-resistant anemias such as DBA.
Methods
Reagents
Chemicals are obtained from Sigma. Human peripheral blood G-CSF mobilized hematopoietic stem/progenitor cells enriched for CD34+ were purchased from Fred Hutchinson Cancer Research Center (FHCRC), Seattle. StemSpan™ SFEM, CC100 cytokine cocktail, fetal bovine serum and bovine serum albumin (BSA) are purchased from STEMCELL Technologies. Holo human transferrin is from Sigma. Recombinant human and murine Stem cell factor (rhSCF, rmSCF) and Interleukin 3 (rhIL-3, rmIL-3), recombinant murine Interleukin 6 (rmIL-6) and recombinant murine insulin like growth factor-1 (rmIGF-1) are from Peprotech. Recombinant human erythropoietin (rhEpo) is from Amgen. Antibodies: Santa Cruz: GR: H300 (sc-8992), M-20 (sc-1004); PPARα: H-98 (sc-9000). β-actin: N-21(sc-130656); RPS19 antibody is from Abcam (ab57643). FACS antibodies are from eBioscience: anti-human c-kit PE (#12-1178), anti-human CD71 FITC (#11-0719), anti-human CD235a APC (#17-9987), anti-mouse CD71 PE (#12-0711), and anti-mouse Ter119 APC (#17-5921). Real time PCR Primers (mouse): Hbb-F: TTTAACGATGGCCTGAATCACTT; Hbb-R: CAGCACAATCACGATCATATTGC; Slc4a1-F: GGACAGATAGCATATAGAGACCTAACCA; Slc4a1-R: CGTAGTCTGTGGCTGTTTGCTC; Egln2-F: 5′ CTGGGCAACTACGTCATCAAT; Egln2-R: 5′ CCGCCATGCACCTTAACATC; Hmgcs2-F: 5′GAAGAGAGCGATGCAGGAAAC, Hmgcs2-R: 5′ GTCCACATATTGGGCTGGAAA; Kit-F: 5′ GTTCTGCTCCTACTGCTTCGC; Kit-R: 5′ TAACAGCCTAATCTCGTCGCC.
shRNA sequences: human PPARA shRNA-1 GGAGTTTATGAGGCCATATTC; human PPARA shRNA-2: GCTTTACGGAATACCAGTATT; mouse Pu.1 shRNA: CCATGTCCACAACAACGAGTT; ChIP-PCR primers: KIT ChIP-PCR 5′ F: GTCACAGCCACCAGAGAGAG; KIT ChIP-PCR 5′ R: TGGCAATGTTAAGAAGTGGTGG; PPARA ChIP-PCR 5′ F: CCAGGGCTACACAGAGAAAC; PPARA ChIP-PCR 3′ F: TAGCCTGAGAGTTGTGCCAA
RPS19 shRNA is described in a previously published study 21.
Ex vivo human CD34+ erythroid culture
Our Human CD34+ cell erythroid differentiation method is composed of 4 phases over 21 days: Expansion (Day 0–4), Differentiation (Dif) I (Day 5–9), II (Day 10–13), and III (Day 14–21). Cells are thawed according to the FHCRC protocol, and cultured in Expansion medium (StemSpan™ SFEM, CC100 cytokine cocktail and 2% penicillin-streptomycin) at 105 cells/mL from Day 0–4. After expansion, cells are subsequently cultured in Iscove’s Modified Dulbecco’s Medium (IMDM)-based erythroid differentiation medium supplemented with different cytokines in Dif I, II and III. The medium base for all three differentiation phases comprises: IMDM, 15% FBS, 2mM glutamine, 1% BSA, 500 μg/mL holo human transferrin, 10 μg/mL recombinant human insulin and 2% penicillin-streptomycin. Day 5–9, cells are cultured in Dif I medium, which contains erythroid medium base, 1 μM Dexamethasone, 1μM β-estradiol, 5 ng/mL rhIL-3, 100 ng/mL rhSCF and 6U/mL rhEpo. Day 10–13, cells are grown in Dif II medium containing erythroid medium base, 50 ng/mL rhSCF and 6U/mL rhEpo. Day 14–21, cells are cultured in fibronectin-coated plates in Dif III medium, which is erythroid medium base supplemented with 2U/mL rhEpo. GW7647 was added in both Dif I (100 nM) and Dif II (10 nM) when indicated. Cell numbers reseeded in the beginning of Dif I, II and III are 105, 2*105, and 3*105/mL, respectively.
Mouse fetal liver BFU-E and CFU-E isolation, cell proliferation assay and virus transduction
Purification of BFU-E and CFU-E cells from murine fetal livers was performed as described before 10. Briefly, fetal liver erythroid cells were isolated between embryonic days 14.5 (E14.5) to E15.5. A pure erythroid progenitor population containing more than 90% of BFU-E and CFU-E cells were obtained through a negative magnetic bead selection for lineage markers including Ter119, B220, Mac-1, CD3, Gr-1, Sca-1, CD16/CD32, CD41, CD34 and positive selection for c-Kit. Afterwards c-Kit+ BFU-E (CD71 10% low) and CFU-E (CD71 20% high) cells were separated by flow cytometry. Purified BFU-E or CFU-E cells were seeded in serum-free erythroid liquid expansion medium (SFELE) (StemSpan™ SFEM with 100 ng/mL rmSCF, 40 ng/mL rmIGF-1, and 2 U/mL rhEpo) alone, or SFELE containing 100 nM DEX ± 10 μM GW7647. Erythroblasts produced from purified BFU-E and CFU-E were analyzed over time by FACS and benzidine-Giemsa staining as described 10.
For PU.1 knock down, primary BFU–Es purified from mouse E14.5 fetal liver were incubated with virus encoding a shRNA for LacZ or mouse Pu.1 at 37 °C overnight. After incubation, cells were cultured in SFELE medium with or without DEX and/or GW7647.
Colony forming assay
Murine BFU-E colony-forming assays were performed in MethoCult M3234 (StemCell Technologies) containing 10 U/mL rhEpo, 20 ng/mL rmIL-3, 20 ng/mL rmIL-6, and 50 ng/mL rmSCF, with or without 100 nM DEX ± 10 μM GW7647. For CFU-E colony-forming assays, cells were cultured in MethoCult M3234 containing 10 U/mL rhEpo, with or without 100 nM DEX ± 10 μM GW7647. The number of CFU-E or BFU-E colonies was scored after 3 days or 7 days in culture, respectively.
For human colony forming assays, cells were plated in MethoCult H4034 Optimum (StemCell Technologies) without additional cytokines. Cells were cultured for 12 – 14 days before BFU-E and CFU-E colonies were scored.
In vivo mice experiments to test PPARα agonists
129/SvImJ (wild-type), 129S4/SvJae (wild-type), or 129S4/SvJae-Pparα tm1Gonz/J female mice (The Jackson Laboratory) 6 – 8 weeks of age, randomized by weight, were pretreated with GW7647 (100 μg/kg) for 3 days (days −3 – −1). On day 0, the mice were injected with phenylhydrazine (PHZ) (60 mg/kg). GW7647 injection was continued during days 0 – 6. Whole blood samples were collected at each day of day 1 – 5, and day 7 and 9 for Complete Blood Count (CBC) analyses.
4 to 6 week old Nan/+ mutant mice (officially designated as Klf1Nan; http://www.informatics.jax.org/allele/MGI:1861107), obtained from the Jackson Laboratory, were injected with GW7647 (100 μg/kg) for 18 days. Mice were randomized by weight. Whole blood samples were collected every 3 days for CBC analyses.
All mouse procedures were approved by the Animal Care and Use Committees of the Massachusetts Institute of Technology (Cambridge, MA).
Loss-of-function assay in human CD34+ erythroid culture system via lentiviral transduction
The lentiviral backbone vector pLKO.1 and packaging plasmids were transfected into 293T cells. Supernatants containing viral particles were harvested at 48 and 72 hrs. Primary human CD34+ hematopoietic cells were transduced with lentivirus one day after thawing with the presence of 2 μg/mL polybrene (Sigma). 24 hrs after viral transduction, cells were selected by growing in culture medium containing 1 μg/mL puromycin (Sigma) for 2 days.
For RPS19 knock down, 5x105 CD34 cells at day 1 of culture were infected with lentivirus encoding GFP and an shRNA targeting human RPS19 21 or a scrambled shRNA. Cells were then treated with DMSO or 0.01 μM, 0.1 μM or 1 μM GW7647. After 48 hrs, GFP positive cells were isolated by flow cytometry and returned to culture. Colony forming assay were conducted at day 6. CD71 expression was analyzed at day 9 and CD235 expression was analyzed at day 21 to determine the percentage of erythroid cells. Total cell numbers were also counted at the end of each differentiation stage.
ChIP-Seq and de novo motif discovery
Mouse ChIP-Seq experiments in BFU-Es were conducted as described before 11. 107 mouse BFU-E cells purified from E14.5 fetal liver with or without treatment were used per IP. Besides specific antibodies, we included species-matched IgG as control, and species-matched IgG yielded little to no signals. Purified DNA was prepared for sequencing according to a modified version of the Solexa genomic DNA protocol. ChIP-Seq fragments as well as inputs were barcoded and sequenced on an Illumina HiSeq sequencer. Approximately 30 million 40 nt long single reads per sample were obtained. Adapters were removed and reads shorter than 20 nt were discarded. Reads were mapped with Bowtie1 24. Peaks were called with MACS 1.4 using the corresponding input for each sample and “mfold” set to 5,30 25. We selected peaks with fold enrichment ≥10. Plots showing density of reads around the peak summits were done with ngsplots. For de novo motif discovery, Homer was used with default setting to find motifs in GR and PPARα overlapping peaks 26.
RNA-Seq
BFU-E cells from embryonic day 14.5 (E14.5) mouse fetal livers were isolated as described 3. Total RNA was purified from the mouse BFU-Es. Samples for Paired-End mRNA-seq were prepared using the Solexa kit according to the manufacturer’s instructions. RNA samples from two replicas of cells untreated, or treated with DEX ± GW7647 for 12 hrs were sequenced on an Illumina HiSeq sequencer. Around 50 million 100 nucleotide (nt) paired-end reads were obtained from each sample. Reads were trimmed to remove low quality reads using FASTQ quality trimmer with quality threshold of 20 (−t 20) and minimum length to keep 25 nt (−l 25). Reads that still had both pairs after the trimming step were mapped with TopHat 27 using gene models from ENSEMBL Genes 67, Mus musculus genes NCBIM37 (Mus_musculus.NCBIM37.67). The number of reads mapped to each gene was obtained with HTseq-count. Differential expression was assayed using DE-seq 28.
For each of the 719 peaks bound by both GR and PPARα in the presence of GW7647 and DEX, we found the closest gene using the closestBed tool 29. We filtered out any gene at a distance higher than 10 Kb from a peak.
Immunoprecipitation
Mouse BFU-Es were isolated from E14.5 mouse fetal livers. Cells were cultured in SFELE medium alone or treated with 100 nM Dex with or without 10 μM GW7647 for 12 hrs. Whole cell lysates were prepared from 4 x 107 cells using RIPA lysis buffer (sc-24948, Santa Cruz Biotechnology) with protease inhibitor cocktail. The lysates were pre-cleared by incubating with protein A-Sepharose for 1 h at 4°C and centrifugation. The supernatant was immunoprecipitated with 1 μg rabbit IgG or anti-GR antibody overnight at 4°C. Immune complexes were collected by incubation with protein A-Sepharose for 4 hrs at 4°C and washed for 5 times at 4°C with lysis buffer. The immune complexes adsorbed to the beads were centrifuged and the supernatant was removed. 50 μL of 1x loading buffer was added to the samples and boiled at 95°C for 5 minutes. Proteins were resolved by SDS-PAGE and immunoblotted by GR and PPARα antibodies.
Quantitative Real-Time RT-PCR
Total RNA from mouse BFU-Es was purified with TRIzol (Invitrogen). cDNA was prepared from 1 μg RNA. Reaction mixtures (15 μL) contained 2.0 μL of cDNA, 7.5 μL of SYBR green master mix (Applied Biosystems) and appropriate primers. Product was monitored by SYBR green fluorescence. Control reactions lacking RT yielded little to no signal. Relative expression levels were determined from a delta-delta CT method and were normalized to 18S rRNA expression.
Extended Data
Supplementary Material
Acknowledgments
We thank the Whitehead Institute Flow Cytometry Facility, Genome Technology Core and Bioinformatics & Research Computing (BARC) Facility, as well as MIT Koch Institute Flow Cytometry Core. We appreciate the help of Dr. Vijay Sankaran (Boston Children’s Hospital) for hemoglobin HPLC and Dr. Johan Flygare (Lund Universitet) for the plasmid encoding the RPS19 shRNA. We are very grateful to animal technicians Ferenc Reinhardt and Tony E. Chavarria for their assistance. This study was supported by grants to H.F.L. (DARPA #HR0011-14-2-0005; DOD/U.S. Army Medical Research and Materiel Command #W81WH-12-1-0449, NIH/NHLBI 2 P01 HL032262-25; as well as research support from the Diamond-Blackfan Anemia Foundation and Diamond Blackfan Anemia Canada. L.L.P. was supported by NIH grant DK100692. X.G. was supported by a postdoctoral fellowship from the Leukemia and Lymphoma Society.
Footnotes
Author Contributions
H.Y.L., X.G., L.L.P. and H.F.L. designed the experiments. H.Y.L., X.G. and R.R.E. performed the experiments. M.I.B. and H.L. conducted bioinformatic analyses of ChIP-Seq and RNA-Seq. H.Y.L., X.G. and H.F.L. wrote the manuscript with input from M.I.B.. All authors discussed the results and commented on the manuscript.
Supplementary Information is linked to the online version of the paper at www.nature.com/nature.
RNA-Seq and ChIP-Seq data have been deposited in the Gene Expression Omnibus under accession numbers GSE63836 and GSE63837, respectively.
The authors declare no competing financial interests.
References
- 1.Kaushansky KLAM, Beutler E, Kipps JT, Seligsohn U, Prchal TJ. Title of book: Williams Hematology. 8. 2010. [Google Scholar]
- 2.Livingston DH, et al. Bone marrow failure following severe injury in humans. Annals of surgery. 2003;238:748–753. doi: 10.1097/01.sla.0000094441.38807.09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Jones KB, Anderson DW, Longmore GD. Effects of recombinant hematopoietins on blood-loss anemia in mice. The Iowa orthopaedic journal. 2005;25:129–134. [PMC free article] [PubMed] [Google Scholar]
- 4.Robinson Y, et al. Impaired erythropoiesis after haemorrhagic shock in mice is associated with erythroid progenitor apoptosis in vivo. Acta anaesthesiologica Scandinavica. 2008;52:605–613. doi: 10.1111/j.1399-6576.2008.01656.x. [DOI] [PubMed] [Google Scholar]
- 5.Zimmerman JL. Use of blood products in sepsis: an evidence-based review. Critical care medicine. 2004;32:S542–547. doi: 10.1097/01.ccm.0000145906.63859.1a. [DOI] [PubMed] [Google Scholar]
- 6.Fiorillo A, et al. Unresponsiveness to erythropoietin therapy in a case of Blackfan Diamond anemia. American journal of hematology. 1991;37:65. doi: 10.1002/ajh.2830370121. [DOI] [PubMed] [Google Scholar]
- 7.Nathan DG, Clarke BJ, Hillman DG, Alter BP, Housman DE. Erythroid precursors in congenital hypoplastic (Diamond-Blackfan) anemia. The Journal of clinical investigation. 1978;61:489–498. doi: 10.1172/JCI108960. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Vlachos A, Muir E. How I treat Diamond-Blackfan anemia. Blood. 2010;116:3715–3723. doi: 10.1182/blood-2010-02-251090. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Niemeyer CM, et al. Treatment trial with recombinant human erythropoietin in children with congenital hypoplastic anemia. Contributions to nephrology. 1991;88:276–280. doi: 10.1159/000419537. discussion 281. [DOI] [PubMed] [Google Scholar]
- 10.Flygare J, Rayon Estrada V, Shin C, Gupta S, Lodish HF. HIF1alpha synergizes with glucocorticoids to promote BFU-E progenitor self-renewal. Blood. 2011;117:3435–3444. doi: 10.1182/blood-2010-07-295550. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Zhang L, et al. ZFP36L2 is required for self-renewal of early burst-forming unit erythroid progenitors. Nature. 2013;499:92–96. doi: 10.1038/nature12215. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Willig TN, et al. Identification of new prognosis factors from the clinical and epidemiologic analysis of a registry of 229 Diamond-Blackfan anemia patients. DBA group of Societe d’Hematologie et d’Immunologie Pediatrique (SHIP), Gesellshaft fur Padiatrische Onkologie und Hamatologie (GPOH), and the European Society for Pediatric Hematology and Immunology (ESPHI) Pediatric research. 1999;46:553–561. doi: 10.1203/00006450-199911000-00011. [DOI] [PubMed] [Google Scholar]
- 13.Lipton JM, Atsidaftos E, Zyskind I, Vlachos A. Improving clinical care and elucidating the pathophysiology of Diamond Blackfan anemia: an update from the Diamond Blackfan Anemia Registry. Pediatric blood & cancer. 2006;46:558–564. doi: 10.1002/pbc.20642. [DOI] [PubMed] [Google Scholar]
- 14.Bauer A, et al. The glucocorticoid receptor is required for stress erythropoiesis. Genes & development. 1999;13:2996–3002. doi: 10.1101/gad.13.22.2996. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.von Lindern M, et al. The glucocorticoid receptor cooperates with the erythropoietin receptor and c-Kit to enhance and sustain proliferation of erythroid progenitors in vitro. Blood. 1999;94:550–559. [PubMed] [Google Scholar]
- 16.O’Malley B. The steroid receptor superfamily: more excitement predicted for the future. Molecular endocrinology. 1990;4:363–369. doi: 10.1210/mend-4-3-363. [DOI] [PubMed] [Google Scholar]
- 17.Moore JT, Collins JL, Pearce KH. The nuclear receptor superfamily and drug discovery. ChemMedChem. 2006;1:504–523. doi: 10.1002/cmdc.200600006. [DOI] [PubMed] [Google Scholar]
- 18.Yang LP, Keating GM. Fenofibric acid: in combination therapy in the treatment of mixed dyslipidemia. American journal of cardiovascular drugs : drugs, devices, and other interventions. 2009;9:401–409. doi: 10.2165/11203920-000000000-00000. [DOI] [PubMed] [Google Scholar]
- 19.Muoio DM, et al. Peroxisome proliferator-activated receptor-alpha regulates fatty acid utilization in primary human skeletal muscle cells. Diabetes. 2002;51:901–909. doi: 10.2337/diabetes.51.4.901. [DOI] [PubMed] [Google Scholar]
- 20.Lee SS, et al. Targeted disruption of the alpha isoform of the peroxisome proliferator-activated receptor gene in mice results in abolishment of the pleiotropic effects of peroxisome proliferators. Molecular and cellular biology. 1995;15:3012–3022. doi: 10.1128/mcb.15.6.3012. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Flygare J, et al. Deficiency of ribosomal protein S19 in CD34+ cells generated by siRNA blocks erythroid development and mimics defects seen in Diamond-Blackfan anemia. Blood. 2005;105:4627–4634. doi: 10.1182/blood-2004-08-3115. [DOI] [PubMed] [Google Scholar]
- 22.Ebert BL, et al. An RNA interference model of RPS19 deficiency in Diamond-Blackfan anemia recapitulates defective hematopoiesis and rescue by dexamethasone: identification of dexamethasone-responsive genes by microarray. Blood. 2005;105:4620–4626. doi: 10.1182/blood-2004-08-3313. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Whyte WA, et al. Master transcription factors and mediator establish super-enhancers at key cell identity genes. Cell. 2013;153:307–319. doi: 10.1016/j.cell.2013.03.035. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Wong P, et al. Gene induction and repression during terminal erythropoiesis are mediated by distinct epigenetic changes. Blood. 2011;118:e128–138. doi: 10.1182/blood-2011-03-341404. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Langmead B, Trapnell C, Pop M, Salzberg SL. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome biology. 2009;10:R25. doi: 10.1186/gb-2009-10-3-r25. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Zhang Y, et al. Model-based analysis of ChIP-Seq (MACS) Genome biology. 2008;9:R137. doi: 10.1186/gb-2008-9-9-r137. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Heinz S, et al. Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities. Molecular cell. 2010;38:576–589. doi: 10.1016/j.molcel.2010.05.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Trapnell C, Pachter L, Salzberg SL. TopHat: discovering splice junctions with RNA-Seq. Bioinformatics. 2009;25:1105–1111. doi: 10.1093/bioinformatics/btp120. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Anders S, Huber W. Differential expression analysis for sequence count data. Genome biology. 2010;11:R106. doi: 10.1186/gb-2010-11-10-r106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Quinlan AR, Hall IM. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics. 2010;26:841–842. doi: 10.1093/bioinformatics/btq033. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.