Three New Cutinases from the Yeast Arxula adeninivorans That Are Suitable for Biotechnological Applications

Abstract

The genes ACUT1, ACUT2, and ACUT3, encoding cutinases, were selected from the genomic DNA of Arxula adeninivorans LS3. The alignment of the amino acid sequences of these cutinases with those of other cutinases or cutinase-like enzymes from different fungi showed that they all had a catalytic S-D-H triad with a conserved G-Y-S-Q-G domain. All three genes were overexpressed in A. adeninivorans using the strong constitutive TEF1 promoter. Recombinant 6× His (6h)-tagged cutinase 1 protein (p) from A. adeninivorans LS3 (Acut1-6hp), Acut2-6hp, and Acut3-6hp were produced and purified by immobilized-metal ion affinity chromatography and biochemically characterized using p-nitrophenyl butyrate as the substrate for standard activity tests. All three enzymes from A. adeninivorans were active from pH 4.5 to 6.5 and from 20 to 30°C. They were shown to be unstable under optimal reaction conditions but could be stabilized using organic solvents, such as polyethylene glycol 200 (PEG 200), isopropanol, ethanol, or acetone. PEG 200 (50%, vol/vol) was found to be the best stabilizing agent for all of the cutinases, and acetone greatly increased the half-life and enzyme activity (up to 300% for Acut3-6hp). The substrate spectra for Acut1-6hp, Acut2-6hp, and Acut3-6hp were quite similar, with the highest activity being for short-chain fatty acid esters of p-nitrophenol and glycerol. Additionally, they were found to have polycaprolactone degradation activity and cutinolytic activity against cutin from apple peel. The activity was compared with that of the 6× His-tagged cutinase from Fusarium solani f. sp. pisi (FsCut-6hp), also expressed in A. adeninivorans, as a positive control. A fed-batch cultivation of the best Acut2-6hp-producing strain, A. adeninivorans G1212/YRC102-ACUT2-6H, was performed and showed that very high activities of 1,064 U ml⁻¹ could be achieved even with a nonoptimized cultivation procedure.

INTRODUCTION

Recently, there has been increasing interest in cutinases (EC 3.1.1.74) because of their potential for industrial application (1). In nature, cutinases hydrolyze cutin, the major component of the leaf cuticles of higher plants. Cutin is a hydrophobic wax-like substance mainly containing 1- to 3-fold hydroxylated and epoxylated fatty acids (2). Cutin plays a key role in protecting the plant leaf from desiccation and protecting the leaf against plant pathogens by functioning as a barrier layer. Purdy and Kolattukudy (2) showed that the fungal plant pathogen Fusarium solani f. sp pisi produces extracellular cutinases and that this organism can use cutin as its sole carbon source. Because cutinases or cutinase-like enzymes can hydrolyze polyesters, they can be used for the degradation of natural and synthetic polymers, such as polycaprolactone (PCL), polylactic acid (PLA), polyurethane, poly(butylene succinate), poly(butylene succinate-coadipate), and poly(butylene adipate-coterephthalate) (3–7), all of which are widely used in industrial and consumer goods. They can also be used for hydrolysis reactions in the dairy industry, in household detergents, and in the oleochemical industry (1). Furthermore, they can be used for the synthesis of mono-, di-, and triglycerides (8), and under low water activities, they are able to catalyze transesterification reactions (9–13). Additionally, they can selectively esterify fatty acids with different alcohols (12, 14, 15).

Many different cutinases or cutinase-like enzymes had been investigated in recent years. The first cutinases were found in fungi of the genus Fusarium (16–20). Recently, a low-molecular-mass cutinase from the fungus Thielavia terrestris that is able to efficiently hydrolyze polyesters has been reported by Yang et al. (5). Production of cutinases or cutinase-like enzymes has also been found in bacteria, for example, Streptomyces spp. (21), Thermobifida fusca (7), and a Pseudomonas sp. (22), and in yeast, such as Cryptococcus spp. (4, 23) and Pseudozyma antarctica (6, 24). Scientific interest is now focused on acidic cutinases, which function at pH values of less than 5, because their use provides benefits over the use of existing enzymes for the enzymatic and chemical hydrolysis of polyesters under alkaline conditions (25).

The yeast Arxula adeninivorans, which is a yeast of great biotechnological interest due to its wide substrate spectrum and robustness (26), has not been reported to be a plant pathogen and is therefore not a yeast where cutinase production is expected. However, after the publication of the genome data for A. adeninivorans by Kunze et al. (27), three different genes encoding potential cutinases or cutinase-like enzymes were annotated, and these enzymes could have properties superior to those of the cutinases found in typical host organisms.

In this study, the genes for the three putative cutinases from A. adeninivorans were cloned with an additional His tag-encoding region and homologously expressed to analyze the biochemical properties of the enzymes that they encode and the ability of the enzymes to degrade cutin and biodegradable plastic. All results were compared with the properties of a His-tagged version of a cutinase encoded by a gene from the plant-pathogenic fungus Fusarium solani f. sp pisi and produced in A. adeninivorans.

MATERIALS AND METHODS

Strains and cultivation conditions.

Escherichia coli XL1-Blue MRF′ {Δ(mcrA)183 Δ(mcrCB-hsdSMR-mrr)173 endA1 supE44 thi-1 recA1 gyrA96 relA1 lac [F′ proAB lacI^qZΔM15 Tn10 (Tet^r)]}, obtained from Invitrogen (Grand Island, NY, USA), served as the host strain for bacterial transformation and plasmid isolation. The strain was grown in lysogeny (Luria) broth (LB) medium supplemented with ampicillin or kanamycin (50 mg ml⁻¹) for selection. The auxotrophic mutant A. adeninivorans G1212 (aleu2 ALEU2::atrp1) was used as the recipient strain, and wild-type strain A. adeninivorans LS3 (28) was used as the source of the genes. All strains were grown at 30°C under nonselective conditions in a complex medium (yeast extract-peptone-dextrose [YPD]) or under selective conditions in yeast minimal medium (YMM) supplemented with 2% (wt/vol) glucose as the carbon source (29, 30). Agar plates were prepared by adding 1.6% (wt/vol) agar to the liquid media.

Expression of cutinase genes.

To express the ACUT1, ACUT2, and ACUT3 genes in A. adeninivorans G1212, the open reading frame was amplified by PCR using chromosomal DNA from A. adeninivorans LS3 as the template. The primers are shown in Table 1. The gene encoding the F. solani f. sp. pisi cutinase (FSCUT) was synthesized using the GeneArt gene synthesis tool with optimized codon usage. All genes were then flanked with restriction sites and a sequence encoding a 6× histidine (6h) tag on the 3′ end by PCR using the primers shown in Table 1. The amplified gene fragments were inserted into the plasmid pBS-TEF1-PHO5-SS (flanked by SpeI and SacII restriction sites) between the A. adeninivorans-derived TEF1 promoter and the Saccharomyces cerevisiae-derived PHO5 terminator. After restriction of the resulting pBS-TEF1-ACUT1-(6H)-PHO5-SS, pBS-TEF1-ACUT2-(6H)-PHO5-SS, pBS-TEF1-ACUT3-(6H)-PHO5-SS, and pBS-TEF1-FSCUT-(6H)-PHO5-SS plasmids with SpeI-SacII, the fragments were cloned into the Xplor2 vector of the Xplor2 transformation/expression platform containing auxotrophic marker ATRP1m (31). Linearization with AscI produced fragments that were flanked by 25S ribosomal DNA (rDNA) sequences (yeast rDNA integrative cassettes [YRCs]) for homologous recombination or SbfI sequences (yeast integrative cassettes [YICs]) for nonhomologous integration. The fragments were transferred to competent A. adeninivorans G1212 cells as described by Dohmen et al. (32), resulting in the final strains indicated in Table 1. The transformants were cultivated in 24-well deep-well plates (Brand, Germany) containing 2.5 ml YMM supplemented with 2% (wt/vol) glucose as the carbon source per each well at 30°C and 180 rpm. The supernatant was collected and screened for esterase activity with p-nitrophenyl butyrate (pNPB) as the substrate, and the best transformants were selected for further analysis. For each cutinase, the highest-performing transformants were then cultivated in 500 ml YMM with 2% glucose at 30°C and 180 rpm to obtain supernatants for immobilized-metal ion affinity chromatography (IMAC) purification.

TABLE 1.

Primers for gene amplification by PCR and the resulting strains expressing ACUT1, ACUT2, ACUT3, and FSCUT in A. adeninivorans G1212^a

Gene and orientation	Primer sequencea	Description and strains
ACUT1b
Forward	GCGCGAATTCATGAAGACTAACTTCCTCATCGCCTG	Linearization with AscI, A. adeninivorans G1212/YRC102-ACUT1 and A. adeninivorans G1212/YRC102-ACUT1-6H
Reverse	GCGCGGATCCTTAGCTAGAACCGGTCAGGGCCTTGA	Linearization with SbfI, A. adeninivorans G1212/YIC102-ACUT1 and A. adeninivorans G1212/YIC102-ACUT1-6H
Reverse-6h	GCGCGGATCCTTAGTGGTGGTGATGATGGTGGCTAGAACCGGTCAGGGCCTTGA
ACUT2b
Forward	GCGCGAATTCATGAAGGCCAATCTGATTCTCGCTTG	Linearization with AscI, A. adeninivorans G1212/YRC102-ACUT2 and A. adeninivorans G1212/YRC102-ACUT2-6H
Reverse	GCGCGGATCCCTAAGAAGTAAGAGCCTTGACTACAAAG	Linearization with SbfI, A. adeninivorans G1212/YIC102-ACUT2 and A. adeninivorans G1212/YIC102-ACUT2-6H
Reverse-6h	GCGCGGATCCCTAGTGGTGGTGATGATGGTGAGAAGTAAGAGCCTTGACTACAAAG
ACUT3c
Forward	GCGCAGATCTATGAAGTACAGTGCCATTTACACTCTTGC	Linearization with AscI, A. adeninivorans G1212/YRC102-ACUT3 and A. adeninivorans G1212/YRC102-ACUT3-6H
Reverse	GCGCGCGGCCGCTTAAGCGGAACCGGAACCGAAGCCAG	Linearization with SbfI, A. adeninivorans G1212/YIC102-ACUT3 and A. adeninivorans G1212/YIC102-ACUT3-6H
Reverse-6H	GCGCGCGGCCGCTTAGTGGTGGTGATGATGGTGAGCGGAACCGGAACCGAAGCCAG
FSCUTb
Forward	GCGCGAATTCATGAAGTTCTTCGCTCTGACTACTCTGCTGGCTGC	Linearization with AscI, A. adeninivorans G1212/YRC102-FSCUT and A. adeninivorans G1212/YRC102-FSCUT-6H
Reverse	GCGCGGATCCCTAAGCAGATCCTCGGACAGCTCGGACCTTCTCAATCAGG	Linearization with SbfI, A. adeninivorans G1212/YIC102-FSCUT and A. adeninivorans G1212/YIC102-FSCUT-6H
Reverse-6H	GCGCGGATCCCTAGTGGTGGTGATGATGGTGAGCAGATCCTCGGACAGCTCGGACCTTCTCAATCAGG

^aRestriction sites used for cloning of the fragments and the 6× histidine-encoding sequences are in bold.

^bThe restriction site in the forward primer was EcoRI, and that in the reverse primer was BamHI.

^cThe restriction site in the forward primer was BglII, and that in the reverse primer was NotI.

Southern blot analysis was performed to determine the integration number of the ACUT2-6H inserts in A. adeninivorans G1212/YRC102-ACUT2-6H. Overnight cultures (2 ml) of A. adeninivorans G1212/YRC102-ACUT2-6H and G1212/YRC102 (a negative control) in yeast extract-peptone-glucose medium were centrifuged, and a ball mill (MM 200; Retsch, Germany) with silica beads was used to rupture the cells. Extraction of genomic DNA and alkaline Southern transfer to a Hybond-N+ membrane (GE Healthcare, Germany) were performed as described by Sambrook and Russell (33). Genomic DNA (10 μg) was digested overnight with HindIII and subsequently separated on a 0.8% agarose gel. Hybridization was carried out at 65°C using Roti-Hybri-Quick buffer (Roth, Germany) and a digoxigenin-labeled probe for the ACUT2-6H gene, produced via PCR with gene-specific primers (Table 1) and digoxigenin-11-dUTPs (Roche, Germany). After three washing steps with 1:2, 1:5, and 1:10 dilutions of Roti-Hybri-Quick buffer for 15 min each time, the membrane was stained with Fab fragments from polyclonal antidigoxigenin antibodies conjugated to alkaline phosphatase (Roche, Germany).

Fed-batch fermentation.

In order to accumulate high levels of recombinant protein under controlled conditions, fed-batch fermentation was carried out in a 5-liter bioreactor (Sartorius, Germany) with the strain A. adeninivorans G1212/YRC102-ACUT2-6H. Cultivation was started with 200 ml of an overnight seed culture in batch mode in 3 liters of YPD medium containing 2% glucose, pH 5, with a 40% oxygen partial pressure (pO₂) at 30°C. The pH was maintained using a 12.5% ammonia and 40% phosphoric acid solution. When the glucose concentration dropped to 1.5 g liter⁻¹, the feeding phase with a nutrient medium based on YMM (30) containing 5 g liter⁻¹ (NH₄)H₂PO₄ as a nitrogen source and 70% glucose was initiated. The initial flow rate was 15 ml h⁻¹, giving an average rate of glucose addition of 3.5 g liter⁻¹ h⁻¹. This was increased to 30 ml h⁻¹ at 60 h (5.8 g liter⁻¹ h⁻¹) and 60 ml h⁻¹ at 80 h (7.5 g liter⁻¹ h⁻¹) because of the increasing cell mass. Samples were taken at regular intervals during growth and analyzed for enzymatic activity, overall protein concentration, dry cell weight (dcw), and glucose concentration. The dcw was quantified by pelleting cells from 4 ml of sample by centrifugation. The pellet was washed three times with distilled water and dried until a constant weight was achieved. Glucose was the sole carbon source in the bioreactor, and its concentration was monitored using the 3,5-dinitrosalicylic acid (DNSA) assay for the determination of reducing sugars according to the method of Miller (34). The protein concentration was determined using the dye-binding method of Bradford (35) with bovine serum albumin as the standard.

Enzyme purification via IMAC.

Recombinant 6× His (6h)-tagged cutinase 1 protein (p) from A. adeninivorans LS3 (Acut1-6hp), Acut2-6hp, Acut3-6hp, and 6× His-tagged F. solani f. sp. pisi cutinase (FsCut-6hp) were purified by IMAC using Ni-nitrilotriacetic acid agarose as the column material. The transgenic A. adeninivorans strains were incubated as described above, and cell-free supernatant was obtained by centrifugation of the culture at 10,000 × g for 10 min. The cell-free supernatant was mixed with the same volume of binding buffer containing 500 mM NaCl, 5 mM imidazole, and 20 mM Tris-HCl, pH 7.9. The mixture was loaded onto a self-packed column and washed through with binding buffer. A second washing step was performed with washing buffer with 60 mM imidazole, before a three-step elution with elution buffer (500 mM imidazole). Imidazole was removed from the elution fractions using PD10 columns (GE Healthcare, United Kingdom) and 1× phosphate-buffered saline (PBS). The purified enzyme was stored on ice in 1× PBS at pH 7.4.

Enzymatic assay.

The standard assay for determining overall esterase activity was performed as described by Kolattukudy et al. (36) with pNPB (Sigma-Aldrich, Germany) as the substrate. The reaction mixture (100 μl) contained 50 mM sodium citrate buffer, pH 5.5, for cutinase 1 from A. adeninivorans LS3 (Acut1p), Acut2p, and Acut3p and 50 mM Tris-HCl, pH 8.0, for F. solani f. sp. pisi cutinase (FsCutp). Triton X-100 (0.5% vol/vol), 0.1% (wt/vol) gum arabic, 2 mM pNPB, and 10 μl of a suitably diluted sample were added to each reaction mixture. The formation of p-nitrophenol over time at 25°C was followed with a spectrophotometer (Tecan Infinite, Germany) at 348 nm, which is the isosbestic point of p-nitrophenol and p-nitrophenolate. Absolute activity was then calculated by linear regression of the activity over the first 2 min of the reaction and quantified using p-nitrophenol (Sigma-Aldrich, Germany), which has a molar extinction coefficient of 4,320 M⁻¹ cm⁻¹, as the standard. A reaction mixture with water instead of enzyme was used as the negative control. The activity of the control was subtracted from the activity of the sample to obtain the overall value of the enzymatic activity. One unit of activity was defined as the amount of enzyme that released 1 μmol of p-nitrophenol per minute under the conditions determined for each enzyme. The protein concentration was determined by the Bradford assay (35) using a prepared Bradford solution provided by Bio-Rad (USA). Bovine serum albumin served as the protein standard for quantification.

Measurement of enzyme activity with different p-nitrophenyl (pNP) esters was done in the same way described above using pNP-acetate (C₂), -butyrate (C₄), -caproate (C₆), -caprylate (C₈), -caprate (C₁₀), -laurate (C₁₂), and -palmitate (C₁₆) at a concentration of 10 mM each. The substrate mixture was emulsified with an Ultra-Turrax homogenizer, and the activity for triglycerides was measured using the titration method described by Kleeberg et al. (7). Relative activity was calculated from the amount of sodium hydroxide used to maintain the pH at 5.5 for Acut1-6hp, Acut2-6hp, and Acut3-6hp and pH 8.0 for FsCut-6hp. All enzyme assays were performed in triplicate, and the activities shown are averages of the values from three independent experiments.

Effect of pH and temperature on enzyme activity and stability of cutinases.

To determine the effect of pH on enzyme activity, the standard enzymatic assay was repeated, but buffers of different pHs were used. The pH of the 50 mM sodium acetate buffer ranged from pH 3.0 to 6.0, that of the 50 mM sodium citrate buffer ranged from pH 3.0 to 6.5, that of the 50 mM sodium phosphate buffer ranged from pH 5.5 to 7.5, and that of the 50 mM Tris-HCl buffer ranged from pH 7.5 to 9.0. The ionic strength was adjusted to 300 mM by adding an appropriate amount of NaCl to the reaction mixture. A reaction mixture with water instead of enzyme, i.e., a negative control, was used to check for the hydrolysis of pNPB at the various pH values. Activity was then calculated as described above. All measurements were done in triplicate. The same buffers were used for the pH stability test by incubating the enzymes at several pH values. Residual activity was measured after 10, 60, 120, and 240 min with pNPB as the substrate.

The effect of temperature on enzymatic activity was tested by performing the activity test at temperatures ranging from 20 to 90°C in a PCR thermocycler (Eppendorf, Germany). After 5 min of incubation, the reaction was stopped by adding 100 μl of 3% acetic acid. The mixture was then transferred to a 96-well microplate for measurement of the absorbance at 348 nm. Activity was calculated using the difference in absorbance between the samples containing enzyme and the negative control. Temperature stability was assessed by incubating the purified enzyme at 0 (on ice), 30, 40, 50, 60, 70, 80, and 90°C for 10, 60, 120, and 240 min. Residual activity was measured by the standard assay.

Influence of metal ions, cofactors, and organic solvents on enzyme activity.

The influence of different cofactors on enzyme activity was tested with pNPB as the substrate by adding to the activity assay mixture CaCl₂, CoCl₂, CoSO₄, CuCl₂, CuSO₄, FeCl₃, FeSO₄, KCl, MgCl₂, MgSO₄, MnCl₂, MnSO₄, NiCl₂, NiSO₄, ZnCl₃, ZnSO₄, and dithiothreitol (DTT) to a final concentration of 1 mM each. The mixture was incubated for 10 min on ice before measurement of the activities. The activities were compared with the activity of the enzyme without addition of cofactors and with addition of 1 mM EDTA.

An assay to investigate the ionic strength stability of Acut1-6hp, Acut2-6hp, and Acut3-6hp was performed in sodium citrate buffer (pH 5.5) at ionic strengths ranging from 200 to 1,000 mM. Tris-HCl (pH 8.0) was used as the buffer for FsCut-6hp.

The influence of organic solvents was tested by incubating purified Acut1-6hp, Acut2-6hp, Acut3-6hp, and FsCut-6hp with 50% (vol/vol) polyethylene glycol 200 (PEG 200), diethylene glycol (DEG), isopropanol, dimethyl sulfoxide (DMSO), ethanol, and acetone in sodium citrate buffer (pH 5.5) and Tris-HCl (pH 8.0). Residual activity with pNPB as the substrate was measured after 10, 60, and 120 min and 24 h. The concentration of solvent during the measurement was maintained at 25% (vol/vol). Additionally, the influence of PEG 200 on enzyme stability at temperatures ranging from 4 to 25°C was tested with Acut2p and Acut3p.

SDS-PAGE and molecular mass determination.

A check of the purity of the recombinant enzymes was carried out using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) with a 15% separation gel and a 4% stacking gel as described by Laemmli (37). Fifteen microliters of each elution fraction was loaded on the gel, and a PageRuler prestained protein ladder (Thermo Scientific, Germany) was used as a molecular mass marker. Western blotting was performed after separation of the proteins on the gel by electrotransfer to a polyvinylidene difluoride membrane. The blots were stained with solutions containing 200 ng ml⁻¹ anti-6× His-tagged antibody from rabbit (Micromol, Germany) and 125 ng ml⁻¹ alkaline phosphatase-conjugated anti-rabbit immunoglobulin antibody from goat (Promega, Germany) using nitroblue tetrazolium–5-bromo-4-chloro-3-indolylphosphate (NBT-BCIP) as the substrate for alkaline phosphatase conjugated with a secondary antibody.

Determination of the native molecular mass was carried out by size exclusion chromatography (SEC) using a Superdex200 column (1 cm by 50 cm) and 100 mM sodium citrate buffer (pH 6.0) with 150 mM NaCl at a flow rate of 1 ml min⁻¹. A mixture of ferritin (450 kDa), catalase (240 kDa), alcohol dehydrogenase from S. cerevisiae (150 kDa), bovine serum albumin (66 kDa), and ovalbumin (45 kDa) served as the molecular mass standard.

Preparation of cutin from apple peels.

Cutin was extracted from ‘Golden Delicious’ apples obtained from a local supermarket, using the method described by Walton and Kolattukudy (38).

Cellulase TXL and pectinase L 40 preparations (ASA Spezialenzyme GmbH, Germany) in 100 mM sodium citrate buffer (pH 4.5) at 50°C were used to release the cutin.

Preparation of turbid agar plates with PCL for enzyme activity test.

Turbid agar plates containing PCL (Sigma-Aldrich, Germany) were prepared as described by Murphy et al. (16). PCL (1% in acetone stock solution) was prepared and added to 1 liter of 100 mM sodium citrate buffer (pH 5.5) or 100 mM Tris-HCl (pH 8.0), both of which contained 20 g liter⁻¹ of agar, to give a final PCL concentration of 0.05%. After gentle shaking, the mixture was poured into petri dishes and allowed to solidify. Evaluation of enzymatic activity was performed by observing the formation of clear zones around the application spots.

Thin-layer chromatography.

The hydrolysis products released from apple cutin by the enzymatic actions of Acut1-6hp, Acut2-6hp, Acut3-6hp, and FsCut-6hp were analyzed by thin-layer chromatography (TLC) as described by Davies et al. (39). Apple cutin (30 mg ml⁻¹) was incubated for 48 h in Falcon tubes with 10 ml of 20 mM sodium citrate buffer (pH 5.5) containing Acut1-6hp (11 U), Acut2-6hp (635 U), or Acut3-6hp (110 U) at 25°C. The apple cutin preparation was also incubated for 48 h in 20 mM Tris-HCl (pH 8.0) with 15 U FsCut-6hp at 40°C as a positive control. The mixture without an enzyme served as the negative control. After acidification with HCl, the free fatty acids were extracted with chloroform, and 500 μl was transferred to a Polygram SIL G/UV₂₅₄ 0.2-mm TLC plate (Macherey-Nagel, Germany). A mixture of diethyl ether–n-hexane–methanol (8:2:1) was used as the eluent. The spots were visualized with acetone-sulfuric acid (20:1) containing 1.6% potassium permanganate.

Nucleotide sequence accession numbers.

The ACUT1, ACUT2, and ACUT3 genes of A. adeninivorans G1212 have been submitted to GenBank and may be found under accession numbers LN828946, LN828947, and LN828948, respectively.

RESULTS

Sequence analysis of Acut1, Acut2, and Acut3.

A comparison of the amino acid sequences of the different cutinases of fungi and yeast with those of cutinases from A. adeninivorans showed similarities at several positions. The alignment is shown in Fig. 1. The same G-Y-S-Q-G motif (positions 199 to 203), aspartic acid (position 281), and histidine (position 296) forming the catalytic triad of these cutinases appeared in all three cutinases from A. adeninivorans, making them serine hydrolases. Furthermore, there are 4 cysteine residues at positions 109, 194, 277, and 287 which may form two characteristic disulfide bonds indicating the α/β structure of esterase proteins. Additionally, there was an 18-amino-acid long secretion signal in Acut1p, Acut2p, and Acut3p according to the SignalP (version 4.1) program (http://www.cbs.dtu.dk/services/SignalP/).

FIG 1.

Alignment of partial amino acid sequences of Acut1p (GenBank accession number CFW93879.1), Acut2p (GenBank accession number CFW93880.1), and Acut3p (GenBank accession number CFW93881.1) with the amino acid sequences of other cutinases. Abbreviations: FsCutp, Fusarium solani f. sp. pisi cutinase (GenBank accession number P00590); ScScut, Sclerotinia sclerotiorum cutinase (UniProt accession number A7EQQ8); SCcut, Sirococcus conigenus cutinase (UniProt accession number S4VCH4); Mfcut, Monilinia fructicola cutinase (GenBank accession number Q8TGB8); TaCut, Trichosporon asahii var. asahii CBS 8904 cutinase (UniProt accession number K1WEK5); TaCut2, Trichosporon asahii var. asahii CBS 2479 cutinase (UniProt accession number J6F6C1); PaCle, Pseudozyma antarctica cutinase-like enzyme (UniProt accession number A0A081CFK4); CaCut, Coniosporium apollinis cutinase (UniProt accession number R7YN00); PhCut, Pseudozyma hubeiensis cutinase (UniProt accession number R9PBF8); Ccle, Cryptococcus sp. strain S-2 cutinase-like enzyme (GenBank accession number Q874E9). Amino acids which belong to the catalytic triad are indicated by a black background (+), and cysteine residues forming disulfide bridges are indicated with a gray background (*). The number in parentheses describes the starting amino acid position of each protein in each line.

Expression of ACUT1, ACUT2, ACUT3, and FSCUT genes in A. adeninivorans and purification of recombinant Acut1-6hp, Acut2-6hp, Acut3-6hp, and FsCut-6hp.

As described above, untagged and 6× His-tagged variants of each cutinase gene were produced with A. adeninivorans G1212. The specific activities measured in the supernatants of cultures provided for IMAC purification are shown in Table 2 and ranged from 497.4 U mg⁻¹ for Acut2-6hp to 23.4 U mg⁻¹ for Acut1-6hp. Only minor activity of 0.34 U mg⁻¹ could be measured in the supernatant of control strain A. adeninivorans G1212/YRC102; i.e., strain G1212 transformed with the selection marker module only. SDS-PAGE analysis (Fig. 2) of the elution fractions showed that all His-tagged cutinases could be purified to virtual homogeneity, with the specific activities related to protein concentrations being 66.1 U mg⁻¹ (Acut1-6hp), 1,747.8 (Acut2-6hp), 1,251.6 U mg⁻¹ (Acut3-6hp), and 251.7 U mg⁻¹ (FsCut-6hp). The nontagged variants were cultivated and tested in the same way. The presence of the His tag did not influence the esterase activities of Acut1p, Acut2p, Acut3p, and FsCutp.

TABLE 2.

Purification of Acut1-6hp, Acut2-6hp, Acut3-6hp, and FsCut-6hp produced by A. adeninivorans G1212/YRC102-ACUT1-6H, G1212/YRC102-ACUT2-6H, G1212/YRC102-ACUT3-6H, and G1212/YRC102-FSCUT-6H via IMAC^a

Enzyme	Total activity (U)		Sp act (U mg−1)		Purification factor (fold)	Yieldb (%)
	Culture supernatant	Elution fraction	Culture supernatant	Elution fraction
Acut1-6hp	220.1	10.6	23.4	66.1	2.8	4.8
Acut2-6hp	11,891.6	3,815	497.4	1,747.8	3.5	32.1
Acut3-6hp	5,870.8	660.2	230.9	1,251.6	5.4	11.3
FsCut-6hp	927.9	92.6	87.8	251.7	2.9	10
Negative controlc	5		0.34

^aEnzyme activity was determined at 25°C in 50 mM sodium citrate buffer (pH 5.5) for Acut1-6hp, Acut2-6hp, and Acut3-6hp and in 50 mM Tris-HCl (pH 8.0) for FsCut-6hp.

^bThe yield means the ratio of the residual enzyme activity to the initial total enzyme activity as a percentage.

^cA. adeninivorans G1212/YRC102 transformed with a selection marker module served as the negative control.

FIG 2.

SDS-PAGE (A) and Western blot (B) analysis of elution fractions after IMAC purification of Acut3-6hp (lanes 1), Acut1-6hp (lanes 2), Acut2-6hp (lanes 3), and FsCut-6hp (lanes 4). The Western blot was stained with an anti-6× His antibody from rabbit and an anti-rabbit immunoglobulin antibody from goat using NBT/BCIP as the substrate for alkaline phosphatase conjugated with secondary antibody.

Bioreactor cultivation for large-scale production of Acut2-6hp.

A fed-batch cultivation was performed with A. adeninivorans G1212/YRC102-ACUT2-6H, which had the highest esterase activity during screening of all Acut2-6hp-producing strains. Southern blot analysis showed that it has 3 integrations of the ACUT2-6H gene. The cultivation was started under aerobic conditions in batch mode (3 liters) with YPD medium, and the culture was fed with 2 liters of YMM (as described in Materials and Methods) containing 70% glucose, 12.5% ammonium as a nitrogen source, and 40% phosphoric acid to maintain the pH at 6.0. The temperature was maintained at 30°C with a constant oxygen partial pressure (pO₂) of 40%. The changes in dcw, cutinase activity, protein concentration, and glucose level during the cultivation are shown in Fig. 3. The flow rate of the feed medium was increased, because of the increasing dcw, from 15 to 30 ml h⁻¹ and then to 60 ml h⁻¹ after 24, 60, and 80 h, respectively. After the flow rate was set to 60 ml h⁻¹, there was an accumulation of glucose in the culture broth, indicating that this flow rate was too high. After the volume limit of 5 liters was reached, the residual glucose was then utilized without further increases in dcw or the enzyme concentration. An overall dcw of 64.5 g liter⁻¹ and an enzyme activity of 1,064 U ml⁻¹ were reached at the end of growth, resulting in yields of 16,496 U (g dcw)⁻¹ and 732.3 U (g of glucose)⁻¹ and a productivity of 5.1 U (g of glucose)⁻¹ h⁻¹. The results of SDS-PAGE and Western blot analysis, shown in Fig. 3, indicate the accumulation of Acut2-6hp over the period of the incubation. After 24 h, more than 50% of the total protein in the supernatant was Acut2-6hp. The percentage decreased after the start of the feeding phase due to the high levels of secretion of other proteins.

FIG 3.

Fed-batch cultivation of A. adeninivorans G1212/YRC102-ACUT2-6H in the bioreactor with YPD as the starting medium and YMM with 70% glucose as the feed. (A) Time course of dcw (filled circles), glucose concentration (filled squares), enzyme activity (empty diamonds), pO₂ (empty circles), and volume of ammonia (filled triangles). (B) Coomassie-stained SDS-polyacrylamide gel. (C) Western blot stained with an anti-6× His antibody from rabbit and anti-rabbit immunoglobulin antibody from goat using NBT-BCIP as the substrate for alkaline phosphatase conjugated with secondary antibody.

Biochemical properties of Acut1-6hp, Acut2-6hp, and Acut3-6hp.

The biochemical properties of Acut1-6hp, Acut2-6hp, Acut3-6hp, and FsCut-6hp are shown in Table 3. The pH optima for Acut1-6hp, Acut2-6hp, and Acut3-6hp were determined to be 5.0, 5.0, and 5.5, respectively, and the pH ranges where at least 80% of the activity occurred were from 4.5 to 6.0 for Acut1-6hp, from 4.0 to 6.0 Acut2-6hp, and from 4.5 to 6.5 for Acut3-6hp. For FsCut-6hp, the optimum was determined to be pH 8.0, and the functional range was from 6.5 to 9.0 (Fig. 4). Enzyme stability is also affected by the pH value. Figure 4 shows the loss of enzyme activity of Acut3-6hp from 10 to 240 min at pH values ranging from 3 to 9. The highest activity loss can be found in sodium citrate buffer at pH 5 from 10 to 60 min, whereas the highest stability for the enzyme was in sodium phosphate buffer at pH 7. Similar effects occurred for Acut1-6hp and Acut2-6hp (Table 3).

TABLE 3.

Biochemical properties of Acut1-6hp, Acut2-6hp, Acut3-6hp, and FsCut-6hp^a

Enzyme	Molecular mass (kDa)		Optimum (range) pHc	Optimum (ranged) temp (°C)	Temp (°C) stability (duration [h])	Km (mM) for pNPB
	Amino acid sequenceb	Size exclusion chromatography
Acut1-6hp	21.6	21.3	5.0 (4.5–6.0)	20 (20–35)	25 (2)	1.60
Acut2-6hp	21.6	21.3	5.0 (4.0–6.0)	30 (20–45)	40 (2)	1.46
Acut3-6hp	29.2	59.7	5.5 (4.5–6.5)	30 (20–45)	50 (4)	1.93
FsCut-6hp	20.7e	21.3	8.0 (6.5–9.0)	45 (35–55)	40 (2)	1.06

^aCofactors had no effect on activity.

^bMolecular mass was calculated from the amino acid sequence without a secretion signal or a histidine tag.

^cThe pH was not stable under optimum conditions (a 50% loss of activity after 2 h). The range refers to the range of pHs where at least 80% of the activity occurred.

^dThe range refers to the range of temperatures where at least 80% of the activity occurred.

^eThe sequence was obtained from UniProt using the feature identifier PRO_0000006440 from the entry of F. solani f. sp. pisi cutinase (GenBank accession number P00590).

FIG 4.

(A) Effect of pH on the activity of Acut3-6hp (solid line), Acut1-6hp (medium dash), Acut2-6hp (short dash), and FsCut-6hp (long dash). The optimal pH was determined at 25°C using pNPB as the substrate in 50 mM sodium citrate buffer (pH 3.0 to 6.5; diamonds), sodium phosphate buffer (pH 5.5 to 7.5; circles), and Tris-HCl (pH 7.5 to 9.0; squares). Open and filled symbols are used to distinguish between the different overlapping graphs. (B) Effect of pH on the stability of Acut3-6hp. The residual activity was measured at 25°C after incubation of Acut3-6hp for 10 min (filled circles), 60 min (empty circles), 120 min (filled triangles), and 240 min (empty triangles) on ice in 50 mM sodium citrate buffer (pH 3.0 to 6.0), sodium phosphate buffer (pH 7.0), and Tris-HCl (pH 8.0 and 9.0).

The temperature optimum of Acut1-6hp, Acut2-6hp, and Acut3-6hp was found to lie between 20 and 30°C (Fig. 5). The temperature range where 80% of the activity occurred was from 20 to 45°C for Acut2-6hp and Acut3-6hp and 20 to 35°C for Acut1-6hp. FsCut-6hp was most active between 35 and 55°C, with the highest activity being at 45°C. Additionally, the temperature stability was determined and is shown in Fig. 5. Acut3-6hp was stable at 50°C for a minimum of 4 h, whereas Acut1-6hp and Acut2-6hp were stable at 25 and 30°C, respectively, for up to 2 h. Interestingly, after 240 min at 90°C, there was a residual activity of 13%, 3%, and 11% for Acut1-6hp, Acut2-6hp, and Acut3-6hp, respectively.

FIG 5.

Effect of temperature on the activity (A) and stability (B) of Acut1-6hp (empty circles), Acut2-6hp (filled triangles), Acut3-6hp (filled circles), and FsCut-6hp (empty triangles). The temperature optimum was determined using pNPB as the substrate in sodium citrate (pH 5.5) for Acut1-6hp, Acut2-6hp, and Acut3-6hp or Tris-HCl (pH 8.0) for FsCut-6hp at various temperatures ranging from 20 to 80°C. Residual activity was measured after incubating the enzymes at temperatures ranging from 0 to 90°C for 10, 60, 120, and 240 min (the residual activity after 240 min is shown in the figure).

The influence of different cofactors was investigated by adding 1 mM (each) CaCl₂, CoCl₂, CoSO₄, CuCl₂, CuSO₄, FeCl₃, FeSO₄, KCl, MgCl₂, MgSO₄, MnCl₂, MnSO₄, NiCl₂, NiSO₄, ZnCl₃, ZnSO₄, and DTT to the activity assay. No difference in the activity of Acut1-6hp, Acut2-6hp, Acut3-6hp, and FsCut-6hp in comparison to that in the reactions with EDTA and the control reactions could be detected. A difference in activity was not seen when the ionic strength was increased from 200 mM to 1 M (data not shown).

The substrate profiles of the four enzymes were investigated with pNP esters and triglycerides with acyl chain lengths ranging from C₂ to C₁₈. The highest activity for all cutinases was found with C₄ and C₆ substrates, which is common for cutinases in general (Table 4). The kinetic parameters for p-nitrophenyl butyrate (C₄) can be found in Table 3. The K_m values were similar for FsCut-6hp (1.0 mM) and Acut3-6hp (1.9 mM). However, some other differences between the four cutinases were apparent. Acut1-6hp and Acut2-6hp seemed to have higher activity with pNP-caproate, whereas Acut3-6hp and FsCut-6hp had higher activity with pNPB. However, for the hydrolysis of triglycerides, all four enzymes had similar activity profiles. All had the highest activity with tributyrin as the substrate (Table 4), while negligible activity was detected for the hydrolysis of C₁₀ to C₁₈ triglycerides.

TABLE 4.

Substrate specificity of Acut1-6hp, Acut2-6hp, Acut3-6hp, and FsCut-6hp produced with A. adeninivorans^a

Substrate	Relative activity (%)
	Acut1-6hp	Acut2-6hp	Acut3-6hp	FsCut-6hp
pNP esters
pNP-acetate	4.6 ± 1.7	8.8 ± 1.6	7.6 ± 1.0	31.9 ± 1.1
pNP-butyrate	100.0 ± 16.5	100 ± 9.5	100.0 ± 6.7	100 ± 14.6
pNP-caproate	144.6 ± 26.6	130.5 ± 26.4	63.5 ± 7.6	22.1 ± 2.4
pNP-caprylate	32.0 ± 0.6	67.5 ± 19.2	13.5 ± 0.8	5.9 ± 2.4
pNP-caprate	26.2 ± 5.7	43.6 ± 29.4	0.9 ± 2.4	2.5 ± 0.1
pNP-laurate	5.8 ± 4.7	22.4 ± 14.7	0.5 ± 1.8	1.9 ± 2.1
pNP-palmitate	2.7 ± 1.9	21.0 ± 1.7	0.2 ± 0.8	0.2 ± 0.0
Triglycerides
Triacetin	0.0	11.1	7.3	16.1
Tributyrin	100.0	100.0	100.0	100.0
Tricaproin	77.9	90.3	47.1	25.0
Tricaprylin	13.8	71.8	2.1	2.7
Tricaprin	4.5	8.3	0.4	4.5
Trilaurin	0.0	3.1	0.1	0.0
Trimyristin	0.0	3.2	0.0	4.5
Tripalmitin	5.2	7.0	1.2	15.2
Triolein	0.0	3.2	0.0	0.0

^aEnzyme activity was determined at 25°C in 50 mM sodium citrate buffer (pH 5.5) for Acut3-6hp, Acut1-6hp, and Acut2-6hp and in 50 mM Tris-HCl (pH 8.0) for FsCut-6hp. In both cases the reaction mixture contained 0.5% (vol/vol) Triton X-100 and 0.1% (wt/vol) arabic gum and each substrate at a concentration of 2 mM for the pNP esters and 10 mM for the triglycerides. Triglyceride activity was quantified using a titration method.

The effects of different additives, such as polymers and organic solvents, on the activity and stability of the four enzymes are shown in Fig. 6. In general, the addition of PEG 200 and DEG had a stabilizing effect and increased the enzymatic activity for Acut1-6hp (122% and 123%, respectively), Acut2-6hp (183% and 161%, respectively), and Acut3-6hp (190% and 186%, respectively) in comparison to the control with water instead of organic solvents. Furthermore, acetone stabilized these cutinases, and there was a remarkable increase in the activity of Acut3-6hp to 290% when it was incubated with acetone. In contrast, the activity of FsCut-6hp decreased to 23% when acetone was added, and isopropanol decreased the activity of Acut1-6hp, Acut2-6hp, Acut3-6hp, and FsCut-6hp 5-fold. Ethanol caused a small decrease in the activity of Acut3-6hp to 87%, and it had a slightly greater effect on Acut2-6hp, which was reduced to 77%, and decreased the activity of Acut1-6hp and FsCut-6hp to 52 and 23%, respectively. The effect of DMSO was different for each enzyme, and only Acut1-6hp was stabilized with DMSO. With DMSO, the activity of Acut1-6hp, Acut2-6hp, and Acut3-6hp was increased after 10 min incubation to 111, 117, and 173%, respectively, while FsCut-6hp showed a decrease in activity to 68% after 10 min of incubation, which then dropped further to 25% activity after 24 h of incubation. After 60 min of incubation, the activity of Acut3-6hp with DMSO dropped to 87%, and at 24 h it was further reduced to 48%. The same effect was demonstrated for Acut2-6hp, which decreased to 24% at 24 h. The stabilizing effect of PEG 200 was further investigated in combination with pH and temperature stability. As already stated, Acut1-6hp, Acut2-6hp, and Acut3-6hp were not stable at optimal pH values but were stabilized with 50% PEG 200 in sodium citrate buffer (pH 5.5) at various temperatures ranging from 4 to 25°C. Samples were taken and analyzed for residual activity after 10, 60, 120, and 240 min. For both enzymes, the activity decreased rapidly from 100% after 10 min to about 5% (Acut3-6hp) and practically 0% (Acut2-6hp) after 240 min at each temperature. However, when incubated with PEG 200, the activity of Acut2-6hp and Acut3-6hp was stable over the whole period of time (Fig. 7), and activity remained at 100% at all temperatures for more than 24 h (data not shown).

FIG 6.

Effect of PEG 200, DEG, isopropanol, ethanol, and acetone on the activity of Acut1-6hp (A), Acut2-6hp (B), Acut3-6hp (C), and FsCut-6hp (D). The residual activity obtained with pNPB as the substrate was measured after 10, 60, and 120 min and 24 h of incubation with 50% (vol/vol) each solvent in sodium citrate buffer at pH 5.5 for Acut1-6hp, Acut2-6hp, and Acut3-6hp and Tris-HCl at pH 8.0 for FsCut-6hp. The effect was compared with that obtained with a mixture containing water instead of solvent.

FIG 7.

Effect of PEG 200 on the stability of Acut2-6hp (A) and Acut3-6hp (B). Residual activity was measured after 10, 60, 120, and 240 min of incubation with 50% (vol/vol) PEG 200 in sodium citrate buffer (pH 5.5) using pNPB as the substrate at various temperatures ranging from 4 to 25°C. The effect was compared with that obtained with a mixture containing water instead of PEG 200.

Degradation of cutin and PCL.

To investigate whether Acut1-6hp, Acut2-6hp, and Acut3-6hp act in a manner similar to that of cutinase from F. solani f. sp. pisi, cutin from apple peels and PCL was used as a substrate for enzymatic degradation. The enzymatic activity in the PCL plate assay was visualized as a clear zone surrounding the enzyme (Fig. 8). The clear zone increased in size over 24 h with all four enzymes (Acut1-6hp at 1 U, Acut2-6hp at 1 U, Acut3-6hp at 3 U, and FsCut-6hp at 1 U), and no clear zone was detected in the negative control (1× PBS buffer, pH 5.5 and 8.0) (not shown). Degradation of apple cutin was analyzed by TLC, as described above. Figure 9 shows the separated hydrolysis products released by the enzymatic action of Acut1-6hp, Acut2-6hp, Acut3-6hp, and FsCut-6hp on cutin, with three different spots being seen in each enzyme lane (lanes 1, 3, 4, and 5). However, no products were visible in lanes 2 and 6 (negative controls without cutinase). A comparison of the hydrolysis patterns from Acut1-6hp, Acut2-6hp, and Acut3-6hp with the hydrolysis pattern from FsCut-6hp revealed that the same monomers are released through the activity of all four enzymes.

FIG 8.

Clear zone formation on turbid agar plates containing PCL after incubation for 1, 2, 4, and 24 h with Acut1-6hp, Acut2-6hp, Acut3-6hp, and FsCut-6hp at pH 5.5 and 25°C or pH 8.0 and 40°C. Tests with PBS buffer at pH 5.5 and 8.0 instead of enzymes served as a negative control.

FIG 9.

TLC of the hydrolysis products released from apple cutin by Acut1-6hp (lane 4), Acut2-6hp (lane 5), Acut3-6hp (lane 3), and FsCut-6hp (lane 1) compared to those released by the use of PBS buffer at 25°C (lane 6) and 40°C (lane 2) after 48 h of incubation. RF, retardation factor.

DISCUSSION

Different secretory enzymes have already been reported to be produced by A. adeninivorans, showing the great biotechnological potential of this yeast species (26, 40). However, the secretion of cutinases or cutinase-like enzymes by A. adeninivorans has not been reported to date. Although A. adeninivorans has occasionally been isolated from plant material and soil containing plant material, this yeast has not been shown to be a plant pathogen (41). Despite this, three different genes encoding potential cutinases or cutinase-like enzymes were annotated in the genomic DNA of A. adeninivorans LS3. An alignment of the amino acid sequences of the respective proteins with other known cutinases revealed the catalytic triad S-D-H with the conserved G-Y-S-Q-G motif as well as cysteine residues forming the two typical disulfide bridges indicating the α/β structure of serine hydrolase proteins (1). The determination of the molecular mass showed that Acut3-6hp is probably a dimer under native conditions and is different from Acut1-6hp, Acut2-6hp, and FsCut-6hp, which are monomeric.

The cutinases found in A. adeninivorans are most active under slightly acidic conditions, with the pH optima being between 5.0 and 5.5, whereas the alkaline cutinase FsCutp from F. solani f. sp. pisi has a pH optimum of 8.0 to 9.0. Relative activity of 80% was found at pH 4.5, but at pH 3, no activity was detectible, which clearly distinguishes the Arxula cutinases from acidic cutinases, such as cutinase 1 from Sirococcus conigenus (ScCut1) (25). Unlike other cutinases or cutinase-like enzymes, e.g., the cutinase-like enzyme from Pseudozyma antarctica (PaE), cutinase A from Thielavia terrestris (TtCutA), and FsCut, which have been shown to be the most active at temperatures of between 40 and 50°C (5, 6, 19), Acut1-6hp, Acut2-6hp, and Acut3-6hp had lower temperature optima of 20 to 30°C, and it was found that the pH and temperature stabilities for the cutinases from A. adeninivorans were restricted compared to those for the cutinases investigated in other studies (5, 25). Acut3-6hp was found to be the most stable, having more than 80% residual activity at 50°C after 4 h. A comparison of the amino acid sequence of Acut3-6hp with the amino acid sequences of the less stable Acut1-6hp and Acut2-6hp showed that it has an elongated sequence with glycine- and serine-rich repetitions, which may influence temperature stability.

The data obtained for pH stability showed that the cutinases from A. adeninivorans are unstable under optimal reaction conditions and that they lose nearly 50% of their activity after 2 h of incubation. The same result was also obtained for FsCut-6hp produced in A. adeninivorans. However, additives that stabilized the activity of the Arxula cutinases were identified, and PEG 200 was shown to significantly stabilize cutinases from A. adeninivorans. PEG 200 also increased the activity of Acut2-6hp and Acut3-6hp by up to 200% and that of Acut1-6hp by up to 150%. Similar effects have also been shown by Talukder et al. (42), who used PEG 400 to increase the activity and stability of a lipase from Chromobacterium viscosum in sodium bis(2-ethyl-l-hexyl)sulfosuccinate (AOT)–isooctane reverse micelles, with the half-life increasing from 38 days in simple reverse micelles to 60 days in reverse micelles. Stabilization of low-molecular-mass PEG in aqueous nonmicellar solutions was also seen by Gomes et al. (43). Furthermore, our study showed that DEG has an effect similar to that of PEG on these cutinases. The stabilizing effect of alcohols on cutinases has been extensively studied with different reaction systems and enzyme preparations, most of which were microencapsulated in reverse micelles. A summary of these studies can be found elsewhere (1). One example is the stabilization of a cutinase using hexanol, which allows the deactivation that occurs in AOT reversed micelles to be avoided and leads to an increase in the half-life from 2.7 h to 159 days (44). Additionally, ethanol and isopropanol were tested in this study for their influence on the activity and stability of cutinases from A. adeninivorans. In comparison to the activity obtained with PEG 200, there was a decrease in the activity of Acut1-6hp, Acut2-6hp, and Acut3-6hp by incubation with ethanol and isopropanol, but both alcohols stabilized these enzymes. The increase of Acut3-6hp activity to 300% after incubation with acetone was unique among the enzymes tested in this study and was not found for the other cutinases in the literature. The reason for this effect remains a subject of speculation, but it could be related to the elongated amino acid sequence of Acut3-6hp compared to the length of the amino acid sequences of Acut1-6hp and Acut2-6hp.

The substrate profiles of Acut1-6hp, Acut2-6hp, Acut3-6hp, and FsCut-6hp were found to be quite similar. They all showed maximum activity with short-chain fatty acids, p-nitrophenyl esters, and triacylglycerides, which is typical for cutinases and contrasts with the findings for true lipases, which have higher levels of activity with long-chain fatty acid esters (1). Acut3-6hp and FsCut-6hp showed the highest activity with the C₄ esters pNPB and tributyrin. In contrast, Acut1-6hp and Acut2-6hp had higher activity with the C₆ ester pNP-caproate; however, in the case of triacylglycerides, the result for Acut1-6hp and Acut2-6hp was similar to that for Acut3-6hp and FsCut-6hp. Several known cutinases, for example, TtCutA from Thielavia terrestris (5) and PaE from Pseudozyma antarctica (6), have the same substrate profile, but there are also other cutinases or cutinase-like enzymes which have slightly different affinities, with higher levels of activity toward pNP-acetate being detected (25, 45, 46). Martinez et al. (47) suggested that the low levels of activity of cutinases toward pNP esters of long-chain fatty acids are related to the lack of a large hydrophobic area around the active site, which is present in lipases. To determine if the potential cutinases from A. adeninivorans are true cutinases, PCL was used as a model polyester substrate, because it has been used in previous studies (4, 6, 16, 48, 49). The test for a clear zone revealed PCL degradation by Acut1-6hp, Acut2-6hp, and Acut3-6hp and by FsCut-6hp, which served as a positive control. Since the hydrolysis of PCL is not sufficient for an enzyme to be categorized as a true cutinase, the hydrolysis products released from apple cutin by Acut1-6hp, Acut2-6hp, and Acut3-6hp were compared to the hydrolysis products released from apple cutin by FsCut-6hp. The products were found to be identical, indicating that these four cutinases have the same cutinolytic activity. In previous work, it has been shown that the major components released by enzymatic hydrolysis of cutin are 9,10,8-trihydroxy-C₁₈, 10,16-dihydroxy-C₁₆, and ω-hydroxy-C₁₆ and C₁₈ with R_f values of 0.34, 0.51, and 0.72, respectively (39, 50). Three of the spots visible in Fig. 9 have R_f values of 0.43, 0.51, and 0.74, which correspond to those for the compounds described above. Nyyssölä et al. (25) isolated hydrolysis products from apple peels after incubation with two different cutinases, using the same TLC system that was used in this study. They assumed that their product with an R_f value of 0.41 corresponded to trihydroxy fatty acids. In their study, no other spots which might correspond to di- or monohydroxy fatty acids were detected.

The industrial application of enzymes requires that they be readily available at low cost. A fed-batch cultivation performed with A. adeninivorans G1212/YRC102-ACUT2-6H to produce Acut2-6hp resulted in a high volumetric activity of 1,064 U ml⁻¹, which is twice that achieved by Seman et al. (51) using Pichia pastoris for the production of Glomerella cingulata cutinase. However, the maximum enzyme concentration of 800 mg liter⁻¹ for Acut2-6hp did not match the concentration of 3.8 g liter⁻¹ achieved with G. cingulata cutinase. S. cerevisiae has also been used for the production of cutinases, e.g., F. solani f. sp. pisi cutinase (52, 53), with a maximum activity of 113 U ml⁻¹ being achieved by fed-batch growth. This is 1/10 the volumetric activity achieved with fed-batch cultivation with Arxula (52). Another interesting phenomenon, which can be seen in the data obtained during the cultivation, is the fact that extracellular protein production stops at the end of cell growth. Since the expression cassette used is under the control of the strong constitutive TEF1 promoter, extracellular protein accumulation should be independent of an increase in dcw, as long as a substrate is still available. Glucose (80 g liter⁻¹) was added at the end of the growth phase; however, increases in the amount of extracellular protein, dcw, and enzyme activity did not occur. This effect could be explained by a deficiency in available nitrogen sources, such as amino acids or ammonium; however, since pH maintenance was done with 12.5% ammonia feed, there was a constant supply of nitrogen during the cultivation period, suggesting that there is another reason for the cessation of protein accumulation, e.g., the use of the TEF1 promoter itself (Fig. 3).

Cutinases are of great interest, due to their potential application in industrial processes, and much work to find and characterize new cutinases from different sources has been undertaken (54). As well as pathogenic microorganisms, there are some unusual sources of cutinases, for example, the midgut of stag beetle larvae (23). The identification of the three new cutinases or cutinase-like enzymes in A. adeninivorans was surprising because this organism is not known to be a plant pathogen.

The high expression levels that were achieved with Acut2-6hp and the possibility of stabilization with organic solvents makes further investigation of these enzymes for industrial applications, such as transesterification, esterification, and plastic degradation, worthwhile (1). Their natural function and regulation at the level of transcription in A. adeninivorans LS3 could also be topics for further investigation.