Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2015 Jul 21;81(16):5395–5410. doi: 10.1128/AEM.00835-15

Phylogenetic and Variable-Number Tandem-Repeat Analyses Identify Nonpathogenic Xanthomonas arboricola Lineages Lacking the Canonical Type III Secretion System

Salwa Essakhi a,*, Sophie Cesbron a, Marion Fischer-Le Saux a, Sophie Bonneau a, Marie-Agnès Jacques a, Charles Manceau a,b,✉
Editor: H Goodrich-Blair
PMCID: PMC4510168  PMID: 26048944

Abstract

Xanthomonas arboricola is conventionally known as a taxon of plant-pathogenic bacteria that includes seven pathovars. This study showed that X. arboricola also encompasses nonpathogenic bacteria that cause no apparent disease symptoms on their hosts. The aim of this study was to assess the X. arboricola population structure associated with walnut, including nonpathogenic strains, in order to gain a better understanding of the role of nonpathogenic xanthomonads in walnut microbiota. A multilocus sequence analysis (MLSA) was performed on a collection of 100 X. arboricola strains, including 27 nonpathogenic strains isolated from walnut. Nonpathogenic strains grouped outside clusters defined by pathovars and formed separate genetic lineages. A multilocus variable-number tandem-repeat analysis (MLVA) conducted on a collection of X. arboricola strains isolated from walnut showed that nonpathogenic strains clustered separately from clonal complexes containing Xanthomonas arboricola pv. juglandis strains. Some nonpathogenic strains of X. arboricola did not contain the canonical type III secretion system (T3SS) and harbored only one to three type III effector (T3E) genes. In the nonpathogenic strains CFBP 7640 and CFBP 7653, neither T3SS genes nor any of the analyzed T3E genes were detected. This finding raises a question about the origin of nonpathogenic strains and the evolution of plant pathogenicity in X. arboricola. T3E genes that were not detected in any nonpathogenic isolates studied represent excellent candidates to be those responsible for pathogenicity in X. arboricola.

INTRODUCTION

Eubacteria constitute a major component of the commensal microbiota, and the nature of their interaction with plants is still unknown (1). Xanthomonas strains living in close association with plants but causing no apparent disease symptoms on their host have been reported (2, 3). On the basis of amplified fragment length polymorphism (AFLP) analysis, Gonzalez et al. (2) showed that nonpathogenic Xanthomonas strains colonizing cassava were clearly distinguished from Xanthomonas axonopodis pv. manihotis strains that cause cassava bacterial blight. Although some of these nonpathogenic strains have been characterized genetically and phenotypically, little is known about their epidemiological or ecological importance.

In previous studies, the genetic diversity and population structure of Xanthomonas have been investigated using DNA-DNA hybridization (4, 5), repetitive-sequence PCR (rep-PCR) (4–7), AFLP (4, 8), and fluorescent AFLP (9, 10). As an alternative to these methods, the comparative sequence analysis of protein-encoding genes has also been widely explored. For example, Parkinson et al. (11) used the gyrB gene, which encodes the subunit B protein of DNA gyrase, for establishing a phylogenetic relationship among 203 Xanthomonas pathotype strains. Young et al. (12, 13) used a multilocus sequence analysis (MLSA) based on four genes (dnaK, encoding the chaperone protein; fyuA, encoding one tonB-dependent transporter; gyrB and rpoD, encoding the RNA polymerase sigma factor) to study the phylogenetic and taxonomic relationships within the genus Xanthomonas. MLSA is a powerful technique for inferring phylogenetic relationships at the interspecific and intraspecific levels, as well as for evolutionary studies and systematics, and it can be useful in bacterial taxonomy as a complementary tool for defining species and for identification of new strains (14, 15). MLSA provides a robust method for the differentiation of most Xanthomonas spp. One of its most important contributions, applied to Xanthomonas, is that it allows strains to be allocated to known species or to be identified as members of new species more easily. Moreover, MLSA generally mimics grouping generated by DNA-DNA hybridization within Xanthomonas, AFLP, and rep-PCR and may therefore offer a refined method for differentiation of species (13). In some cases, MLSA is insufficient for discriminating closely related isolates and studying intraspecies genetic diversity. Thus, highly discriminative typing methods are needed for surveillance and outbreak studies. Multilocus variable-number tandem-repeat (VNTR) analysis (MLVA) has been successfully developed for many bacterial species (16–21). It is a bacterial typing method involving amplification and fragment size analysis of polymorphic regions of DNA containing variable numbers of tandem repeat sequences. VNTRs can be rapidly characterized by PCRs with specific primers based on the flanking regions of the tandem repeats. MLVA based on a few highly variable VNTRs usually displays a high level of discriminatory power in distinguishing closely related isolates for the investigation of disease outbreaks and epidemiological studies (16–21).

Vauterin et al. (3) suggested the investigation of hrp (hypersensitive reaction and pathogenicity) genes to distinguish the nonpathogenic Xanthomonas strains from the pathogenic ones. hrp genes are known to be involved in induction of hypersensitive response (HR) in resistant host and nonhost plants and pathogenicity in susceptible host plants (22, 23); hrc (hrp conserved) genes are considered to be critical for pathogenicity and initiation of disease and encode the type III secretion system (T3SS), a highly conserved protein secretion system (22, 24). Previous studies reported that the distribution of type III effectors (T3Es) within Xanthomonas strains may suggest a basic role in host specificity (25). T3Es are candidate determinants of host specificity of pathogenic bacteria, since it has been shown that many T3Es can act as molecular double agents that betray the pathogen to plant defenses in some interactions and suppress host defenses in others (26). More recently, Hajri et al. (27) investigated the variability of T3E repertoires in the species X. arboricola and their potential role in structuring its populations according to host range and confirmed that T3SS is an essential virulence mechanism in X. arboricola.

Walnut blight (WB), caused by Xanthomonas arboricola pv. juglandis (5), is a major disease of walnut in France and the most important one in all walnut-growing areas (28). Common symptoms include stem, fruit, and leaf spots, catkin necrosis, and fruit drop. Previous studies showed that X. arboricola pv. juglandis has been also isolated from tissues affected by brown apical necrosis (29–31). Hajri et al. (10) reported the association of X. arboricola pv. juglandis with vertical oozing canker (VOC) and clarified the taxonomic position of VOC strains as belonging to a singular lineage within X. arboricola pv. juglandis. During surveys in the two main production areas of walnut in France (Grenoble in the southeast and Périgord in the southwest), we noticed that nonpathogenic strains of X. arboricola were isolated from healthy and diseased walnuts. These strains were characterized by pathogenicity tests on walnut seedlings and a range of other plants. The main aim of the present study was to assess X. arboricola population structure associated with walnut, including nonpathogenic strains, in order to gain a better understanding of the role of nonpathogenic xanthomonads in walnut microflora. Knowledge pertaining to the population structure of X. arboricola isolated from walnut should shed light on the epidemiology of diseases associated with X. arboricola pv. juglandis, with the final aim of helping in development of reliable identification and specific detection tools that will facilitate ecological and epidemiological studies. Hence, the genetic structure of nonpathogenic strains was investigated using MLSA and MLVA approaches, and the type of interaction that this group of bacteria develops with host and nonhost plants was characterized. In this context, we investigated the distribution of T3Es and T3SS-coding genes in nonpathogenic strains.

MATERIALS AND METHODS

Bacterial strains.

The bacterial strains used in this study are listed in Table 1. Strains of X. arboricola were obtained from the International Center for Microbial Resources, French Collection for Plant Associated Bacteria (CIRM-CFBP), INRA, Angers, France (http://www.angers.inra.fr/cfbp/), or isolated from buds of healthy walnuts in the two main walnut-growing areas in France (Rhône-Alpes region in the southeast and Périgord in the southwest). Bacterial strains were routinely cultured at 27°C on YPGA medium (7 g liter−1 yeast extract, 7 g liter−1 peptone, 7 g liter−1 glucose, 15 g liter−1 agar) for 24 to 48 h.

TABLE 1.

Bacterial strains used in this studya

Taxon Strain Other collection accession no. and/or strain no. Host plant Geographic origin Yr of isolation
X. arboricola pv. celebensis CFBP 3523PT LMG 677, NCPPB 1832, ATCC 19045 Musa acuminata New Zealand 1960
CFBP 7150 LMG 676, NCPPB 1630, ICMP 1484 Musa acuminata New Zealand 1960
X. arboricola pv. corylina CFBP 1159PT LMG 689, NCPPB 935, ATCC 19313 Corylus maxima United States 1939
CFBP1846 Corylus avellana France 1975
CFBP1847 C. avellana Algeria 1977
CFBP1848 C. avellana United Kingdom 1977
CFBP 2565 ICMP 11956 C. avellana France 1985
CFBP 5956 C. avellana France 1979
CFBP 6101 C. avellana France 1979
Xanthomonas arboricola pv. fragariae CFBP 6771PT LMG 19145, PD 2780 Fragaria × ananassa Italy 1993
CFBP 6762 PD 2694 Fragaria × ananassa Italy NA
CFBP 6763 PD 2697 Fragaria × ananassa Italy NA
CFBP 6770 LMG 19144, PD 2696 Fragaria × ananassa Italy 1994
CFBP 6772 PD 2803 Fragaria × ananassa Italy NA
CFBP 3548 LMG 19146, PD 3164 Fragaria sp. France 1986
CFBP 3549 PD 3160 Fragaria sp. France 1986
X. arboricola pv. pruni CFBP 3894PT NCPPB 416, ATCC 19316, ICMP 51, CFBP 2535 Prunus salicina New Zealand 1953
CFBP 3893 Prunus persica Italy 1989
CFBP 3898 Prunus domestica United States 1989
CFBP 3900 P. persica United States 1987
CFBP 3901 Prunus armeniaca United States 1987
CFBP 3921 P. persica Italy 1996
CFBP 411 ATCC 10016, ICMP 12475 P. persica United States 1963
CFBP 5229 Prunus sp. Argentina 1996
CFBP 5529 NCPPB 1607 P. persica Australia 1964
CFBP 5530 Prunus persica Italy 1989
CFBP 5580 Prunus japonica France 2000
CFBP 5722 P. persica Brazil 1991
CFBP 5723 Prunus sp. Uruguay NA
CFBP 5724 Prunus amygdalus United States NA
CFBP 6653 P. persica France 2000
CFBP 7098 P. domestica Spain 2002
CFBP 7099 P.domestica Spain 2003
CFBP 7100 Prunus dulcis Spain 2006
X. arboricola pv. populi CFBP 3123PT Populus × canadensis Netherlands 1979
CFBP 2113 Populus × interamericana Netherlands 1980
CFBP 2666 Populus × interamericana France 1983
CFBP 2669 Populus × canadensis France 1987
CFBP 2983 Populus × canadensis Italy 1989
CFBP 2985 Populus × interamericana Belgium 1989
CFBP 2986 Populus × interamericana Belgium 1989
CFBP 3004 Populus × interamericana France 1989
CFBP 3121 Salix alba Netherlands 1980
CFBP 3122 ICMP 9140 Salix alba Netherlands 1980
CFBP 3124 LMG 9713, ICMP 9367 Populus × generosa New Zealand 1986
CFBP 3338 Populus × interamericana France 1991
CFBP 3342 Salix sp. New Zealand 1988
CFBP 3343 Populus sp. New Zealand 1988
CFBP 3344 Salix sp. New Zealand 1988
CFBP 3839 Populus deltoides Belgium 1984
X. arboricola pv. juglandis CFBP 2528T LMG 747, NCPPB 411, ATCC 49083, ICMP 35 Juglans regia New Zealand 1956
CFBP 176 J. regia France 1961
CFBP 878 J. regia France 1966
CFBP 2564 ICMP 11955 J. regia Italy 1985
CFBP 2568 J. regia Italy 1985
CFBP 2632 ICMP 11963 J. regia Spain 1984
CFBP 6557 J. regia Italy 1999
CFBP 7071 Juglans sp. Spain 1993
CFBP 7072 Juglans sp. Spain 1993
CFBP 7244 J. regia France 1978
12572 J. regia France 2001
12573 J. regia France 2001
12575 J. regia France 2001
12576 J. regia France 2001
12577 J. regia France 2001
12579 J. regia France 2001
12581 J. regia France 2001
12586 J. regia France 2001
12707 J. regia cv. Fernor France 2002
12710 J. regia cv. Franquette France 2002
12680 J. regia France 2002
12783 J. regia France 2003
12763* CFBP 7179 J. regia cv. Fernor France 2002
12574* J. regia France 2001
12578* J. regia France 2001
12580* J. regia France 2001
12582* J. regia France 2001
12583* J. regia France 2001
12584* J. regia France 2001
12585* J. regia France 2001
12587* J. regia France 2001
12588* J. regia France 2001
12589* J. regia France 2001
12591* J. regia France 2001
12592* J. regia France 2001
12681* J. regia France 2002
12708* J. regia cv. Fernor France 2002
12709* J. regia cv. Fernor France 2002
12711* J. regia cv. Fernor France 2002
12712* J. regia cv. lara France 2002
12713* J. regia cv. Fernor France 2002
12714* J. regia cv. Fernor France 2002
12715* J. regia cv. Fernor France 2002
12762* J. regia cv. Fernor France 2002
12765* J. regia cv. Fernor France 2003
12766* J. regia France 2003
12768* J. regia France 2003
12769* J. regia France 2003
12770* J. regia cv. Fernor France 2003
12772* J. regia cv. Fernor France 2003
12774* J. regia France 2003
12775* J. regia France 2003
12776* J. regia France 2003
12777* J. regia France 2003
12778* J. regia France 2003
12779* J. regia France 2003
12780* J. regia cv. Fernor France 2003
12781* J. regia France 2003
12782* J. regia France 2003
12784* J. regia cv. Vina France 2003
12785* J. regia cv. Franquette France 2003
CFBP 7643 J. regia France 2009
X. arboricola CFBP 1022 J. regia France 1967
CFBP 7654 CB1 J. regia Périgord, France 2008
CFBP 7653 CS2 J. regia Périgord, France 2008
CFBP 7651 CS5F J. regia Isère, France 2008
CFBP 7652 SPS1 J. regia Périgord, France 2008
CFBP 7647 P2-4 J. regia cv. Franquette Isère, France 2009
CFBP 7641 P2-7 J. regia cv. Franquette Isère, France 2009
CFBP 7635 P2-21 J. regia cv. Franquette Isère, France 2009
CFBP 7637 P3-6 J. regia cv. Franquette Isère, France 2009
CFBP 7638 P3-24 J. regia cv. Franquette Isère, France 2009
CFBP 7645 P7-4 J. regia Loire, France 2009
CFBP 7640 P7-18 J. regia Loire, France 2009
CFBP 7636 P7-27 J. regia Loire, France 2009
CFBP 7633 P8-6 J. regia Rhône, France 2009
CFBP 7634 P8-10 J. regia Rhône, France 2009
CFBP 7639 P8-14 J. regia Rhône, France 2009
CFBP 7632 P8-15 J. regia Rhône, France 2009
CFBP 7629 P8-20 J. regia Rhône, France 2009
CFBP 7630 P9-12 J. regia Isère, France 2009
CFBP 7656 P9-21 J. regia Isère, France 2009
CFBP 7646 P10-8 J. regia Rhône, France 2009
CFBP 7644 P10-14 J. regia Rhône, France 2009
CFBP 7650 P10-19 J. regia Rhône, France 2009
CFBP 7649 P10-25 J. regia Rhône, France 2009
CFBP 7648 P11-12 J. regia Isère, France 2009
CFBP 7631 P11-21 J. regia Isère, France 2009
CFBP 7655 P16-11 J. regia Isère, France 2009
X. campestris pv. campestris CFBP 5241 Brassica oleracea United Kingdom 1957
a

CIRM/CFBP, Collection Française de Bactéries associées aux Plantes, INRA, Angers, France; ICMP, International Collection of Microorganisms from Plants, Auckland, New Zealand; LMG, BCCM/LMG Bacteria Collection, University of Ghent, Ghent, Belgium; NCPPB, National Collection of Plant Pathogenic Bacteria, York, United Kingdom; ATCC, American Type Culture Collection, Manassas, VA; PD, Culture Collection of Plant Pathogenic Bacteria, Plant Protection Service, Wageningen, Netherlands. Superscript T and PT indicate type strain of a species and pathotype strain of a pathovar respectively. *, Xanthomonas arboricola pv. juglandis strain isolated from vertical oozing canker symptoms on trunks and branches (10). NA, not available.

Plant material.

Seedlings of walnut (Juglans regia cv. Fernor and cv. Franquette), peach (Prunus persica cv. Dixired), radish (Rhaphanus sativus var. Kocto), tomato (Lycopersicon esculentum cv. marmande), and pepper (Capsicum annum cv. ECW) were used for pathogenicity tests. A hypersensitivity reaction was induced on leaves of Nicotiana benthamiana. Plants were grown in a greenhouse under 18°C at night and 24°C during day with a 12-h photoperiod. For negative controls, plants were inoculated with sterile distilled water. For positive controls, plants were inoculated with X. arboricola pv. juglandis strains CFBP 2528PT and CFBP 7179 for walnut, X. arboricola pv. pruni strain CFBP 3894PT for peach, Xanthomonas vesicatoria CFBP 1941 for tomato, Xanthomonas euvesicatoria CFBP 5618 for pepper, and X. campestris pv. campestris strain CFBP 5241 for tests on R. sativus and N. benthamiana plants.

Pathogenicity tests.

Walnut seedlings were grown in a greenhouse until four to six young leaves were evident. Bacterial suspensions (1 × 108 CFU ml−1) were sprayed onto the foliage, and plants were maintained for 2 days under plastic bags and incubated in growth chambers. The plastic bags were then removed, and the plants were maintained in the growth chamber under the same climatic conditions. Plants were checked for symptoms weekly for up to 30 days after inoculation.

Two-year-old peach seedlings were planted in 30-cm-diameter pots. Young leaves (third to sixth leaves from shoot tip) were detached from peach seedlings, collected, and inoculated using detached-leaf assays as described by Randhawa and Civerolo (32). Detached leaves were disinfected for 40 to 60 s with 70% ethanol and then rinsed in sterile water. These leaves were then immersed in a bacterial suspension (1 × 107 CFU ml−1), and a 10-kPa vacuum was applied for 2 min. Inoculated leaves were placed in a sterile tube with the leaf upright, and the petiole was immersed in 6% water agar. Symptom development was recorded daily for 3 weeks after inoculation. For a positive result, after 6 to 9 days, all inoculated sites had to exhibit confluent water soaking, become dark brown, and exhibit brittle necrotic spots, often surrounded by a greyish white or purple margin.

On radish, two leaves per plant at the stage of four fully expanded leaves were inoculated by the leaf-clipping method. The last completely expanded leaf was cut with scissors dipped in bacterial suspensions (1 × 108 CFU ml−1). Ten leaves were inoculated for each strain. A positive result was obtained if V-shaped lesions appeared at the leaf margin approximately 2 weeks after inoculation.

Leaves of tomato and pepper were punctured at four locations with a sterile needle and 1 ml of bacterial suspension (1 × 106 CFU ml−1) was infiltrated through wounds. A positive reaction was obtained when inoculated leaves exhibited dark brown irregularly shaped splotches with chlorosis surrounding the lesions, while inoculated leaves of pepper had small, yellow-green lesions that became deformed and twisted.

Leaves of N. benthamiana were punctured at four locations with a sterile needle, and 1 ml of bacterial suspension (1 × 106 CFU ml−1) was infiltrated through wounds. Necrosis of the infiltrated area after 24 to 48 h was considered a hypersensitive response (HR).

The disease occurrence was monitored by quantification of symptoms and bacterial populations at 2, 7, 14, and 21 days after inoculation into plant tissues. Inoculated plants were maintained in growth chambers under 18°C at night and 20°C during the day with a 15-h photoperiod (light intensity of 85 μE m−2 s−1) and a high relative humidity.

MLSA.

Gene fragments of atpD, dnaK, efp, fyuA, glnA, gyrB, and rpoD were amplified from genomic DNA of the 27 nonpathogenic strains by using primers described by Fargier et al. (14). A list of genes and primer sequences used for PCR amplification and sequencing is provided in Table 2. PCR amplifications were carried out in a total volume of 25 μl containing 1× GoTaq buffer (Promega, Fitchburg, WI, USA), a 200 μM concentration of each deoxynucleoside triphosphate (dNTP), a 0.5 μM concentration of each primer, 0.4 U of GoTaq polymerase (16 U ml−1 final concentration), and 5 μl of boiled bacterial cells (3 × 108 CFU ml−1). The PCR cycling conditions consisted of an initial denaturation step at 94°C for 5 min, followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 60°C for all loci (except 62°C for efp) for 60 s, and extension at 72°C for 30 s, and a final extension step at 72°C for 7 min.

TABLE 2.

Primers used in MLSA for amplification and sequencing

Gene Primer sequence
PCR fragment size (bp)
Forward Reverse
atpD GGGCAAGATCGTTCAGAT GCTCTTGGTCGAGGTGAT 750
dnaK GGTATTGACCTCGGCACCAC ACCTTCGGCATACGGGTCT 759
efp TCATCACCGAGACCGAATA TCCTGGTTGACGAACAGC 339
fyuA ACCATCGACATGGACTGGACC GTCGCCGAACAGGTTCACC 753
glnA ATCAAGGACAACAAGGTCG GCGGTGAAGGTCAGGTAG 675
gyrB ACGAGTACAACCCGGACAA CCCATCARGGTGCTGAAGAT 735
rpoD ATGGCCAACGAACGTCCTGC AACTTGTAACCGCGACGGTATTCG 609

PCR amplicons sequencing was performed by the Biogenouest platform (Nantes, France). Nucleotide sequences were corrected using Geneious v. 4.8.4 (33) and edited using BioEdit (34). These sequences were aligned together with sequences of 73 representative strains of Xanthomonas arboricola available from the CIRM-CFBP sequence data (http://www.angers.inra.fr/cfbp/) using Clustal W (35). A neighbor-joining tree was generated with MEGA v. 5.0.3 (36) using the Kimura two-parameter model (37) and 1,000 bootstrap replicates. X. campestris pv. campestris strain CFBP 5241 was used as an outgroup.

MLVA.

Seventeen loci of 6- to 15-bp tandem repeat (TR) units previously constructed (38) were used in the multilocus VNTR analysis (MLVA) scheme (Table 3). PCR and capillary electrophoresis were conducted as described in reference 38. Output data from capillary electrophoreses were managed with BioNumerics v.6.5 (Applied Maths, St-Martens-Latem, Belgium), and chromatograms were also checked with Peakscanner software v. 1.0 (Life Technologies). The allele scores based on the fragment sizes were converted into repeat numbers and used as character data for cluster analysis. A minimum spanning tree (MST) was generated using BioNumerics v. 6.5 (Applied Maths, St-Martens-Latem, Belgium) using the categorical coefficient and the maximum number of single-locus variants (SLVs) as a priority rule (39).

TABLE 3.

Primers used for amplification of VNTR loci and their corresponding positions on the genome of X. arboricola pv. pruni CFBP 5530

Multiplex VNTR locus Primer sequence
Position
Forwarda Reverse Start End
A TR50I V-CGTGCATCAGACGCTTGCGT GTTGCGAGATCGGGCGCTTC 3413992 3414042
TR33I P-CTCGCAAAACCCTTGCCATC CGAGTGGATGTTATGGCGTGG 2022442 2022490
TR68I F-AAATCATCGGCGCCTGAAAC CTTGCGGTACTGGCTGTTCA 4140738 4140827
B TR19I N-GATTGACGGCACCCACACAG CCAGGACGTTGTGCCGTGGT 1523902 1523949
TR36I P-CGATCGCATCTGTGTGGGTTAG GCAGGAGAAGGAAAGCGCCAG 2284172 2284214
TR58I V-ACCAACACCGAGCTTGCCTC ATCTGTTGCTGGCCGAGAGC 3538491 3538528
C TR3I N-GGTTGCTTGGTCGTTGATCG GACATTCGCCGGGAGTGCAG 150355 150401
TR40I P-TGGAATGTGGAGGCTGTTCG TATCAGGCAGCGCACCAGCT 2426642 2426699
D TR15I N-TCGAGCGGTTCCTGCGGTTGT GCCATGTCGCCGGGAAACGA 1310624 1310662
TR37I P-CCAACAGAACCCCGCACCCA ATGGAGGATGCGGTTGCGGCT 2348164 2348197
E TR05II F-CAGATGCTGTCCCGATTCCCG GTCGACGGGTTCGCGGAAGGT 340287 340353
TR39II P-GGTACGGAAGGTGGTGGTCTGC CCCGCATACTGATGCAGTTCG 1940044 1940160
TR06II F-GTGCAGCACCAGCCAAAGGCA TCATAGGCTGGGGATTGGGGA 340223 340303
F TR21II V-ACACGGACGTACTTGCGGCGT GGAGCGTATTGCTTGAACGGGA 1114440 1114597
TR58II P-TCTGATCGGTGCTGAGCGTCT GGAAGAGTACCCGGCAATTCT 3391120 3391216
G TR38II N-CCCGTAGCTGTATCAGTGCCT TCTCGGTATCGATGTGGGTGC 1930537 1930595
TR67II P-AGCTCGCAACTGCTTTTCCCGA GATACAAGGCGAACGCGATGA 3641116 3641204
a

Forward primer pairs were marked with one of the following fluorescent dyes: F, FAM; V, VIC; N, NED; or P, PET.

Amplification of T3E and T3SS genes.

Nonpathogenic strains used in this study were tested for the presence or absence of hrp genes by PCR amplification of genomic DNA using primers described by Hajri et al. (27) (Tables 4 and 5). For detection of T3E genes, PCRs were carried out in a total volume of 20 μl containing 1× GoTaq buffer (Promega), a 200 μM concentration of each dNTP, a 0.5 μM concentration of each primers, 0.4 U GoTaq polymerase (16 U ml−1 final concentration), and 5 μl of boiled bacterial cells (3 × 108 CFU ml−1). All PCRs were performed with the following cycling conditions: initial denaturation step at 94°C for 2 min, 30 cycles of denaturation at 94°C for 1 min, annealing at 60°C for 1 min, and extension at 72°C for 2 min, and a final extension step at 72°C for 10 min.

TABLE 4.

PCR primers used to amplify T3Es genes

T3E gene Forward primer Reverse primer PCR fragment Size (bp)
avrBs2 ACCGCGCTGGCCACACCG TCACTCGCCCGGCTCGATC 2,118
TGCCGGTGTTGATGCACGA TCGGTCAGCAGGCTTTC 850
xopF1 TGAAACTCACCAGCAATATCG CTAGCGAAGCGCCTCGCTC 1,996
AGGCCATCGACCCCAAGATCC GTTCTTGGCCTTGAGCGCATTCC 779
xopA ATGGACTCATCTATCGGAAACTT GCCGGTGATGCTCGACAG 381
TGCAGACGATGGGCATCG CTGCATCAGCTGCATCACGATC 239
hrpW ATGCAACGCATGCTCAGCGACAT GTCTTCAGGTTCGCCAGCTTCAC 905
AAGGTCGTCACCGCGC GTCCTGCACGACCTTGTCT 399
hpaA ATGATCCGGCGCATTTCGCCAG TCATGCACGAATCTCCTGAGCGGC 816
CGCTGGATGGCATGGACGACG CGTCTGAGCGTCTGGTCGGCGGC 292
xopR ATGCGCCTGAGTCAGTTGTTT GTAGCCGTTGTCGATTGCCTCTT 1,230
CGTGCGGCCCTGATCGC GTAGCCCTGCATCATGCGTT 303
xopN ATGAAGTCATCCGCATCCGTCGAT CTCGATCGGTTCGGGCTACTCG 2,092
GTCATGACCCAGGGCGC GGTGATGGCGGTGTGCTG 864
xopX ATGGAGATCAAGAAACAGCAAACCGC GGCGACAGGCTTTGCACATATCTGG 1,865
GTGGAAAACAACCTGGG CCCCAGTTCATCGCC 827
xopZ GCACTTGCGGATACTAATGCGG GTCGACGAAGTCCTGCAATTGG 2,868
TTCGGCCGCGGCTCGGC GCACGGCATGGCGCGCTCC 1,012
xopQ GTGCCCGCAGGCGCTCATGCAA CCTTGGCGTGAACAGCATGCC 1,224
ACCCCGACGATGT TTGTTGTAGGCGCG 484
xopK GACGCCCTTGCTTCAGCGAAC TTCGGTGGCCAGCAACGTGCC 2,454
CTCGGCATCCAGGGC GACAAAGCCCTTGTTCCA 357
xopV ATGAAAGTCTCCGCAACCCTT TCAGGTTGCGAAAGGTGAGG 1,023
ACACGCCTGTTCGTCTC GCGATGTTCCATTTGTA 236
xopL ATGCGACGCGTCGATCAACCG CTACTGATGGCCTGAGGGTTCCG 1,863
CCACCGACCGTGGGCGCTTCATCATTA ACATCTGCACTGCCTTGGCCAGC 1,324
xopAI ATGACTTCGGTAAGCCAGCGCGAATC TCGATCTGGCTTTGATAAATCCTCAGAC 950
AGAGCAGACCACGCCCTCTACG GAATATTCTTCGGGAAGCGAGTGC 507
avrXccA1 GTGGTTCGCTGCGATGGC TCACCCAGCCAGCGGG 813
GATGGGCGGCACCG ATCGCCACGCACCTG 163
avrXccA2 GCCGATGGCTGCCGCCGGCGCTA TTGGTGTTCCAGTTCCGATCCAGG 1,442
ACGGCCCGTTCTTTCCGCAAAGCC CAACGGGCGCTCCGGCGACG 371
xopAH ATGAAGAACACGTCTGTCCCT CTACTTCTGCGTGGGAGGC 1,002
ATTGTGGTATGGGCCTAGGC TGCTTGGCGTACTCGTAGAAT 220
xopB ATGAAGGCAGAGCTCACACGA TCAGGCGCGGGTTGGTGCGAAGTA 1,835
AGCATTTGGCCCAAGCGCTTT CGCTTCGGTTGTCGTCATATTGG 574

TABLE 5.

PCR primers used to amplify T3SS genes

Gene Forward primer Reverse primer PCR fragment Size (bp)
hrcR GCTGGTGGTCATCATGCTGG GTGTTTGAGGAGGAATTGC 292
hrcN ATGTCAACGTGATCGTGC CTGGCTCATCACCCGGCTC 524
hrcT GTCGTTCTACGCGCTGG GTTGGCGGCATCGTGCAA 376
hrcC ACCGAAGTGCAGGTGTTTC ATCTCGATGATGGTGGCATCGAT 575
hrcV GCGCCATGAAATTCGTCAAGG GCCAGCAGCAGGAACAGC 367
hrcU GGCGTGGTGCTGTGG GGTTGACCACCATCACCTTG 340
hrcJ CTCGGCGAGATGTTCAAG GCCACCAATACAGCGC 436
hrpB1 CTGATCACGGTCGG TCGGCATCGGCGTC 287
hrpF ACGCTGGACACCATC TTCTTGTAGCCGGTGAT 188

Nucleotide sequence accession numbers.

The nucleotide sequences obtained in this work were deposited in GenBank under accession numbers KF904342 to KF904442 for atpD, KF904443 to KF904543 for dnaK, KF904544 to KF904644 for efp, KF904645 to KF904745 for fyuA, KF904746 to KF904846 for glnA, KF904847 to KF904947 for gyrB, and KF904948 to KF905048 for rpoD.

RESULTS

Identification of nonpathogenic strains of X. arboricola on walnut.

Xanthomonas-like strains isolated from walnut buds were characterized by pathogenicity tests on walnut seedlings and on a range of other plants. Strains were identified as X. arboricola based upon phenotypic characteristics and biochemical tests as described by Schaad (40). and amplification of a specific PCR fragment using the PCR test with XarbQ-F and XarbQ-R primers developed by Pothier et al. (41). A set of 27 strains formed convex, yellow-pigmented colonies, which were characterized as Gram-negative rods able to perform oxidative metabolism of glucose, galactose, mannose, cellobiose, trehalose, and arabinose and hydrolysis of gelatin, esculin, starch, and Tween 20 (except for strains CFBP 7645 and CFBP 7636, which did not hydrolyze Tween 20). A single amplicon with the correct size of 432 bp was obtained for each of these 27 strains using the PCR test (41). None of the 27 strains induced symptoms on walnut (Juglans regia), the plant from which they were isolated, after inoculation on walnut seedlings. Dynamics of the bacterial population sizes revealed that these strains were not able to reach bacterial population sizes higher than 1 × 106 CFU per g leaf tissue, the typical level observed for pathogenic interactions on walnut, whereas X. arboricola pv. juglandis CFBP 7179 induced typical necrotic leaf spots (Fig. 1) and reached about 1 × 107 CFU per g 7 days after inoculation (see Fig. S1 in the supplemental material).

FIG 1.

FIG 1

Illustration of walnut seedling responses to inoculations of X. arboricola strains CFBP 7634, CFBP 7645, CFBP 7653, and CFBP 7179. Observations were made 14 days after spraying bacterial suspension on walnut leaves. No reaction was induced on walnut leaves inoculated with X. arboricola strains CFBP 7634, CFBP 7645, and CFBP 7653 (A, B, and C, respectively). Dark brown spots and necrosis were observed on walnut leaves inoculated with X. arboricola pv. juglandis strain CFBP 7179 (D).

The pathogenicity of five strains representing each clonal group identified by MLSA and MLVA (CFBP 7634, CFBP 7645, CFBP 7651, CFBP 7652, and CFBP 7653) was evaluated on plants known to be hosts of other X. arboricola pathovars: P. persica, R. sativus, L. esculentum, and C. annum. While positive-control strains developed characteristic symptoms on their respective hosts, none of the five X. arboricola strains isolated from walnut and nonpathogenic on walnut (CFBP 7634, CFBP 7645, CFBP 7651, CFBP 7652, and CFBP 7653) induced any disease symptom on these plants (Fig. 2). Cell death in the inoculated area was observed on tomato and pepper plants following inoculation with strains CFBP 7651 and CFBP 7652 (Fig. 3). The dynamics of bacterial population sizes showed that the five strains were not able to reach population sizes equal to 1 × 108 CFU per g, the typical level of pathogenic interactions on the tested plants (see Fig. S1 in the supplemental material).

FIG 2.

FIG 2

Plant reaction observed on peach (A and B) and radish (C and D) leaves 14 days after inoculation. Compatible interactions cause typical symptoms when X. arboricola pv. pruni strain CFBP 3894PT was inoculated onto peach leaves (B) and when X. campestris pv. campestris CFBP 5241 was inoculated onto radish leaves (D). No reaction was observed when peach leaves were inoculated with X. arboricola strain CFBP 7634 (A) and when radish leaves were inoculated with X. arboricola strain CFBP 7652 (C).

FIG 3.

FIG 3

Tomato and pepper reactions to inoculation with Xanthomonas strains, 7 days after inoculation. No reaction is induced on tomato and pepper leaves inoculated with X. arboricola strain CFBP 7634 isolated from healthy walnut (A and D). Hypersensitive reactions were observed on tomato and pepper leaves inoculated with X. arboricola strain CFBP 7651 (B and E). Dark brown, irregularly shaped splotches with chlorosis surrounding lesions were observed on tomato leaves inoculated with Xanthomonas vesicatoria strain CFBP 1941 (C). Brown lesions were observed on pepper leaves inoculated with X. axonopodis pv. vesicatoria strain CFBP 5618 (F).

The ability of these strains to induce cell death was also tested on N. benthamiana. CFBP 7651 and CFBP 7652 cause cell death on N. benthamiana within 48 to 72 h after inoculation, while CFBP 7634, CFBP 7653, and CFBP 7645 did not elicit any plant reaction on inoculated N. benthamiana leaves (Fig. 4).

FIG 4.

FIG 4

Plant reactions when Nicotiana benthamiana leaves were inoculated with X. arboricola strain CFBP 7634 (A), X. arboricola strain CFBP 7651 (B), and X. campestris pv. campestris strain CFBP 5241 (C). Images were taken 72 h after bacterial infiltration.

MLSA confirmed that nonpathogenic strains isolated from walnut belong to X. arboricola.

Partial sequences of atpD, dnaK, efp, fyuA, glnA, gyrB, and rpoD genes were used in the present study to investigate the phylogenetic relationships between pathogenic and nonpathogenic strains of X. arboricola isolated from walnut. A phylogenetic tree was constructed based on the neighbor-joining method using the concatenated nucleotide sequences of the seven gene fragments of 27 nonpathogenic strains and 73 representative strains of X. arboricola. The sizes of the seven gene fragments were 750 bp (atpD), 759 bp (dnaK), 339 bp (efp), 753 bp (fyuA), 675 bp (glnA), 735 bp (gyrB), and 609 bp (rpoD), leading to a total of 4,620 bp for the concatenated data set. Except for the strain CFBP 7653, all strains of X. arboricola used in the MLSA scheme clustered in a large clade separately from X. campestris pv. campestris, used as an outgroup in the phylogenetic analysis (Fig. 5). Phylogenetic analyses distinguished several groups with high bootstrap values corresponding to different pathovars of X. arboricola. This clear correspondence between phylogenetic clustering and pathovar classification was not supported by phylogenetic trees based on individual loci (see Fig. S2 in the supplemental material). These observed incongruences might be explained by recombination events that shuffle the phylogenetic signal and by the fact that each individual locus does not harbor enough phylogenetic information. Thus, the addition of nonpathogenic strains in the phylogenetic tree does not modify the phylogenetic relationships between pathovars of X. arboricola (pathovars pruni, corylina, fragariae, populi, celebensis, and juglandis). Based on the phylogenetic position of nonpathogenic strains in the neighbor-joining tree, we confirmed that nonpathogenic strains definitely belonged to X. arboricola, grouped outside clusters defined by pathovars, and formed separate genetic lineages. Nonpathogenic strains isolated from walnut were polymorphic as they were distributed into three separated clusters within X. arboricola (Fig. 5). Thus, three main groups, termed NP1, NP2, and NP3, and four single branches were revealed by MLSA. The high bootstrap values of nonpathogenic strains depicted the robustness of these lineages; NP2 and NP3 with a bootstrap value equal to 100%, and NP1 with a bootstrap value equal to 98%. For NP3, CFBP 7640 presents differences in nucleotide sequences of the seven genes used in the phylogenetic analysis, whereas CFBP 7636 and CFBP 7645 are identical. The remaining strains, CFBP 7630, CFBP 1022, and CFBP 7652, did not cluster with either NP1 or NP2 with high bootstrap support.

FIG 5.

FIG 5

Phylogenetic tree constructed based on the neighbor-joining method using concatenated nucleotide sequences from 100 X. arboricola strains of partial regions of the atpD, dnaK, efp, fyuA, glnA, gyrB, and rpoD genes, representing a total of 4,620 bp. Bootstrap support as a percentage was based on 1,000 replicates. X. campestris pv. campestris CFBP 5241 was used as the outgroup.

MLVA distinguished several clonal complexes within X. arboricola strains isolated from walnut.

Ninety-three X. arboricola strains isolated from walnut, including 27 nonpathogenic strains, were typed using multilocus variable-number tandem-repeat analysis (MLVA). A minimum spanning tree (MST) was constructed using the highest number of single-locus variants (SLVs) as the priority. The minimum spanning tree is an undirected network in which all the samples within the population studied are linked together with the smallest possible linkages between nearest neighbors. MLVA types were distinguished to define clonal complexes that grouped strains that differ from each other by at most three locus variants (Fig. 6). Strains causing VOC grouped separately from WB strains and from nonpathogenic strains isolated from walnut. VOC-causing strains were grouped into one clonal complex and two singletons, whereas WB strains were more heterogeneous; they were separated into two clonal complexes and 16 singletons. Nonpathogenic strains were grouped separately from clonal complexes containing the WB- and VOC-causing strains and confirmed to be heterogeneous, as they were divided into six clonal complexes and four singletons. Nonpathogenic strains belonging to NP1 clustered in two clonal complexes and one singleton (CFBP 7638), while NP2 strains clustered into three clonal complexes and two singletons, NP3 strains, were divided into one clonal complex and one singleton (Fig. 6).

FIG 6.

FIG 6

Minimum spanning tree of 93 X. arboricola pv. juglandis and nonpathogenic strains based on 17 VNTR loci. Each circle represents an MLVA type with a size corresponding to the number of strains that share an identical MLVA type. MLVA types connected by a thick solid line differ by at most one VNTR locus, while MLVA types connected by a thin solid line differ by two or three VNTR loci. MLVA types that differ from each other by four VNTR loci or more are connected by dashed and dotted lines. A maximum distance between nodes in the same partition is 3. Branch distances above 5 are in blue. Clonal complexes defined in the gray zone, grouped strains that differed from each other's by at most three locus variants. NP, nonpathogenic; WB, walnut blight; VOC, vertical oozing canker.

In order to better understand the correlation between the population structure of nonpathogenic strains and their geographical origin, we performed an MST on the 27 nonpathogenic strains. Some clonal complexes grouped only strains belonging to the same geographic origin, i.e., isolated from the same field, such as orchard P10, located at Saint-Romains (CFBP 7644, CFBP 7646, CFBP 7649, and CFBP 7650), or orchard P8, located at Laval (CFBP 7629, CFBP 7632, CFBP 7633, and CFBP 7634). However, other clonal complexes grouped strains isolated in different geographic locations, such as clonal complexes grouping CFBP 7631, CFBP 7637, CFBP 7648 and CFBP 7656 (Fig. 7). These clonal complexes grouped strains belonging to different geographic locations from both eastern and southwestern areas, and other nonpathogenic strains belonging to different clonal complexes populations were recovered in the same orchards. Thus, the nonpathogenic strains were not structured according to their geographical origins based on this MLVA.

FIG 7.

FIG 7

Minimum spanning tree of the 27 nonpathogenic X. arboricola strains isolated from walnut, based on 17 VNTR loci. MLVA types connected by a thick solid line differ by at most one VNTR locus, while MLVA types connected by a thin solid line differ by two or three VNTR loci. MLVA types that differ from each other by four VNTR loci or more are connected by dashed and dotted lines. Clonal complexes defined in the gray zones are grouped strains that differed from each other's by at most three locus variants.

Several nonpathogenic strains lack the hrp-hrc cluster, coding for the type III secretion system.

Most nonpathogenic strains isolated from walnut were unable to elicit an HR on N. benthamiana and to cause disease on walnut and on other plant species tested. These observations suggest that these strains may lack the T3SS. We monitored the distribution of 9 genes coding the highly conserved genes of this secretion apparatus (27). Based on PCR results, no T3SS was detected in NP1 strains, NP3 strains, or CFBP 7653, since the 9 hrp-hrc gene primer pairs failed to amplify any DNA fragment for these strains. However, the NP2 strains CFBP 1022, CFBP 7630, and CFBP 7652 harbored genes of a typical T3SS of the Hrp2 family based on our PCR results (Fig. 8).

FIG 8.

FIG 8

Distribution of 18 T3Es and nine genes (two being hrp and seven being hrc) coding for the structural and regulatory components of the T3SS of the Hrp2 family among 27 nonpathogenic strains isolated from walnut, in comparison to X. arboricola pv. juglandis CFBP 2528T and CFBP 7179. The presence or absence of an orthologue of each selected gene was determined by PCR. Black squares represent presence of the corresponding gene, whereas white squares represent absence of the gene.

The composition of T3E repertoires differs between nonpathogenic strains.

In this study, we investigated the distribution of 18 T3Es present in X. arboricola pv. juglandis (27). Many differences between nonpathogenic strains in the size and composition of their T3E repertoires were noticed. Strains that belonged to NP2 and contain T3SS have more effector-encoding genes (seven in total) than strains of NP1 that do not contain T3SS, which harbor only three effectors (xopR, avrBs2, and avrXccA1). In addition, strains belonging to NP2 and CFBP 7630, CFBP 1022, and CFBP 7652 showed a homogeneous pattern of T3Es genes. All these strains harbored seven T3E-encoding genes, six of them being orthologues of avrBs2, xopF1, xopA, hrpW, hpaA, and xopR (Fig. 8). These genes are considered to be the ubiquitous set of T3E genes for X. arboricola strains (27). The XopB-encoding gene, which was detected previously only in VOC strains, and the XopAH-encoding gene, which is present only in WB isolates of X. arboricola pv. juglandis, were not detected in any of the nonpathogenic strains tested. Two strains from NP3 (CFBP 7636 and CFBP 7645) have only the XopR-encoding gene, while two strains (CFBP 7640 from NP3 and the singleton CFBP 7653) do not have any of the 18 T3E-encoding genes tested. A total of 11 of the 18 T3E genes studied were not detected in any nonpathogenic isolates studied.

DISCUSSION

X. arboricola is conventionally known as a taxon of plant-pathogenic bacteria that includes including seven pathovars. However, this study showed that X. arboricola also encompasses nonpathogenic bacteria that do not cause disease on the plants from which they were isolated or on a panel of plants representative of species usually used for plant-bacterium interaction studies. Knowledge pertaining to the population structure of X. arboricola isolated from walnut should shed light on the epidemiology of diseases associated with X. arboricola pv. juglandis, the evolutionary mechanism of this pathogen, the taxonomy and ecology of nonpathogenic xanthomonads and possible ways of increasing the effectiveness of detection and management of plant diseases associated with Xanthomonas taxa. During epidemiological surveys conducted in the two main production areas of walnut in France (Grenoble in the southeast and Périgord in the southwest), 27 bacterial strains isolated from asymptomatic buds were identified as nonpathogenic based on phenotypic and genotypic characteristics and pathogenicity tests on walnut seedlings. Phylogenetic analyses, performed by MLSA, distinguished several groups with high bootstrap values corresponding to different pathovars of X. arboricola (pathovars pruni, corylina, fragariae, populi, celebensis, poinsettiicola, and juglandis). Nonpathogenic strains definitely belong to X. arboricola and grouped outside clusters defined by pathovars that form separate genetic lineages. Nonpathogenic strains were polymorphic, as they were distributed into three separate clusters within X. arboricola, termed NP1, NP2, and NP3, and four single branches. Clustering of phylogenetic positions of nonpathogenic strains is not correlated to their geographical origins, indicating the absence of genotype-geographic structure. NP2 showed a high percentage of similarity and clustered strains collected in both eastern and southwestern regions in France. It is remarkable that all nonpathogenic xanthomonad strains isolated from walnut belong to the same species, X. arboricola, which is the only pathogenic bacterium known to affect walnut so far. It suggests that a link exists between these lineages.

MLVA distinguished several clonal complexes within X. arboricola strains isolated from walnut. Strains causing VOC grouped separately from WB strains. VOC strains are divided into one clonal complex and two singletons, whereas WB strains are more heterogeneous and are divided into two clonal complexes and 16 singletons. Thus, strains causing VOC might be the result of a natural selection of some WB strains that gain additional features necessary to cause canker in woody parts. One VOC strain (12714) was not grouped with other VOC strains and had already been found to belong to a separate lineage by MLSA studies (10). We could hypothesize that the gain of features could occur several times on the WB populations. This hypothesis of gaining features is supported by the ability of VOC strains to cause cankers on trunks and necrotic spots on leaves and fruits as well, whereas WB strains cause only necrotic symptoms on leaves and fruits. Nonpathogenic strains were grouped separately from clonal complexes grouping WB and VOC strains and revealed to be genetically heterogeneous, as they were divided into six clonal complexes and four singletons. There is a concordance between MLSA and MLVA results. All genetic lineages identified by MLSA were distinct from each other in the MLVA scheme as well. However, MLVA was confirmed to be a more discriminative typing method than MLSA, given that some genetic lineages defined by MLSA were divided into several clonal complexes and singletons in the population structure defined by MLVA. Strains that appear identical by MLSA may present different VNTR profiles, such as strains belonging to NP2 that formed a single genetic lineage with a 100% internal similarity in the MLSA scheme and are divided into three clonal complexes and two singletons by MLVA. In addition, population structure of clonal complexes defined by VNTR analysis is not correlated to their geographical origins, given that some clonal complexes grouped strains belonging to different geographic locations from both the Rhône-Alpes and Périgord regions. The occurrence of the same genotype in different geographic areas supports the fact that nonpathogenic strains have been spread all over walnut-growing areas in France. It would be useful to check the occurrence of these bacterial lineages on other cultivated plants and weeds in both areas to gain a better understanding of the ecology of these bacteria and to highlight the role of walnut in the ecology of X. arboricola strains. VNTR markers proved to be relatively easy and rapid to use and provide informative data for subtyping bacterial strains. VNTR analysis will gain more attention in the future because of the availability of more Xanthomonas genomes sequenced, since VNTRs can rapidly be characterized by PCRs with specific primers based on the flanking regions of the tandem repeats.

Based on the population structure of X. arboricola described in this study, we can presume that pathovars result from a selection of host-specialized strains that have been further developed as a single clonal lineage. Nonpathogenic X. arboricola strains were more polymorphic than pathovars and were spread across different geographic locations, suggesting that the plant-bacterium interaction of these nonpathogenic strains occurs differently from plant-pathogen interactions. In this context, the plant-bacterium interactions of representative strains of nonpathogenic X. arboricola defined by MLSA and MLVA (CFBP 7634, CFBP 7645, CFBP 7651, CFBP 7652, and CFBP 7653) were assessed on a range of plants, including P. persica, R. sativus, L. esculentum, C. annum, and N. benthamiana. None of the xanthomonad strains tested induced disease symptoms when inoculated into Prunus and Raphanus leaves. However, L. esculentum, C. annum and N. benthamiana were resistant to strains CFBP 7651 and CFBP 7652 as local cell death was noticed at the point of inoculation, while CFBP 7634, CFBP 7653, and CFBP 7645 did not induce any disease symptoms on these plants. According to the results obtained from pathogenicity and HR assays, the following questions arise: (i) why do some nonpathogenic strains induce cell death when inoculated into tomato, pepper, and tobacco leaves whereas others do not? and (ii) what are the molecular pathogenicity determinants that differ between pathogenic and nonpathogenic strains and induce the inability of nonpathogenic strains to cause disease on plant species tested and especially on walnut?

Previous studies reported that the repertoires of T3Es within Xanthomonas strains play a basic role in aggressiveness and host specificity (25), and more recently, Hajri et al. (27) investigated the variability of T3E repertoires in the species X. arboricola, showed that T3SS is an essential virulence mechanism in X. arboricola, and suggested the use of nonpathogenic strains to test whether a modification in T3E repertoire would lead to changes in the pathogenic behavior of the bacterium. Thus, the distribution of 18 T3Es, which are the core sets of T3Es present in X. arboricola pv. juglandis (27), was investigated together with the presence or absence of genes coding for the highly conserved T3SS of the Hrp2 family. We noticed congruence between the composition of T3E repertoires and phylogenetic structure of the nonpathogenic strains in three major groups. Interestingly, no T3SS was detected in NP1, NP3, and CFBP 7653, although these strains clearly belong to X. arboricola. The groups of strains defined by MLSA, i.e., NP1, NP3, and the strain CFBP 7653, lack an hrp-hrc cluster, whereas strains CFBP 1022, 7630, 7652, and NP2 encoded a typical hrp-type T3SS. The major common attribute of strains belonging to NP1 and NP3 is the lack of T3SS genes and the inability to elicit any HR or cause disease symptoms in any of the plants tested. Hence, we can hypothesize that nonpathogenic strains lacking T3SS and containing the T3Es xopR, avrXccA1, and avrBs2 are unable to translocate effectors into plant cells, which may explain their inability to cause disease on plant species tested and to elicit an HR.

Given that hrpF functions as a translocon of effector proteins into the host cell (42, 43), we can assume that T3Es present in NP1 strains are not translocated into plants inoculated due also to the absence of hrpF, which might explain their inability to elicit an HR on nonhost plants. In fact, previous studies showed that mutation of the hrpF locus of X. oryzae pv. oryzicola strain resulted in the loss of pathogenicity in rice and the ability to induce HR in nonhost tobacco (44). Similarly, mutations in hrpF of X. campestris pv. vesicatoria strain or X. axonopodis pv. glycines strain resulted in strains that were nonpathogenic in host plants and unable to elicit race-specific HRs (44, 45).When corresponding R and avr genes are present in the host and pathogen, respectively, the result is disease resistance (46). AvrBs2 is a functional protein reporter for avrBs2-dependent HR activity in plant cells (47). Transient expression of AvrBs2 in BS2 pepper leaves induced a strong HR response. The AvrBs2/Bs2 reporter system has been previously used as a tool to identify translocated effectors in bacterial pathogens that infect other naturally occurring or transgenic BS2 plant lines (48). In addition, we showed that within the species X. arboricola, two isolates, CFBP 7640 and CFBP 7653, do not contain either an hrp-hrc cluster coding for a T3SS or known Xanthomonas T3E genes. Given that the successful establishment of a disease relies on the presence of a T3SS and on the translocation of T3Es (26, 49, 50), it appears that these strains may depend on an entirely nonpathogenic lifestyle. Previous work reported that nonpathogenic Pseudomonas isolates lacking a T3SS are common leaf colonizers of healthy plants and grow as well as or better than other Pseudomonas syringae strains on nonhost species without causing disease (51). Clarke et al. (50) showed later that these strains contain an unusual hrp-hrc cluster that is only distantly related to the canonical P. syringae hrp-hrc cluster.

This study reports on the occurrence of nonpathogenic isolates within the species X. arboricola that do not contain an hrp-hrc cluster coding for a T3SS and of strains that harbor some T3Es but no T3SS-encoding genes. The present finding raises questions about the origin of these nonpathogenic strains and the evolution of plant pathogenicity in X. arboricola. Mohr et al. (51) suggest that loss of the T3SS in one pathogenic strain was the initial event in the evolution of T3SS lacking isolates. They assumed that nonpathogenic Pseudomonas strains most likely evolved from a pathogenic strain ancestor through the loss of its T3SS. The hrp-hrc cluster and most of the effector genes were deleted during the evolution of nonpathogenic strains.

In contrast, pathogenic strains might have evolved from their nonpathogenic ancestors after (i) acquisition of pathogenesis-associated gene clusters (in this context, Lu et al. [52] suggested that acquisition of the hrp clusters was a critical step in the evolution of plant pathogenicity in Xanthomonas), (ii) mutations in genes related to virulence or avirulence function, and (iii) horizontal gene transfer. Nonpathogenic strains were present together with pathogenic ones. They grow or at least survive epiphytically on plants without causing disease. Consequently, these strains have been largely overlooked because of their lower economic importance.

The identified nonpathogenic strains provide excellent tools to elucidate the difference in HR and pathogenicity reactions between these strains and pathogenic ones in relation to their T3E repertoires. T3E genes that were not detected in any nonpathogenic isolates studied are excellent candidates for being responsible for pathogenicity in X. arboricola. Furthermore, these strains could be used to study pathogenicity factors and molecular determinants (particularly effectors), to better understand the basis of host range in Xanthomonas, and to gain insight into molecular determinants of plant resistance and how bacterial pathogenicity works. In fact, it would be interesting to engineer these isolates back into pathogens with different host ranges by adding a functional T3SS or different assortment of effector genes to see whether a modification of the interaction between these strains and plants tested would be observed.

Because of the practical obstacle of extensive pathogenicity tests, the possibility cannot be excluded that some of these nonpathogenic isolates could be pathogenic Xanthomonas strains with an unknown host plant(s), particularly strains belonging to NP2, CFBP 7630, CFBP 1022, and CFBP 7652, which harbor genes of a typical T3SS of the Hrp2 family and seven T3E-encoding genes. Therefore, the use of the term “nonpathogenic” for these strains might not always be correct. In this context, Mohr et al. (51) assumed that nonpathogenic P. syringae strains can live without causing disease on plants for extended periods of time but can cause disease when they find themselves on a susceptible plant under favorable environmental conditions.

Further work is under way to conduct a complete genomic comparison of pathogenic and nonpathogenic strains sequenced, in order to find bacterial functions involved in the epiphytic colonization of plants and to determine common and differential genes within these strains (and other xanthomonads) that could be linked to pathogenicity. Further analysis of sequenced genomes would aid in understanding the function of the missing components of a T3SS in nonpathogenic strains and to provide novel insights into other pathogenicity determinants that may play a role in the plant-bacterium interaction. Among them, particular attention should be paid to genes involved in adhesion, biofilm formation, flagellum synthesis, motility, lipopolysaccharide synthesis, quorum sensing, and finally type IV and VI secretion systems to answer the question regarding the possibility of involvement of other pathogenicity determinants like T4SS and T6SS in NP1 strains that carry T3Es but do not harbor any gene of T3SS. Understanding the acquisition and evolution of type III effectors in X. arboricola may help us to deduce the roles of these proteins in pathogenicity and will help in understanding functions of most T3Es identified in X. arboricola.

Supplementary Material

Supplemental material

ACKNOWLEDGMENTS

This project was financed by Direction Générale de l'Armement (REI project 2010 34007).

We thank the Collection Française de Bactéries associées aux Plantes (CIRM-CFBP), INRA, Angers, France, for providing X. arboricola strains and their corresponding sequences of the seven investigated genes and Annie Micoud, Anses, Lyon, France, for providing X. arboricola isolates. We thank Jacky Guillaumès and Mathilde Mullard for their contributions in biochemical and pathogenicity tests.

Footnotes

Supplemental material for this article may be found at http://dx.doi.org/10.1128/AEM.00835-15.

REFERENCES

  • 1.Lindow SE, Brandl MT. 2003. Microbiology of the phyllosphere. Appl Environ Microbiol 69:1875–1883. doi: 10.1128/AEM.69.4.1875-1883.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Gonzalez C, Restrepo S, Tohme J, Verdier V. 2002. Characterization of pathogenic and nonpathogenic strains of Xanthomonas axonopodis pv. manihotis by PCR-based DNA fingerprinting techniques. FEMS Microbiol Lett 215:23–31. [DOI] [PubMed] [Google Scholar]
  • 3.Vauterin L, Yang P, Alvarez A, Takikawa Y, Roth DA, Vidaver AK, Stall RE, Kersters K, Swings J. 1996. Identification of non-pathogenic Xanthomonas strains associated with plants. Syst Appl Microbiol 19:96–105. doi: 10.1016/S0723-2020(96)80016-6. [DOI] [Google Scholar]
  • 4.Rademaker JLW, Hoste B, Louws FJ, Kersters K, Swings J, Vauterin L, Vauterin P, de Bruijn FJ. 2000. Comparison of AFLP and rep-PCR genomic finger printing with DNA-DNA homology studies: Xanthomonas as a model system. Int J Syst Evol Microbiol 50:665–677. doi: 10.1099/00207713-50-2-665. [DOI] [PubMed] [Google Scholar]
  • 5.Vauterin L, Hoste B, Kersters K, Swings J. 1995. Reclassification of Xanthomonas. Int J Syst Bacteriol 45:472–489. doi: 10.1099/00207713-45-3-472. [DOI] [Google Scholar]
  • 6.Rademaker JLW, Louws FJ, Schultz MH, Rossbach U, Vauterin L, Swings J, de Bruijn FJ. 2005. A comprehensive species to strain taxonomic framework for Xanthomonas. Phytopathology 95:1098–1111. doi: 10.1094/PHYTO-95-1098. [DOI] [PubMed] [Google Scholar]
  • 7.Scortichini M, Marchesi U, Di Prospero P. 2001. Genetic diversity of Xanthomonas arboricola pv. juglandis (synonyms: X. campestris pv. juglandis; X. juglandis pv. juglandis) strains from different geographical areas shown by repetitive polymerase chain reaction genomic fingerprinting. J Phytopathol 149:325–332. doi: 10.1046/j.1439-0434.2001.00628.x. [DOI] [Google Scholar]
  • 8.Loreti S, Gallelli A, Belisario A, Wajnberg E, Corazza L. 2001. Investigation of genomic variability of Xanthomonas arboricola pv. juglandis by AFLP analysis. Eur J Plant Pathol 107:583–591. doi: 10.1023/A:1017951406237. [DOI] [Google Scholar]
  • 9.Boudon S, Manceau C, Nottegehm JL. 2005. Structure and origin of Xanthomonas arboricola pv. pruni population causing bacterial necrotic spot on stone fruit trees in Western Europe. Phytopathol 95:1081–1088. doi: 10.1094/PHYTO-95-1081. [DOI] [PubMed] [Google Scholar]
  • 10.Hajri A, Meyer D, Delort F, Guillaumès J, Brin C, Manceau C. 2010. Identification of a genetic lineage within Xanthomonas arboricola pv. juglandis as the causal agent of vertical oozing canker of Persian (English) walnut in France. Plant Pathol 59:1014–1022. doi: 10.1111/j.1365-3059.2010.02362.x. [DOI] [Google Scholar]
  • 11.Parkinson N, Cowie C, Heeney J, Stead D. 2009. Phylogenetic structure of Xanthomonas determined by comparison of gyrB sequences. Int J Syst Evol Microbiol 59:264–274. doi: 10.1099/ijs.0.65825-0. [DOI] [PubMed] [Google Scholar]
  • 12.Young JM, Park DC, Shearman HM, Fargier E. 2008. A multilocus sequence analysis of the genus Xanthomonas. Syst Appl Microbiol 31:366–377. doi: 10.1016/j.syapm.2008.06.004. [DOI] [PubMed] [Google Scholar]
  • 13.Young JM, Wilkie JP, Park DC, Watson DRW. 2010. New Zealand strains of plant pathogenic bacteria classified by multi-locus sequence analysis; proposal of Xanthomonas dyei sp. nov. Plant Pathol 59:270–281. doi: 10.1111/j.1365-3059.2009.02210.x. [DOI] [Google Scholar]
  • 14.Fargier E, Fischer-Le Saux M, Manceau C. 2011. A multilocus sequence analysis of Xanthomonas campestris reveals a complex structure within crucifer-attacking pathovars of this species. Syst Appl Microbiol 34:156–165. doi: 10.1016/j.syapm.2010.09.001. [DOI] [PubMed] [Google Scholar]
  • 15.Postic D, Garnier M, Baranton G. 2007. Multilocus sequence analysis of atypical Borrelia burgdorferi sensu lato isolates—description of Borrelia californiensis sp. nov., and genomospecies 1 and 2. Int J Med Microbiol 297:263–271. doi: 10.1016/j.ijmm.2007.01.006. [DOI] [PubMed] [Google Scholar]
  • 16.Bergsma-Vlami M, Martin W, Koenraadt H, Teunissen H, Pothier JF, Duffy B, van Doorn J. 2012. Molecular typing of Dutch isolates of Xanthomonas arboricola pv. pruni isolated from ornamental cherry laurel. Plant Pathol 94:S1.29–S1.35. [Google Scholar]
  • 17.Gironde S, Manceau C. 2012. Housekeeping gene sequencing and multilocus variable-number tandem-repeat analysis to identify subpopulations within Pseudomonas syringae pv. maculicola and Pseudomonas syringae pv. tomato that correlate with host specificity. Appl Environ Microbiol 78:3266–3279. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Lindstedt BA. 2005. Multiple-locus variable number tandem repeats analysis for genetic fingerprinting of pathogenic bacteria. Electrophoresis 26:2567–2582. doi: 10.1002/elps.200500096. [DOI] [PubMed] [Google Scholar]
  • 19.Noller AC, McEllistrem MC, Pacheco AG, Boxrud DJ, Harrison LH. 2003. Multilocus variable-number tandem repeat analysis distinguishes outbreak and sporadic Escherichia coli isolates. J Clin Microbiol 41:5389–5397. doi: 10.1128/JCM.41.12.5389-5397.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Tien YY, Wang YW, Tung SK, Liang SY, Chiou CS. 2011. Comparison of multilocus variable-number tandem repeat analysis and pulsed-field gel electrophoresis in molecular subtyping of Salmonella enterica serovars paratyphi A. Diagn Microbiol Infect Dis 69:1–6. doi: 10.1016/j.diagmicrobio.2010.08.012. [DOI] [PubMed] [Google Scholar]
  • 21.Zhao S, Poulin L, Rodriguez-R LM, Serna NF, Liu SY, Wonni I, Szurek B, Verdier V, Leach JE, He YQ, Feng JX, Koebnik R. 2012. Development of a variable number of tandem repeats typing scheme for the bacterial rice pathogen Xanthomonas oryzae pv. oryzicola. Phytopathology 102:948–956. doi: 10.1094/PHYTO-04-12-0078-R. [DOI] [PubMed] [Google Scholar]
  • 22.Alfano JR, Collmer A. 1997. The type III (Hrp) secretion pathway of plant pathogenic bacteria: trafficking harpins, Avr proteins, and death. J Bacteriol 179:5655–5662. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Bonas U. 1994. hrp genes of phytopathogenic bacteria. Curr Top Microbiol Immunol 192:79–98. [DOI] [PubMed] [Google Scholar]
  • 24.Bonas U, Lahaye T. 2002. Plant disease resistance triggered by pathogen-derived molecules: refined models of specific recognition. Curr Opin Microbiol 5:44–50. doi: 10.1016/S1369-5274(02)00284-9. [DOI] [PubMed] [Google Scholar]
  • 25.Hajri A, Brin C, Hunault G, Lardeux F, Lemaire C, Manceau C, Boureau T, Poussier S. 2009. A ‘repertoire for repertoire’ hypothesis: repertoires of type three effectors are candidate determinants of host specificity in Xanthomonas. PLoS One 4:e6632. doi: 10.1371/journal.pone.0006632. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Alfano JR, Collmer A. 2004. Type III secretion system effector proteins: double agents in bacterial disease and plant defense. Annu Rev Phytopathol 42:385–414. doi: 10.1146/annurev.phyto.42.040103.110731. [DOI] [PubMed] [Google Scholar]
  • 27.Hajri A, Pothier JF, Fischer-Le Saux M, Bonneau S, Poussier S, Boureau T, Duffy B, Manceau C. 2012. Type three effector gene distribution and sequence analysis provide new insights into the pathogenicity of plant-pathogenic Xanthomonas arboricola. Appl Environ Microbiol 78:371–384. doi: 10.1128/AEM.06119-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Leslie CA, Uratsu SL, McGranahan G, Dandekar AM. 2006. Walnut (Juglans). Methods Mol Biol 344:297–307. [DOI] [PubMed] [Google Scholar]
  • 29.Arquero O, Lovera M, Rodriguez R, Salguero A, Trapero A. 2005. Characterization and development of necrotic lesions of walnut tree fruits in southern Spain. Acta Hortic 705:457–461. [Google Scholar]
  • 30.Belisario A, Maccaroni M, Corazza L, Balmas V, Valier A. 2002. Occurrence and etiology of brown apical necrosis on Persian (English) walnut fruit. Plant Dis 86:599–602. doi: 10.1094/PDIS.2002.86.6.599. [DOI] [PubMed] [Google Scholar]
  • 31.Moragrega C, Ozaktan H. 2010. Apical necrosis of Persian (English) walnut (Juglans regia): an update. J Plant Pathol 92:67–71. [Google Scholar]
  • 32.Randhawa PS, Civerolo EL. 1985. A detached-leaf bioassay for Xanthomonas campestris pv. pruni. Phytopathol 75:1060–1063. doi: 10.1094/Phyto-75-1060. [DOI] [Google Scholar]
  • 33.Drummond AJ, Ashton B, Cheung M, Heled J, Kearse M, Moir R, Stones-Havas S, Thierer T, Wilson A. 2009. Geneious v.4.8. http://www.geneious.com. [Google Scholar]
  • 34.Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser 41:95–98. [Google Scholar]
  • 35.Thompson JD, Higgins DG, Gibson TJ. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22:4673–4680. doi: 10.1093/nar/22.22.4673. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Tamura K, Dudley J, Nei M, Kumar S. 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 24:1596–1599. doi: 10.1093/molbev/msm092. [DOI] [PubMed] [Google Scholar]
  • 37.Kimura M. 1980. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J Mol Evol 16:111–120. doi: 10.1007/BF01731581. [DOI] [PubMed] [Google Scholar]
  • 38.Cesbron S, Pothier J, Gironde S, Jacques MA, Manceau C. 2014. Development of multilocus variable-number tandem repeat analysis (MLVA) for Xanthomonas arboricola pathovars. J Microbiol Methods 100:84–90. doi: 10.1016/j.mimet.2014.02.017. [DOI] [PubMed] [Google Scholar]
  • 39.Radomski N, Thibault VC, Karoui C, de Cruz K, Cochard T, Gutiérrez C, Supply P, Biet F, Boschiroli ML. 2010. Determination of genotypic diversity of Mycobacterium avium subspecies from human and animal origins by mycobacterial interspersed repetitive-unit-variable-number tandem-repeat and IS1311 restriction fragment length polymorphism typing methods. J Clin Microbiol 48:1026–1034. doi: 10.1128/JCM.01869-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Schaad NW. 1988. Identification schemes. Xanthomonas, p 81–94. In Schaad NW. (ed), Laboratory guide for identification of plant pathogenic bacteria, 2nd ed American Phytopathological Society, St. Paul, MN. [Google Scholar]
  • 41.Pothier JF, Pagani MC, Pelludat C, Ritchie DF, Duffy B. 2011. A duplex-PCR method for species- and pathovar-level identification and detection of the quarantine plant pathogen Xanthomonas arboricola pv. pruni. J Microbiol Methods 86:16–24. doi: 10.1016/j.mimet.2011.03.019. [DOI] [PubMed] [Google Scholar]
  • 42.Büttner D, Nennstiel D, Klüsener B, Bonas U. 2002. Functional analysis of hrpF, a putative type III translocon protein from Xanthomonas campestris pv. vesicatoria. J Bacteriol 184:2389–2398. doi: 10.1128/JB.184.9.2389-2398.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Rossier O, Van den Ackerveken G, Bonas U. 2000. HrpB2 and HrpF from Xanthomonas are type III-secreted proteins and essential for pathogenicity and recognition by the host plant. Mol Microbiol 38:828–838. doi: 10.1046/j.1365-2958.2000.02173.x. [DOI] [PubMed] [Google Scholar]
  • 44.Zou LF, Wang XP, Xiang Y, Zhang B, Li YR, Xiao YL, Wang JS, Walmsley AR, Chen GY. 2006. Elucidation of the hrp clusters of Xanthomonas oryzae pv. oryzicola that control the hypersensitive response in nonhost tobacco and pathogenicity in susceptible host rice. Appl Environ Microbiol 72:6212–6224. doi: 10.1128/AEM.00511-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Kim JG, Park BK, Yoo CH, Jeon E, Oh J, Hwang I. 2003. Characterization of the Xanthomonas axonopodis pv. glycines Hrp pathogenicity island. J Bacteriol 185:3155–3166. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Flor H. 1971. Current status of the gene-for-gene concept. Annu Rev Phytopathol 9:275–296. doi: 10.1146/annurev.py.09.090171.001423. [DOI] [Google Scholar]
  • 47.Mudgett MB, Chesnokova O, Dahlbeck D, Clark ET, Rossier O, Bonas U, Staskawicz BJ. 2000. Molecular signals required for type III secretion and translocation of the Xanthomonas campestris AvrBs2 protein to pepper plants. Proc Natl Acad Sci U S A 97:13324–13329. doi: 10.1073/pnas.230450797. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Roden JA, Belt B, Ross JB, Tachibana T, Vargas J, Mudgett MB. 2004. A genetic screen to isolate type III effectors translocated into pepper cells during Xanthomonas infection. Proc Natl Acad Sci U S A 101:16 624-16 629. doi: 10.1073/pnas.2235688100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Gürlebeck D, Thieme F, Bonas U. 2006. Type III effector proteins from the plant pathogen Xanthomonas and their role in the interaction with the host plant. J Plant Physiol 163:233–255. doi: 10.1016/j.jplph.2005.11.011. [DOI] [PubMed] [Google Scholar]
  • 50.Clarke CR, Cai R, Studholme DJ, Guttman DS, Vinatzer BA. 2010. Pseudomonas syringae strains naturally lacking the classical P. syringae hrp/hrc locus are common leaf colonizers equipped with an atypical type III secretion system. Mol Plant Microbe Interact 23:198–210. doi: 10.1094/MPMI-23-2-0198. [DOI] [PubMed] [Google Scholar]
  • 51.Mohr TJ, Liu H, Yan S, Morris CE, Castillo JA, Jelenska J, Vinatzer BA. 2008. Naturally occurring nonpathogenic isolates of the plant pathogen Pseudomonas syringae lack a type III secretion system and effector gene orthologues. J Bacteriol 190:2858–2870. doi: 10.1128/JB.01757-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Lu H, Patil P, Van Sluys MA, White FF, Ryan RP, Dow JM, Rabinowicz J, Salzberg SL, Leach JE, Sonti R, Brendel V, Bogdanove AJ. 2008. Acquisition and evolution of plant pathogenesis-associated gene clusters and candidate determinants of tissue-specificity in Xanthomonas. PLoS One 3:e3828. doi: 10.1371/journal.pone.0003828. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental material

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES