Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2015 Jul 21;81(16):5519–5526. doi: 10.1128/AEM.00906-15

pSW2, a Novel Low-Temperature-Inducible Gene Expression Vector Based on a Filamentous Phage of the Deep-Sea Bacterium Shewanella piezotolerans WP3

Xin-Wei Yang a,b, Hua-Hua Jian a, Feng-Ping Wang a,✉
Editor: K E Wommack
PMCID: PMC4510180  PMID: 26048946

Abstract

A low-temperature-inducible protein expression vector (pSW2) based on a filamentous phage (SW1) of the deep-sea bacterium Shewanella piezotolerans WP3 was constructed. This vector replicated stably in Escherichia coli and Shewanella species, and its copy number increased at low temperatures. The pSW2 vector can be utilized as a complementation plasmid in WP3, and it can also be used for the production of complex cytochromes with multiple heme groups, which has the potential for application for metal ion recovery or bioremediation. Promoters of low-temperature-inducible genes in WP3 were fused into the vector to construct a series of vectors for enhancing protein expression at low temperature. The maximum green fluorescent protein intensity was obtained when the promoter for the hfq gene was used. The WP3/pSW2 system can efficiently produce a patatin-like protein (PLP) from a metagenomic library that tends to form inclusion bodies in E. coli. The yields of PLP in the soluble fraction were 8.3 mg/liter and 4.7 mg/liter of culture at 4°C and 20°C, respectively. Moreover, the pSW2 vector can be broadly utilized in other Shewanella species, such as S. oneidensis and S. psychrophila.

INTRODUCTION

The genus Shewanella can metabolize a broad range of metal and organic substances, such as U(VI), Tc(VII), and Cr(VI), trimethylamine-N-oxide (TMAO), dimethyl sulfoxide (DMSO), and fumarate (1). Therefore, Shewanella species are considered to be candidates for the bioremediation of metal and organic contaminants (2). Most of the earth's environments, such as the deep ocean and regions of permafrost, are at low temperatures; therefore, the application of Shewanella and/or other organisms for bioremediation in such environments would require strains that are adapted to low temperatures and an understanding of the effects of low temperatures on the metabolism of these organisms. Low-temperature-adapted (psychrophilic/psychrotrophic) Shewanella strains have been isolated from the deep sea, the Antarctic, and other cold environments (3–5). However, genetic manipulation tools or expression systems that can be utilized at low temperatures are limited (6), which has greatly hindered the research on low-temperature Shewanella organisms and their potential applications.

Shewanella piezotolerans WP3 (here referred to as WP3) was isolated from deep-sea sediments. Although its optimal growth temperature is 20°C, it can grow within a temperature range of 0 to 28°C (7). WP3 contains a filamentous phage, named SW1 (7,718 bp) (8), that can exist as an extrachromosomal plasmid (double-stranded, replicative-form [RF] DNA) or integrate into the chromosome (7). The copy number of the SW1 RF DNA is temperature dependent and increases from approximately 10 copies at 20°C to approximately 30 copies at 4°C in the mid-stationary phase; the copy numbers peak in the late stationary phase at both temperatures (9). This low-temperature-induced SW1 phage could be used for the development of a genetic manipulation tool and a protein expression system.

To our knowledge, most of the heterologous protein production systems in psychrophiles use a mesophile-derived plasmid with a broad host range. These systems include those for the expression of β-lactamase using broad-host-range vector pJRD215 in Shewanella sp. strain Ac10 (6), the expression of a thermolabile luciferase using a pJB3-derived plasmid in an Antarctic strain growing at 15°C (10), and the production of a β-galactosidase using an RSF1010 (IncQ) derivative in a piezopsychrophile, Photobacterium profundum SS9 (11). Of these, the pGEM-derived plasmid-based low-temperature expression system with a Pseudoalteromonas haloplanktis host was the most efficient system (12). This gene expression system is inducible at low temperatures and is strongly induced by the presence of l-malate in the culture medium (13). The successful production of several thermolabile, aggregation-prone proteins and a recombinant antibody fragment was obtained by this system in a certain medium (14, 15).

Here, we report our work on the construction of a low-temperature-inducible protein expression vector based on a filamentous WP3 phage. The vector could be used as a complementation plasmid for gene functional analysis in WP3. The pSW2 copy number was increased at low temperatures, indicating its potential as a low-temperature protein expression vector. A green fluorescent protein (GFP) reporter gene was introduced into the plasmid to screen for promoters of cold-inducible genes in WP3. Finally, we used this newly developed system (WP3/pSW2) to produce a foreign protein from an environmental sample which formed an inclusion body in the Escherichia coli expression system at low temperatures.

MATERIALS AND METHODS

Bacterial strains, plasmids, and culture conditions.

The bacterial strains and plasmids used in this study are listed in Table 1. Cultures of Escherichia coli and Shewanella oneidensis MR-1 were grown aerobically in Luria-Bertani medium at 37°C and 30°C, respectively. S. piezotolerans WP3 and Shewanella psychrophila WP2 were cultured aerobically in modified marine medium 2216E (5 g tryptone, 1 g yeast extract, 34 g sodium chloride, and 50 mg FePO4 per liter) at 20°C or 4°C (WP3) and 15°C (WP2). Ampicillin (Ap) and chloramphenicol (Cm; Chloromycetin) were added to the medium, when required, at concentrations of 100 μg ml−1 Ap for E. coli and 25 μg ml−1 and 12.5 μg ml−1 Cm for E. coli and Shewanella species, respectively.

TABLE 1.

Bacterial strains and plasmids used in this study

Bacterial strain or plasmid Relevant characteristic(s) Source (reference)
Strains
    E. coli
        DH5α Host for regular cloning Lab stock
        WM3064 Donor strain for conjugation Lab stock (35)
    S. piezotolerans
        WP3 S. piezotolerans WP3 wild type Lab stock
        WP3ΔSW1 WP3 wild type without phage SW1 Lab stock (9)
        PR1-PR10 WP3 containing pSW2-P1 to pSW2-P10 (10 different strains) This study
        PR0 WP3 containing pSW2 This study
        WP3_PLP WP3 containing pSW2-PLP This study
        SW1 Natural phage isolated from WP3 Lab stock
Plasmids
    pUC19 Expression vector Lab stock
    pRE112 Allelic exchange vector Lab stock (19)
    pMD18-T Cloning vector Lab stock
    pCC2FOS Expression vector Lab stock
    pI2 Expression vector Lab stock
    pSW1 Double-stranded, RF phage DNA This study
    pSW2 Vector based on the natural phage This study
    pSW3 pSW2 containing the pepN gene Lab stock
    pSW2-Fur pSW2 containing fur Lab stock
    pSW2-PLP pSW2 containing the gene encoding a patatin protein with the promoter PR9 This study
    pSW2-P1-P9 pSW2 containing PR1 to PR9 (an ∼300-bp sequence upstream of the selected genes) in front of gfp (9 different plasmids) This study
    pSW2-P10 pSW2 containing gfp This study
    WP2_P9 Shewanella psychrophila WP2 containing pSW2-P9 This study
    WP2_SW2 Shewanella psychrophila WP2 containing pSW2 This study
    MR-1_P9 Shewanella oneidensis MR-1 containing pSW2-P9 This study
    MR-1_SW2 Shewanella oneidensis MR-1 containing pSW2 This study

For anaerobic cultivation, an oligotrophic medium (0.1 g tryptone, 0.2 g yeast extract, 34 g sodium chloride, 4.8 g HEPES, and 3.4 ml sodium lactate per liter) was dispensed into serum bottles gassed with O2-free nitrogen. After the medium was autoclaved, electron acceptors (EAs) were added at the required concentrations (2 mM nitrite or 15 mM hydrous ferric oxide [HFO]), when needed. The HFO solution was prepared according to a previously described procedure (16). The Fe2+ concentration was determined by measuring the absorbance at 562 nm on a Shimadzu UV-2550 spectrophotometer (Shimadzu Co., Kyoto, Japan) following the ferrozine method after extraction with 1 N HCl (17). All physiological studies were performed in triplicate, and the average values and standard deviations were calculated.

Construction of pSW2 on the basis of the SW1 phage.

pSW2 is a derivative of the SW1 phage isolated from the deep-sea bacterium WP3 (8). The construction procedure was as follows. First, RF SW1 (pSW1) was isolated from WP3 using a modified method for plasmid extraction (9). Second, a fusion fragment (Cm-ori) consisting of the antibiotic resistance marker (Cm) and the origin of replication (ori) with an AflII recognition site at the 5′ end was constructed by the overlap extension PCR technique. The 800-bp fragment encoding the Cm antibiotic marker was amplified from pCC2FOS using primers Cm-For and Cm-Rev, and the 588-bp origin-of-replication fragment was amplified from the pMD18-T vector with primers ori-For and ori-Rev. Third, a fusion fragment (oriT-MCS) consisting of an origin of transfer (oriT) and multiple-cloning site (MCS) with the MluI recognition site at the 3′ end was constructed by the overlap extension PCR technique. The 234-bp oriT fragment was amplified from pRE112 with primers oriT-For and oriT-Rev, and the 50-bp MCS fragment was amplified from pUC19 with primers MCS-For and MCS-Rev. Finally, the Cm-ori fusion fragment and the oriT-MCS fusion fragment were used as DNA templates for the amplification of the full-length Cm-MCS fragment with primers Cm-For and MCS-Rev, generating a PCR product with AflII and MluI recognition sites at each end. The amplicon of the Cm-MCS fragment was ligated to the AflII and MluI sites of pSW1, which had already been cut by the two enzymes (Fig. 1). All primers used in this study are presented in Table 2.

FIG 1.

FIG 1

Construction of the phage SW1-based pSW2 vector. A detailed methodology for the construction of pSW2 can be found in Materials and Methods. The vector components include oriT, an origin of transfer from E. coli to Shewanella species; ori, a high-copy-number E. coli origin of replication; chlR, a gene conferring chloramphenicol resistance to E. coli and Shewanella species; fpsABCDR, the structural genes of the SW1 phage; and multiple-cloning sites (MCSs), which enable the insertion of coding sequences into the vectors. These components are shown in the vector diagrams.

TABLE 2.

Primers used in this study

Primer purpose and primera 5′–3′ oligonucleotide sequence
Construction
    Cm-For GCCCCTTAAGCGCTTATTATCACTTATTCA
    Cm-Rev TATGGAAAATAAATAAATCCTGGTGTCC
    ori-For TTATTTATTTTCCATAGGCTCCGCCCCC
    ori-Rev CAGCGGAAAATTGAGATCCTTTTTTTCTGC
    oriT-For AGGATCTCAATTTTCCGCTGCATAACCCTG
    oriT-Rev GCTCCTCGAGGCCAGCCTCGCAGAGCAGGA
    MCS-For CGAGGCTGGCCTCGAGGAGCTCGGTACCCG
    MCS-Rev CGCCACGCGTGCATGCCTGCAGGTCGACTC
RT-PCR
    pepN-For AGGATCTCAATTTTCCGCTGCATAACCCTG
    pepN-Rev GCTCCTCGAGGCCAGCCTCGCAGAGCAGGA
    attP-For CGAGGCTGGCCTCGAGGAGCTCGGTACCCG
    attP-Rev CGCCACGCGTGCATGCCTGCAGGTCGACTC
Expression
    gfp-For AAAACTGCAGATGGTGAGCAAGGGCGAGGA
    gfp-Rev CGCGACGCGTTTACTTGTACAGCTCGTCCATG
    cymA-For CGGGATCCAGACCCACCTTTTGAGGAAA
    cymA-Rev CCGCTCGAGTCCACTTCTGCTTTGCATTG
    PLP-For GGTTCTCGAGACTTAATTTGGCTTGAAAGC
    PLP-Rev TCGGACGCGTTTAGCAGCCGGATCTCAGTG
a

For, forward; Rev, reverse.

pSW2 copy number determination.

The copy number of the phage-based vector pSW2 was estimated by real-time PCR (RT-PCR) as described previously (9). The pepN gene was inserted into the pSW2 MCS to generate pSW3 (the reference gene) and the attP site of SW1 in pSW2 (the target sequences). RT-PCR was performed using a 7500 real-time PCR system (ABI, San Francisco, CA, USA) in reaction mixtures with total volumes of 20 μl containing 10 μl SYBR green I universal PCR master mix (ABI), 0.5 mM each primer (Table 2), and 1 μl DNA template. The amount of the target was normalized to that of the reference gene pepN, which is a single-copy gene in the WP3 genome. The RT-PCR assays were performed in triplicate for each sample, and a mean value and standard deviation were calculated for the copy number of the phage-based vector pSW2.

Construction of plasmids for screening the low-temperature-inducible promoters.

The coding sequence for GFP was amplified by PCR using plasmid pI2 as a template with primers gfp-For and gfp-Rev (Table 2). The immediate upstream regions (approximately 300 bp; see Table S1 in the supplemental material) of the initiation codons of the selected genes were amplified and fused to the gfp sequence using two different restriction enzymes sites. After the PCR products were ligated to pSW2, the recombinant promoter-trapping plasmids were introduced into WM3064 and then transferred to WP3 by conjugation. These strains were grown to mid-stationary phase at 4°C and 20°C. The cells were then collected to assess the level of GFP production. Two milliliters of each culture was centrifuged, washed with 3.4% (wt/vol) NaCl solution, and diluted to an optical density at 600 nm (OD600) of 1.0. An Enspire 2300 multilabel reader (PerkinElmer, CT, USA) was used to record the level of GFP expression, and the samples were analyzed under an excitation wavelength of 488 nm and an emission wavelength of 509 nm at 25°C. To ensure that the values recorded were due to GFP expression, the pSW2-transformed cultures were used as the appropriate blank for the calculation of the relative number of fluorescence units. All experiments were performed in triplicate independent cultures, and the average and standard deviation were calculated.

Molecular cloning, expression, purification, and assay of the activity of the PLP gene in WP3.

For the molecular cloning of a gene encoding a patatin-like protein (PLP), high-fidelity PCR was used to amplify the PLP gene from the Guaymas metagenomic library using a forward primer (Table 2) that included the sequence for the His tag. The PLP sequence was inserted into pSW2 with the hfq promoter and was then transferred to WP3 by conjugation. After homogenizing the harvested cells by sonication, the supernatant of the cell extracts was used to purify PLP using Ni2+-affinity chromatography. The purified PLP was then subjected to sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) and quantified using the Bradford protein assay. The activity of PLP was assessed using p-nitrophenyl esters of butyrate as the substrate. The reaction mixture contained the p-nitrophenyl ester in DMSO, 1× phosphate-buffered saline buffer, and the purified enzyme solution. After incubation at 50°C for 5 min, the absorbance at 405 nm was measured to detect the released p-nitrophenol (18).

RESULTS AND DISCUSSION

Construction of shuttle vector pSW2.

The shuttle vector pSW2, which can replicate in both E. coli and WP3, was constructed. As shown in Fig. 1A, the construction of pSW2 was based on the extrachromosomal plasmid of filamentous phage SW1 isolated in WP3. Three genes (fpsE, fpsF, fpsG) involved in the structural module of SW1 and one gene (fpsH) involved in the assembly module of SW1 were removed to introduce the necessary parts of a shuttle vector. The pMD18-derived origin of replication (oriC) was responsible for the replication of pSW2 in E. coli DH5α or E. coli WM3064. pSW2 was transferred into WP3 by conjugal transfer using E. coli WM3064 as the donor. The conjugative transfer initiation origin (oriT), derived from pRE112, was recognized by some proteins (encoded by the mob gene cluster) involved in plasmid DNA mobilization from the donors to the psychrophilic recipient cells during conjugation. The transfer efficiency was calculated to be 10−3 to 10−4, which is high enough to perform the gene expression assay. Both E. coli and WP3 are sensitive to chloramphenicol, so the pCC2FOS-derived chloramphenicol resistance gene (chlR) was chosen as a selective marker in pSW2. The fpsA gene (encoding a replication protein), based on phage SW1, was responsible for the replication of pSW2 in the psychrophilic host WP3.

pSW2 is induced by low temperatures.

Our previous study found that the filamentous phage SW1 was significantly induced at low temperatures, and the copy number of its extrachromosomal plasmids was also increased at low temperatures (9). To determine the copy number of pSW2, the sequences of the pepN gene and the attP site were amplified by real-time PCR using DNA from the E. coli and WP3 strains in mid-stationary growth phase at 37°C (E. coli) or 4°C or 20°C (WP3) as the amplification templates (9). The estimated copy number of pSW2 in E. coli was approximately 56 at 37°C. In WP3, the copy number of pSW2 was approximately 12 at 20°C, and this value increased to 30 at 4°C (see Fig. S1 in the supplemental material), suggesting the induction of pSW2 DNA replication in WP3 at low temperatures. When cultured in medium containing chloramphenicol, the pSW2 vector was retained with the same copy number in E. coli and WP3 cells, even after 100 generations (data not shown).

pSW2 as a complementation plasmid in WP3.

The plasmid pRE112, constructed by Edwards et al. (19), was used for gene knockout in WP3. However, no complementation plasmid was successfully constructed to confirm the predicted features in WP3. The expression vectors pBBR1MCS5-1, pHG101, and pHG102, which are based on the broad-host-range cloning vector pBBR1MCS, have been widely used as complementation plasmids in several Shewanella species, such as S. oneidensis MR-1 (20–24). The preliminary experiments revealed that the pBBR1MCS5-1 vector and its derivatives were not suitable for WP3 for unknown reasons (our laboratory data). To detect whether this phage-based pSW2 could act as a complementation plasmid in WP3, a targeted ferric uptake regulator (fur) gene and its native promoter were ligated into pSW2 and introduced into a fur mutant strain. The pSW2 vector harboring the fur gene restored growth to a level comparable to that of the wild type under nitrite-respiring conditions in the fur mutant (see Fig. S2 in the supplemental material), demonstrating the successful utilization of pSW2 as a complementation plasmid in WP3. pSW2 was also demonstrated to be successful for use in gene complementation analysis in our previous studies (16, 25).

Production of complex cytochromes in WP3.

In addition to serving as a complementation vector, pSW2 can be used for the production of complex cytochromes with multiple heme groups. The genome of WP3 encodes a large number of predicted cytochrome c genes and contains accessory proteins that promote the correct processing of the apocytochromes into mature proteins. We introduced the mtrABC gene cluster with its own promoter from the WP3 genome into the pSW2 vector. The mtrABC gene cluster encodes proteins controlling metal reduction and bioremediation processes in various Shewanella species (1, 26). Among them, mtrA encodes a periplasmic decaheme cytochrome c, mtrC encodes a cell surface decaheme cytochrome, and mtrB encodes an integral outer membrane protein. The constructed pSW2-mtrABC plasmid was introduced into WP3 without SW1 (WP3ΔSW1), and its growth and iron-reducing capabilities were measured and compared with those of the WP3ΔSW1 strain with pSW2. The mtrABC-producing strain reduced more iron than the WP3ΔSW1 strain at both temperatures (Fig. 2). Moreover, at 4°C, the difference in iron reduction between the mtrABC-producing strain and the WP3ΔSW1 strain was higher than that observed at 20°C, indicating an induction of pSW2 expression at the lower temperature. Heme staining of the outer membrane and periplasmic electron carriers separated by SDS-PAGE revealed specific protein bands with a stronger signal in preparations of cells from the mtrABC-producing strain than those from the WP3ΔSW1 strain at 4°C (see Fig. S3 in the supplemental material). This could be partly explained by the copy number of the vector, which was higher at 4°C (n = ∼30) than at 20°C (n = ∼12). These results indicate that the WP3/pSW2 system is applicable for the expression of cytochrome c-type cytochromes in the periplasmic space (MtrA) or anchored in the outer membrane (MtrC), and the mtrABC-producing strain acquired a greater respiratory ability for iron reduction due to the overproduction of the mtrABC gene cluster by pSW2.

FIG 2.

FIG 2

Changes in the Fe(II) concentration during bacterial iron reduction by the WP3ΔSW1 (WP3ΔSW1 with pSW2) and the mtrABC-producing (MtrABC) strains at 20°C (left) and 4°C (right) over time. The two strains were cultured in oligotrophic medium with 15 mM hydrous ferric oxide (HFO) as an electron acceptor under anaerobic conditions. The Fe(II) concentration was 0.5 M HCl-extractable Fe(II), as determined by the ferrozine assay. Triplicate experiments were performed, and the error bars show the standard deviations. An independent-samples t test was used to ensure that the differences between the two strains were statistically significant.

Generally, the expression of cytochrome c-type heme proteins is difficult because hemes are covalently linked to the polypeptide chain. Heme attachment to the polypeptide needs special machinery, including cytochrome c maturation (Ccm) proteins in the periplasmic space. Because of the low efficiency of the Ccm machinery, E. coli produces only apocytochromes from the expression of the cytochrome c3 gene (27). To overcome this low efficiency, cytochrome c3 was coexpressed with ccm in E. coli (28). Shewanella produces a variety of cytochrome c-type multiheme cytochromes, suggesting that it should have efficient cytochrome c maturation machinery. S. oneidensis MR-1 has been used for the overproduction of cytochrome c-type multiheme proteins from sulfate-reducing bacteria (SRB) (29, 30) and of a human cytochrome c with the signal sequence from the stc gene of MR-1 (31). Our results indicate that the WP3/pSW2 system can successfully be used for the expression of cytochrome c-type cytochromes. WP3 contains 12 more cytochrome c-type cytochromes than MR-1 and is able to utilize many different electron acceptors in respiration, including soluble and insoluble metal oxides. The overproduction of components related to the anaerobic respiration system makes WP3 more attractive as a model organism for the assessment of bioremediation potential in a deep-sea environment.

Identification of promoters that enhance protein expression in WP3 at low temperatures.

The pSW2 vector was found to be a good candidate for the induction of DNA replication for protein expression in the psychrotrophic bacterium WP3 at low temperatures. To enhance low-temperature protein expression, DNA fragments with high promoter activity were screened in WP3. We analyzed the transcriptome data from this psychrotroph at 4°C and 20°C (unpublished data) and identified proteins that met the following two criteria: (i) 2-fold greater protein expression at 4°C than 20°C [log2 (4°C/20°C) ratio, >1] and (ii) abundant protein production at low temperatures (number of mapped reads per kilobase per million [RPKM], >1,000). Using these two criteria, 9 low-temperature-inducible genes were identified. These genes encoded flagellin (LafA), a cold shock protein (CspA), a phage replication protein (FpsA), an outer membrane protein (OmpA), glutamine synthetase, a hypothetical protein, DEAD box helicase, the ferric uptake regulator (Fur), and a small nuclear ribonucleoprotein (Hfq) (Table 3).

TABLE 3.

Identification of low-temperature-inducible genes using transcriptome analysis

Protein Gene identifier log2 (4°C/20°C) ratio No. of RPKM at 4°C Promoter name
Flagellin (LafA) swp5118 6.18 6,346 PR1
Outer membrane protein (OmpA) swp5089 4.65 1,577 PR2
Cold shock protein (CspA) swp1075 1.76 1,528 PR3
Phage replication protein (FpsA) swp2562 1.52 3,532 PR4
Glutamine synthetase swp0268 1.28 1,431 PR5
Hypothetical protein swp0328 1.2 4,402 PR6
DEAD box helicase swp4551 1.08 1,824 PR7
Ferric uptake regulator (Fur) swp2938 1.06 1,989 PR8
Small nuclear ribonucleoprotein (Hfq) swp0789 1.05 3,101 PR9

The promoter regions (∼300 bp upstream of the translation initiation codons) of these genes were fused to the GFP gene (reporter gene) and inserted into pSW2 to construct promoter-trap pSW2 vectors. Recombinant WP3 cells with the promoter-trap pSW2 vectors were grown to the mid-stationary phase at 20°C and 4°C, and their fluorescence intensities were measured (Fig. 3). Compared with the GFP intensities of the control strains harboring pSW2 (PR0 promoter) and pSW2 without any foreign promoter in front of gfp (PR10 promoter), all strains containing the promoters for the low-temperature-induced genes displayed statistically significant increases in their GFP intensities (paired t test, P < 0.05). The highest GFP intensity was observed in WP3 cells harboring pSW2 with PR9 (the promoter for the Hfq protein) grown at 4°C; this value was ∼7-fold higher than that for the control strains. At 20°C, the highest GFP intensities were found in the strains harboring the PR4 (the promoter for phage replication protein) and PR9 promoters; these values were ∼5-fold higher than those for the control strains. However, the GFP intensities of all the recombinant strains at 4°C were much lower than expected because the induction ratios of all the proteins listed in Table 3 were much higher than 1.5-fold (the highest observed induction ratio from the strain harboring PR3) and the increase in the pSW2 copy number was induced at 4°C. The GFP intensities of the constructs harboring the PR2 (the promoter for the OmpA protein), PR5 (the promoter for glutamine synthetase), PR7 (the promoter for the DEAD box helicase), and PR8 (the promoter for the Fur protein) promoters were even higher at 20°C than at 4°C, indicating that the production of these proteins was mainly regulated at the level of translation. In Shewanella sp. strain Ac10, only 2 of the 27 plasmids containing promoters of low-temperature-induced genes produced higher level of β-lactamase activity at 4°C than at 18°C (6). Eventually, the plasmid with the promoter for the hfq gene with its host WP3 was chosen to assess low-temperature foreign protein expression.

FIG 3.

FIG 3

GFP intensity of the recombinant WP3 cells at 4°C and 20°C. WP3 cells harboring pSW2 with nine different low-temperature-inducible promoters (PR1 to PR9) expressing the GFP reporter gene were incubated to mid-stationary phase in 2216E medium under aerobic conditions at 4°C and 20°C. The fluorescence intensity was quantified using fluorescence spectrometry, as described in Materials and Methods. Cells harboring pSW2 (PR0) were used as a control. PR10 represents cells harboring pSW2 with the GFP reporter gene but lacking a foreign promoter. Data are averages for triplicate cultures.

Protein production using the WP3/pSW2 expression system.

To demonstrate the functionality of the newly developed system at low temperatures, we cloned a gene encoding a patatin-like protein (PLP). PLP belongs to the patatin family and is involved in lipid degradation; it was cloned by screening the Guaymas metagenomic library (15). The gene encoding PLP was inserted into pSW2 (pSW2-PLP) with the hfq promoter and a His tag at its N terminus. When expressed in E. coli using the T7 promoter system (with pET28a as the expression vector), this protein formed inclusion bodies inside the cell. Inclusion body formation was observed even when expression was induced at a lower temperature (15°C). We transferred pSW2-PLP into WP3 and then cultured the WP3_PLP cells at 20°C and 4°C. Recombinant PLP (rPLP) was successfully expressed at both temperatures, and the results of SDS-PAGE (Fig. 4A) and Western blotting against the His-tagged purified proteins (see Fig. S4 in the supplemental material) confirmed the soluble expression of PLP. After desalting, the activity of the purified PLP was shown by the formation of a bright yellow color, indicating patatin activity (Fig. 4B). Thus, patatin was successfully produced as a soluble protein in WP3. Compared to the E. coli T7 promoter system, which is regarded as one of the most powerful expression systems currently available, the low-temperature-adapted WP3/pSW2 system could be suitable for the production of specific proteins that tend to form inclusion bodies in E. coli.

FIG 4.

FIG 4

Production of PLPs using the WP3/pSW2 system. (A) SDS-PAGE analysis of the purified PLPs expressed at 20°C and 4°C in WP3. Lanes: M, protein molecular mass marker; 1, negative control (WP3 cells harboring pSW2); 2, PLP expressed at 20°C in WP3_PLP cells; 3, PLP expressed at 4°C in WP3_PLP cells. (B) Analysis of the activities of PLPs after purification. For the blank, the purified product from the negative control (WP3 cells harboring pSW2) was used as the enzyme solution.

Moreover, on the basis of the findings in lanes 2 and 3 in the SDS-polyacrylamide gel and the activities of the PLPs (Fig. 4), more PLP was expressed at 4°C than at 20°C. This finding is consistent with the observed ability of pSW2 to express higher levels of protein at the low temperature. The yields, as determined using the Bradford protein assay, were 4.7 mg/liter and 8.3 mg/liter of culture at 20°C and 4°C, respectively. The yields of foreign proteins expressed in WP3 at the lower temperature were similar to those of proteins expressed in other cold-adapted host bacteria, such as Shewanella sp. strain Ac10, which produces thermolabile peptidases (PepF and PepQ), and Pseudoalteromonas haloplanktis TAC125, which produces mesophilic β-glucosidase (6, 32). These results suggest that the WP3/pSW2 expression system has the potential to be utilized for fundamental and applied studies on a number of thermolabile proteins at low temperatures.

As a psychrotolerant strain, WP3 was able to grow at 0 to 28°C, with optimal growth occurring at 15 to 20°C. At 20°C, the observed duplication time of WP3 was approximately 100 min, which was 5 times faster than that at 4°C. Of note, WP3 could grow to a high density (up to an OD600 of 4) at both temperatures. With this WP3/pSW2 expression system, it is possible to decrease the cultivation temperature to approximately 0°C. This would be useful for the production of thermolabile proteins, enzymes whose activities are harmful to the host cells, and proteins that tend to form inclusion bodies. The WP3 strain was able to grow under anaerobic conditions and high hydrostatic pressures (0.1 to 50 MPa), making the WP3/pSW2 expression system suitable for the generation of certain proteins from the deep-sea environment, such as hydrostatic pressure-sensitive proteins and oxygen-sensitive proteins.

Utilization of pSW2 as a protein expression vector in other Shewanella species.

To investigate the host range of the pSW2 vector, it was introduced into two other Shewanella species: Shewanella oneidensis MR-1 (33) and Shewanella psychrophila WP2 (5). MR-1, which was originally isolated from a freshwater lake, is a mesophilic bacterium with an optimal growth temperature of approximately 28°C (33). WP2 was isolated from West Pacific sediment (depth, ∼1,910 m) and is a psychrophilic bacterium with an optimal growth temperature of approximately 15°C (5). These species belong to two different Shewanella groups: group 1 consists of psychro- and piezotolerant Shewanella species, such as WP2 and WP3, and group 2 contains mesophilic, pressure-sensitive Shewanella species, such as MR-1 (34). Plasmids that are compatible with MR-1, such as pBBRMCS5-1, cannot be used in WP3 within Shewanella group 1. We used gfp as a reporter gene in the pSW2 vector to test its expression in different hosts. The recombinant plasmid P9 (the pSW2 vector containing the PR9 promoter fused to gfp) was introduced into WM3064 and then transferred to MR-1 and WP2 by conjugation. The GFP intensities in the WP2_P9 and MR-1_P9 strains (see Fig. S5 in the supplemental material) indicated that pSW2 is a broad-host-range gene expression vector in Shewanella.

In conclusion, the novel plasmid pSW2 based on phage SW1 allows gene cloning and expression in WP3 and other Shewanella species and can be used for various applications, including gene function complementation or the production of complex cytochromes. Meanwhile, the WP3/pSW2 expression system increases protein production at low temperatures, which can be useful for the expression of thermolabile proteins or the production of proteins that tend to form inclusion bodies in E. coli.

Supplementary Material

Supplemental material

ACKNOWLEDGMENTS

This work was financially supported by the China Ocean Mineral Resources R&D Association (grant no. DY125-15-T-04) and the National Natural Science Foundation of China (grant no. 31290232 and 41306129).

Footnotes

Supplemental material for this article may be found at http://dx.doi.org/10.1128/AEM.00906-15.

REFERENCES

  • 1.Fredrickson JK, Romine MF, Beliaev AS, Auchtung JM, Driscoll ME, Gardner TS, Nealson KH, Osterman AL, Pinchuk G, Reed JL, Rodionov DA, Rodrigues JLM, Saffarini DA, Serres MH, Spormann AM, Zhulin IB, Tiedje JM. 2008. Towards environmental systems biology of Shewanella. Nat Rev Microbiol 6:592–603. doi: 10.1038/nrmicro1947. [DOI] [PubMed] [Google Scholar]
  • 2.Hau HH, Gralnick JA. 2007. Ecology and biotechnology of the genus Shewanella. Annu Rev Microbiol 61:237–258. doi: 10.1146/annurev.micro.61.080706.093257. [DOI] [PubMed] [Google Scholar]
  • 3.Zhao JS, Manno D, Beaulieu C, Paquet L, Hawari J. 2005. Shewanella sediminis sp. nov, a novel Na+-requiring and hexahydro-1,3,5-trinitro-1,3,5-triazine-degrading bacterium from marine sediment. Int J Syst Evol Microbiol 55:1511–1520. doi: 10.1099/ijs.0.63604-0. [DOI] [PubMed] [Google Scholar]
  • 4.Zhao JS, Manno D, Leggiadro C, O'Neil D, Hawari J. 2006. Shewanella halifaxensis sp. nov, a novel obligately respiratory and denitrifying psychrophile. Int J Syst Evol Microbiol 56:205–212. doi: 10.1099/ijs.0.63829-0. [DOI] [PubMed] [Google Scholar]
  • 5.Xiao X, Wang P, Zeng X, Bartlett DH, Wang F. 2007. Shewanella psychrophila sp. nov. and Shewanella piezotolerans sp. nov., isolated from West Pacific deep-sea sediment. Int J Syst Evol Microbiol 57:60–65. doi: 10.1099/ijs.0.64500-0. [DOI] [PubMed] [Google Scholar]
  • 6.Miyake R, Kawamoto J, Wei YL, Kitagawa M, Kato I, Kurihara T, Esaki N. 2007. Construction of a low-temperature protein expression system using a cold-adapted bacterium, Shewanella sp. strain Ac10, as the host. Appl Environ Microbiol 73:4849–4856. doi: 10.1128/AEM.00824-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Wang F, Wang J, Jian H, Zhang B, Li S, Zeng X, Gao L, Bartlett DH, Yu J, Hu S, Xiao X. 2008. Environmental adaptation: genomic analysis of the piezotolerant and psychrotolerant deep-sea iron reducing bacterium Shewanella piezotolerans WP3. PLoS One 3:e1937. doi: 10.1371/journal.pone.0001937. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Wang F, Li Q, Xiao X. 2007. A novel filamentous phage from the deep-sea bacterium Shewanella piezotolerans WP3 is induced at low temperature. J Bacteriol 189:7151–7153. doi: 10.1128/JB.00569-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Jian H, Xu J, Xiao X, Wang F. 2012. Dynamic modulation of DNA replication and gene transcription in deep-sea filamentous phage SW1 in response to changes of host growth and temperature. PLoS One 7:e41578. doi: 10.1371/journal.pone.0041578. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Davison J, Heusterspreute M, Chevalier N, Ha-Thi V, Brunel F. 1987. Vectors with restriction site banks. V. pJRD215, a wide-host-range cosmid vector with multiple cloning sites. Gene 51:275–280. [DOI] [PubMed] [Google Scholar]
  • 11.Lauro FM, Eloe EA, Liverani N, Bertoloni G, Bartlett DH. 2005. Conjugal vectors for cloning, expression, and insertional mutagenesis in gram-negative bacteria. Biotechniques 38:708–712. doi: 10.2144/05385BM06. [DOI] [PubMed] [Google Scholar]
  • 12.Tutino ML, Duilio A, Parrilli R, Remaut E, Sannia G, Marino G. 2001. A novel replication element from an Antarctic plasmid as a tool for the expression of proteins at low temperature. Extremophiles 5:257–264. doi: 10.1007/s007920100203. [DOI] [PubMed] [Google Scholar]
  • 13.Papa R, Glagla S, Danchin A, Schweder T, Marino G, Duilio A. 2006. Proteomic identification of a two-component regulatory system in Pseudoalteromonas haloplanktis TAC125. Extremophiles 10:483–491. doi: 10.1007/s00792-006-0525-0. [DOI] [PubMed] [Google Scholar]
  • 14.Papa R, Rippa V, Sannia G, Marino G, Duilio A. 2007. An effective cold inducible expression system developed in Pseudoalteromonas haloplanktis TAC125. J Biotechnol 127:199–210. doi: 10.1016/j.jbiotec.2006.07.003. [DOI] [PubMed] [Google Scholar]
  • 15.Giuliani M, Parrilli E, Ferrer P, Baumann K, Marino C, Tutino ML. 2011. Process optimization for recombinant protein production in the psychrophilic bacterium Pseudoalteromonas haloplanktis. Process Biochem 46:953–959. doi: 10.1016/j.procbio.2011.01.011. [DOI] [Google Scholar]
  • 16.Yang XW, He Y, Xu J, Xiao X, Wang FP. 2013. The regulatory role of ferric uptake regulator (Fur) during anaerobic respiration of Shewanella piezotolerans WP3. PLoS One 8:e75588. doi: 10.1371/journal.pone.0075588. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Wu W, Li B, Hu J, Li J, Wang FP, Pan Y. 2011. Iron reduction and magnetite biomineralization mediated by a deep-sea iron reducing bacterium Shewanella piezotolerans WP3. J Geophys Res 116:G04034. [Google Scholar]
  • 18.Peng Q, Zhang X, Shang M, Wang X, Wang G, Li B, Guan G, Li Y, Wang Y. 2011. A novel esterase gene cloned from a metagenomic library from neritic sediments of the South China Sea. Microb Cell Fact 10:95. doi: 10.1186/1475-2859-10-95. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Edwards RA, Keller LH, Schifferli DM. 1998. Improved allelic exchange vectors and their use to analyze 987P fimbria gene expression. Gene 207:149–157. doi: 10.1016/S0378-1119(97)00619-7. [DOI] [PubMed] [Google Scholar]
  • 20.Wu L, Wang J, Tang P, Chen H, Gao H. 2011. Genetic and molecular characterization of flagellar assembly in Shewanella oneidensis. PLoS One 6:e21479. doi: 10.1371/journal.pone.0021479. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Zhou G, Yin J, Chen H, Hua Y, Sun L, Gao H. 2013. Combined effect of loss of the caa3 oxidase and Crp regulation drives Shewanella to thrive in redox-stratified environments. ISME J 7:1752–1763. doi: 10.1038/ismej.2013.62. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Dong YY, Wang JX, Fu HH, Zhou GQ, Shi MM, Gao HC. 2012. A Crp-dependent two-component system regulates nitrate and nitrite respiration in Shewanella oneidensis. PLoS One 7:e51643. doi: 10.1371/journal.pone.0051643. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Gao H, Wang X, Yang ZK, Palzkill T, Zhou J. 2008. Probing regulon of ArcA in Shewanella oneidensis MR-1 by integrated genomic analyses. BMC Genomics 9:42. doi: 10.1186/1471-2164-9-42. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Yang Y, McCue LA, Parsons AB, Feng S, Zhou J. 2010. The tricarboxylic acid cycle in Shewanella oneidensis is independent of Fur and RyhB control. BMC Microbiol 10:264. doi: 10.1186/1471-2180-10-264. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Chen Y, Wang F, Xu J, Mehmood MA, Xiao X. 2011. Physiological and evolutionary studies of NAP systems in Shewanella piezotolerans WP3. ISME J 5:843–855. doi: 10.1038/ismej.2010.182. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Bird LJ, Bonnefoy V, Newman DK. 2011. Bioenergetic challenges of microbial iron metabolisms. Trends Microbiol 19:330–340. doi: 10.1016/j.tim.2011.05.001. [DOI] [PubMed] [Google Scholar]
  • 27.Pollock WB, Chemerika PJ, Forrest ME, Beatty JT, Voordouw G. 1989. Expression of the gene encoding cytochrome c3 from Desulfovibrio vulgaris (Hildenborough) in Escherichia coli: export and processing of the apoprotein. J Gen Microbiol 135:2319–2328. [DOI] [PubMed] [Google Scholar]
  • 28.Arslan E, Schulz H, Zufferey R, Kunzler P, Thony-Meyer L. 1998. Overproduction of the Bradyrhizobium japonicum c-type cytochrome subunits of the cbb3 oxidase in Escherichia coli. Biochem Biophys Res Commun 251:744–747. doi: 10.1006/bbrc.1998.9549. [DOI] [PubMed] [Google Scholar]
  • 29.Ozawa K, Yasukawa F, Fujiwara Y, Akutsu H. 2001. A simple, rapid, and highly efficient gene expression system for multiheme cytochromes c. Biosci Biotechnol Biochem 65:185–189. doi: 10.1271/bbb.65.185. [DOI] [PubMed] [Google Scholar]
  • 30.Ozawa K, Tsapin AI, Nealson KH, Cusanovich MA, Akutsu H. 2000. Expression of a tetraheme protein, Desulfovibrio vulgaris Miyazaki F cytochrome c(3), in Shewanella oneidensis MR-1. Appl Environ Microbiol 66:4168–4171. doi: 10.1128/AEM.66.9.4168-4171.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Takayama Y, Akutsu H. 2007. Expression in periplasmic space of Shewanella oneidensis. Protein Expr Purif 56:80–84. doi: 10.1016/j.pep.2007.06.005. [DOI] [PubMed] [Google Scholar]
  • 32.Duilio A, Tutino ML, Marino G. 2004. Recombinant protein production in Antarctic Gram-negative bacteria. Methods Mol Biol 267:225–237. [DOI] [PubMed] [Google Scholar]
  • 33.Heidelberg JF, Paulsen IT, Nelson KE, Gaidos EJ, Nelson WC, Read TD, Eisen JA, Seshadri R, Ward N, Methe B, Clayton RA, Meyer T, Tsapin A, Scott J, Beanan M, Brinkac L, Daugherty S, DeBoy RT, Dodson RJ, Durkin AS, Haft DH, Kolonay JF, Madupu R, Peterson JD, Umayam LA, White O, Wolf AM, Vamathevan J, Weidman J, Impraim M, Lee K, Berry K, Lee C, Mueller J, Khouri H, Gill J, Utterback TR, McDonald LA, Feldblyum TV, Smith HO, Venter JC, Nealson KH, Fraser CM. 2002. Genome sequence of the dissimilatory metal ion-reducing bacterium Shewanella oneidensis. Nat Biotechnol 20:1118–1123. doi: 10.1038/nbt749. [DOI] [PubMed] [Google Scholar]
  • 34.Kato C, Nogi Y. 2001. Correlation between phylogenetic structure and function: examples from deep-sea Shewanella. FEMS Microbiol Ecol 35:223–230. doi: 10.1111/j.1574-6941.2001.tb00807.x. [DOI] [PubMed] [Google Scholar]
  • 35.Gao HC, Yang ZMK, Wu LY, Thompson DK, Zhou JZ. 2006. Global transcriptome analysis of the cold shock response of Shewanella oneidensis MR-1 and mutational analysis of its classical cold shock proteins. J Bacteriol 188:4560–4569. doi: 10.1128/JB.01908-05. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental material

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES