Skip to main content
BMC Research Notes logoLink to BMC Research Notes
. 2015 Jul 30;8:326. doi: 10.1186/s13104-015-1299-1

The CCR5Δ32 (rs333) polymorphism is not a predisposing factor for severe pandemic influenza in the Brazilian admixed population

Alvino Maestri 1,, Mirleide Cordeiro dos Santos 2, Elzemar M Ribeiro-Rodrigues 1, Wyller Alencar de Mello 3, Rita Catarina Medeiros Sousa 3, Sidney Emanuel dos Santos 1, Vinicius Albuquerque Sortica 4
PMCID: PMC4520097  PMID: 26223981

Abstract

Background

Recent studies have tried to identify host genetic variants that could explain severe cases and deaths in infection with Influenza A(H1N1)pdm09, especially among children and young adults. CCR5 is a chemokine receptor expressed on T cells, macrophages and dendritic cells, which is an important mediator of leukocyte chemotaxis during the immune response. A deletion mutation (Δ32) in this gene interferes with the response of immune cells, impairing viral clearance. We evaluated the CCR5Δ32 polymorphism (rs333) in individuals of the Brazilian admixed population with a diagnosis of Influenza A(H1N1)pdm09 infection.

Methods

A total of 330 subjects with a diagnosis of Influenza A(H1N1)pdm09, evaluated at health services in the northern and northeastern regions of Brazil between June 2009 and August 2010, were genotyped for the Δ32 deletion (rs333). The cases were classified according to the progression of infection into a group of hospitalized patients (n = 156) and a group of non-hospitalized patients (n = 174).

Results

No significant differences in the allele or genotype frequencies of the CCR5Δ32 polymorphism were observed between non-hospitalized and hospitalized patients (p = 0.289 and p = 0.431, respectively).

Conclusion

The Δ32 deletion in the CCR5 gene is not associated with an unfavorable outcome in patients infected with Influenza A(H1N1)pdm09 in the Brazilian admixed population.

Electronic supplementary material

The online version of this article (doi:10.1186/s13104-015-1299-1) contains supplementary material, which is available to authorized users.

Keywords: A(H1N1)pdm09 infection, Influenza, CCR5Δ32

Background

On April 21, 2009 [1], the Centers for Disease Control and Prevention (CDC) announced two flu cases in children from California, USA, caused by a new influenza strain originated by the quadruple reassortment between other already circulating influenza viruses [2]. The new viral subtype spread around the world, a fact that culminated in the announcement by the World Health Organization (WHO) on June 11, 2009, of the first flu pandemic in the 21st century [3]. The lethality of the new viral strain did not add to the flu-related death statistics; however, the large number of severe cases and deaths among children and young adults called the attention of the scientific community [4].

Recent studies have tried to identify host genetic variants that could explain severe cases of the disease [5]. On the basis of the cycle of viral replication of the pandemic strain in human cells, genetic variants that could influence viral clearance [6] have been identified. One genetic variant is a 32-bp deletion in the CCR5 gene (Δ32) [7].

CCR5 is a chemokine receptor expressed on T cells, macrophages and dendritic cells, which is an important mediator of leukocyte chemotaxis during the response to chemokines. The interaction of this receptor with its ligands results in the homing of different immune cells to the sites of viral infection on the mucosal surface. Studies have shown that the Δ32 deletion in the CCR5 gene interferes with the response of immune cells through CCL3, CCL4 and CCL5, impairing viral clearance [810]. In a population of 20 Canadian patients who developed severe forms of infection with the pandemic flu virus, the mutation at position 32 of the CCR5 gene (rs333) was detected in five patients and was associated with an unfavorable clinical evolution [7]. However, the same mutation evaluated in 29 Italian patients also infected with the pandemic strain was not associated with poor clinical outcome [11]. In the present study, the CCR5Δ32 polymorphism (rs333) was investigated in individuals from a Brazilian admixed population with a diagnosis of Influenza A(H1N1)pdm09 infection.

Methods

Population

Between June 2009 and August 2010, the Virology Section of the Evandro Chagas Institute (Seção de Virologia do Instituo Evandro Chagas—SEVIR/IEC) received 5,427 nasal swab or nasopharyngeal aspirate samples from subjects with a clinical suspicion of flu-like illness who sought health services in the states of the northern and northeastern regions of Brazil. Of these, 1,524 samples were positive for the pandemic strain and 330 samples with a diagnosis of Influenza A(H1N1)pdm09 were randomly included in the study. All patients enrolled in the study provided their written informed consent. Underage participants (younger than 18 years n = 115) had the informed consents signed by parents to participate in the study. The study was approved by the Ethics Committee of the Center of Tropical Medicine, Federal University of Pará (Núcleo de Medicina Tropical, Universidade Federal do Pará).

Laboratory diagnosis

Diagnostic confirmation was performed at the Laboratory of Respiratory Viruses, SEVIR/IEC, Ananindeua, Pará, using the SuperScript III™ One-Step qRT-PCR System with Platinum Taq® (Invitrogen Life Technologies, Carlsbad, CA, USA) according to the protocol recommended by the CDC [12].

Genotyping of CCR5Δ32 (rs333)

Genomic DNA was extracted from the leukocyte aggregate found in the nasal aspirate or nasopharyngeal swab using the QIAamp DNA Mini Kit (Qiagen, Valencia, CA, USA) according to manufacturer instructions. All DNA samples were genotyped by PCR. The primers (forward: CTCCCAGGAATCATCTTTACCA and reverse: TTTTTAGGATTCCCGAGTAGCA) were designed using the Primer3 software (http://www.genome.wi.mit.edu/cgi-bin/primer/primer3) and tested with the AutoDimer software.

PCR was carried out in a final volume of 12.5 µL containing PCR buffer 1 with 3 mM of MgCl2, 125 mM of each dNTP, 2 U Platinum AmpliTaq DNA polymerase (Invitrogen Life Technologies, Carlsbad, CA, USA) and 10–20 ng genomic DNA. The PCR conditions were: 11 min at 95°C; 10 cycles of 1 min at 94°C, 1 min at 60°C and 2 min at 70°C; 17 cycles of 1 min at 90°C, 1 min at 60°C and 2 min at 70°C, and a final extension of 60 min at 60°C. For capillary electrophoresis, 1 mL of the PCR product was added to 8.5 mL Hi-Di formamide (Applied Biosystems, Foster City, CA, USA) and 0.5 mL GeneScan 500 LIZ Size Standard (Applied Biosystems, Foster City, CA, USA). The amplicons were separated in an ABI Prism 3130 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA) and analyzed using the v3.2 GeneMapper ID software (Applied Biosystems, Foster City, CA, USA).

Population substructure

The proportions of African, European and Amerindian genetic ancestry of the infected patients were estimated using a panel of 48 ancestry-informative markers as described previously [13].

Statistical analysis

Allele and genotype frequencies were estimated by direct counting. Deviation from Hardy–Weinberg equilibrium was verified by Chi squared analysis. Differences in quantitative and qualitative characteristics between the groups of hospitalized and non-hospitalized patients were evaluated using the Student t test, Chi squared test and Fisher’s exact test. Differences in the proportions of genetic ancestry between groups were determined using the Wilcoxon–Mann–Whitney test. Fisher’s exact test was used to analyze differences in the allele and genotype frequencies of the deletion studied between the groups of patients. Logistic regression was used to assess the effect of the CCR5 polymorphism on the severity of Influenza A(H1N1)pdm09 infection. European and African genetic ancestry and comorbidities (dichotomous variable, presence or not of comorbidity) were included in the model as confounders, as they presented differences between patients groups. Statistical analysis was performed using the SPSS 18.0 software, adopting a level of significance of p < 0.05.

Results

The 330 patients included in the study exhibited the classical clinical symptoms of the disease and were divided according to the progression of infection into two groups: patients that presented severe acute respiratory syndrome (SARS) and were hospitalized (n = 156) following Brazilian Ministry of Health protocol [14] and patients with mild symptoms non-hospitalized (n = 174) (Table 1). There was a predominance of women among the patients studied (61.5%) and the mean patient age was 24.7 years (1–80 years). Forty-seven of the women were pregnant and 28 were hospitalized. Radiologic alterations were found in 51.9% of hospitalized patients. Most hospitalized patients had no comorbidities (59%). However, patients with comorbidities (metabolic disorders, immunosuppression and obesity) were significantly more frequent in the group of hospitalized patients. Deaths occurred in 55.7% of hospitalized patients. The population studied exhibited a mean European genetic contribution of 57.4%, a mean Native American contribution of 26.4% and a mean African contribution of 16.2% (Table 1) in agreement with previously data from Brazilian populations [13, 15]. In non-hospitalized patients the mean European contribution was 60% ranging from 4.6 to 91.9%, the mean Native American contribution was 25% ranging from 3.2 to 93.2%, and the mean African contribution was 15% ranging 2.2–61%. In hospitalized patients, genetic contribution was European 54.4% ranging from 5.9 to 93%, Native American 28% ranging from 3.5 to 90.6%, and African 17,6% ranging 2.4–67.6% (Additional files 1, 2). European and African genetic ancestry showed statistical differences between groups (p = 0.006 and p = 0.010, respectively).

Table 1.

Epidemiological and clinical characteristics of hospitalized and non-hospitalized patients infected with Influenza A(H1N1)pdm09

Characteristics All patients Non-hospitalized Hospitalized p value
N 330 174 156
Female sex 203 (61.5) 102 (58.6) 101 (64.7) 0.254
Age (years) 24.7 ± 15.3 23.8 ± 14.2 25.8 ± 16.5 0.270
Pregnant 47 (31.8) 19 (26.0) 28 (37.3) 0.140
Smoking 18 (5.5) 6 (3.4) 12 (7.7) 0.090
Signs and symptoms
 Fever 320 (97.0) 167 (96.0) 153 (98.1) 0.267
 Cough 311 (94.2) 161 (92.5) 150 (96.2) 0.158
 Shortness of breath 245 (74.2) 101 (58.0) 144 (92.3) <0.001
 Muscle aches 212 (64.2) 117 (67.2) 95 (60.9) 0.230
 Rhinorrhea 197 (59.7) 113 (64.9) 84 (53.8) 0.040
 Sore throat 192 (58.2) 107 (61.5) 85 (54.5) 0.198
 Chills 138 (41.8) 72 (41.4) 66 (42.3) 0.864
Joint pain 118 (35.8) 64 (36.8) 54 (34.6) 0.682
 Headache 63 (19.1) 40 (23) 23 (14.7) 0.057
 Diarrhea 55 (16.7) 24 (13.8) 31 (19.9) 0.139
 Conjunctivitis 21 (6.4) 15 (8.6) 6 (3.8) 0.076
Abnormal chest radiograph 81 (24.5) 0 (0) 81 (51.9) <0.001
Without comorbidities 220 (66.7) 128 (73.6) 92 (59.0) 0.005
With comorbidities
 Chronic lung disorder 65 (19.6) 29 (16.7) 36 (23.1) 0.144
 Chronic cardiovascular condition 22 (6.6) 10 (5.7) 12 (7.7) 0.470
 Metabolic disorder 12 (3.6) 1 (0.6) 11 (7.1) 0.002
 Immunosuppression 7 (2.1) 0 (0) 7 (4.5) 0.005
 Obesity 8 (2.4) 1 (0.6) 7 (4.5) 0.021
 Hemoglobinopathy 3 (0.9) 1 (0.6) 2 (1.3) 0.490
 Chronic kidney disease 4 (1.2) 1 (0.6) 3 (1.9) 0.260
Death 87 (26.3) 0 (0) 87 (55.7) <0.001
Genetic ancestry
 Native American 0.264 ± 0.18 0.250 ± 0.19 0.280 ± 19 0.147
 European 0.574 ± 0.20 0.600 ± 0.20 0.544 ± 19 0.006
 African 0.162 ± 0.11 0.150 ± 0.10 0.176 ± 11 0.010

Age and genetic ancestry were reported as the mean ± SD. All other variables are reported as number (%).

There were no significant differences in the allele or genotype frequencies of the CCR5Δ32 polymorphism between non-hospitalized and hospitalized patients (p = 0.289 and 0.431, respectively) (Table 2). A logistic regression analysis was performed to assess the effect of CCR5Δ32 polymorphism on infection severity controlling for European and African ancestry and the presence of comorbidities to avoid confounding effects. No association between patients carrying the Δ32 allele and severity was found (Table 3).

Table 2.

Genotype and allele distribution of CCR5Δ32 in non-hospitalized and hospitalized patients infected with Influenza A(H1N1)pdm09

Non-hospitalized Hospitalized p value
Genotype
 Wt/Wt 160 (92.0) 148 (94.9) 0.431
 Wt/Δ32 13 (7.5) 8 (5.1)
 Δ32/Δ32 1 (0.6) 0 (0)
Allele
 Wt 333 (0.96) 304 (0.97) 0.289
 Δ32 15 (0.04) 8 (0.03)

Table 3.

CCR5Δ32 effect on A(H1N1)pdm09 infection severity

Genotypes B OR CI 95% P value
Wt/Wta
Δ32 carriersb −0.582 0.559 0.22; 1.26 0.219

Covariates in Regression model: European and African ancestry and comorbidities.

aReference genotype.

bWt/Wt + Wt/Δ32.

Discussion

Since the demonstration of the protective role of a 32-bp deletion in the CCR5 gene in two individuals exposed to, but not infected with HIV [16], studies on the protective or regulatory role of this deletion have multiplied [17]. The protective role of this polymorphism in HIV infection was extensively studied and utilized as model for the development of new therapeutics for AIDS [18].

However, the presence of the deletion can be a determinant factor of morbidity and mortality in the case of other infectious diseases. In a meta-analysis of four cohorts evaluating the deletion in patients with West Nile fever, genetic deficiency of the CCR5 gene was a strong risk factor of symptomatic arbovirus infection [19]. In another study comparing 129 patients with a diagnosis of tickborne encephalitis virus infection and 79 subjects with aseptic meningitis negative for tickborne encephalitis and 134 healthy controls, a higher frequency of the homozygous Δ32/Δ32 genotype was observed among patients with tickborne encephalitis, particularly among severe cases of the disease [20].

In the present study, no difference in the Δ32 deletion of the CCR5 gene was observed between the groups of individuals infected with Influenza A(H1N1)pdm09 in a Brazilian admixed population, who presented the classical clinical symptoms [21]. Thus, no correlation could be established between the presence of the mutation and a more severe outcome of the disease. The present results agree with those reported in a recent study involving an Italian population [11], but disagree with the findings obtained for a Canadian population [7].

The Brazilian population was formed by extensive admixture of Native American, European and African populations, nevertheless European genetic ancestry is predominantly in Brazil [13, 15]. In the population studied the mean European contribution was around 57% and the CCR5Δ32 allele frequency was 3.6%, similar to previously described for Brazilian populations [22]. Despite ethnic differences with the populations previously analyzed, in the present study thirteen heterozygous and one homozygous for the Δ32 deletion were found in patients with mild symptoms and eight heterozygous for this deletion were found in hospitalized group showing no evidence of this allele effect on severity.

Previous researches adopted different criteria for severe patients [7, 11], which could contribute for conflicting results among studies, but despite those differences, we emphasize the large size of the sample studied here compared to previously published studies, supporting the hypothesis that the Δ32 mutation is not a predisposing factor for severe Influenza A(H1N1)pdm09 infection.

Conclusion

Although studies have reported an association between mutation Δ32 in the CCR5 gene and a more severe evolution of some infectious diseases, our findings demonstrate that the same cannot be confirmed for infection with Influenza A(H1N1)pdm09 in the Brazilian admixed population.

Authors’ contributions

AMN designed the study concepts, conducted the study and prepared the manuscript. VAS performed the data analysis and interpretation and drafted the manuscript. MCS, EMR and WAS were involved in sample and data collection, and final approval of the manuscript SEB and RCM designed the study concepts, drafting the manuscript and final approval of the manuscript. All authors read and approved the final manuscript.

Acknowledgements

AMN was the recipient of a Doctoral fellowship from the Brazilian Ministry of Health (Coordenação de Aperfeiçoamento de Pessoal de Nível Superior—CAPES) and the Abroad Sandwich Doctorate Program (Programa de Doutorado Sanduíche no Exterior—PDSE). The authors thank the financial support provided by Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq, Brazil), Programa de Pesquisa para o Sistema Único de Saúde (PPSUS) e CAPES. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Compliance with ethical guidelines

Competing interests The authors declare that they have no competing interests.

Abbreviations

CDC

Centers for Disease Control and Prevention

IEC

Evandro Chagas Institute

SEVIR

Virology Section

WHO

World Health Organization

Additional files

Additional file 1: (232.3KB, pdf)

Genetic ancestry admixture of patients infected with Influenza A(H1N1)pdm09 sorted by African ancestry. Each individual ancestry is depicted as a column, whereas color represents the proportion of ancestry estimated for that individual (African = blue; European = brown; Native American = green). (A) Non-hospitalized patients and (B) Hospitalized patients.

Additional file 2: (211.7KB, pdf)

Genetic ancestry admixture of patients infected with Influenza A(H1N1)pdm09 sorted by European ancestry. Each individual ancestry is depicted as a column, whereas color represents the proportion of ancestry estimated for that individual (African = blue; European = brown; Native American = green). (A) Non-hospitalized patients and (B) Hospitalized patients.

Contributor Information

Alvino Maestri, Email: alvimaestri@hotmail.com.

Mirleide Cordeiro dos Santos, Email: mirleidesantos@iec.pa.gov.br.

Elzemar M Ribeiro-Rodrigues, Email: elze_mar@yahoo.com.br.

Wyller Alencar de Mello, Email: wyllermello@iec.pa.gov.br.

Rita Catarina Medeiros Sousa, Email: ritasousa@iec.pa.gov.br.

Sidney Emanuel dos Santos, Email: sidneysantos@ufpa.br.

Vinicius Albuquerque Sortica, Email: vsortica@hotmail.com.

References

  • 1.Centers for Diseases Control and Prevention Swine influenza A (H1N1) infection in two children-Southern California, March–April 2009. MMWR Morb Mortal Wkly Rep. 2009;58(15):400–402. [PubMed] [Google Scholar]
  • 2.Neumann G, Noda T, Kawaoka Y. Emergence and pandemic potential of swine-origin H1N1 influenza virus. Nature. 2009;459(7249):931–939. doi: 10.1038/nature08157. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.World Health Organization (2009) Influenza A(H1N1) in the Americas, vol 21. In: Pan American Health Organization (ed) World Health Organization, p 2
  • 4.Fineberg HV. Pandemic preparedness and response—lessons from the H1N1 influenza of 2009. N Engl J Med. 2014;370(14):1335–1342. doi: 10.1056/NEJMra1208802. [DOI] [PubMed] [Google Scholar]
  • 5.Keynan Y, Malik S, Fowke KR. The role of polymorphisms in host immune genes in determining the severity of respiratory illness caused by pandemic H1N1 influenza. Public Health Genomics. 2013;16(1–2):9–16. doi: 10.1159/000345937. [DOI] [PubMed] [Google Scholar]
  • 6.Zhang L, Katz JM, Gwinn M, Dowling NF, Khoury MJ. Systems-based candidate genes for human response to influenza infection. Infect Genet Evol. 2009;9(6):1148–1157. doi: 10.1016/j.meegid.2009.07.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Keynan Y, Juno J, Meyers A, Ball TB, Kumar A, Rubinstein E, et al. Chemokine receptor 5 Δ32 allele in patients with severe pandemic (H1N1) 2009. Emerg Infect Dis. 2010;16(10):2. doi: 10.3201/eid1610.100108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Sanchooli J, Sanadgol N, Kazemi Arababadi M, Kennedy D. CCR5 plays important roles in hepatitis B infection. Viral Immunol. 2014;27(1):2–6. doi: 10.1089/vim.2013.0067. [DOI] [PubMed] [Google Scholar]
  • 9.Samson M, Labbe O, Mollereau C, Vassart G, Parmentier M. Molecular cloning and functional expression of a new human CC-chemokine receptor gene. Biochemistry. 1996;35:6. doi: 10.1021/bi952950g. [DOI] [PubMed] [Google Scholar]
  • 10.Ghorban K, Dadmanesh M, Hassanshahi G, Momeni M, Zare-Bidaki M, Arababadi MK, et al. Is the CCR5 Δ 32 mutation associated with immune system-related diseases? Inflammation. 2012;36(3):633–642. doi: 10.1007/s10753-012-9585-8. [DOI] [PubMed] [Google Scholar]
  • 11.Sironi M, Cagliani R, Pontremoli C, Rossi M, Migliorino G, Clerici M, et al. The CCR5Δ32 allele is not a major predisposing factor for severe H1N1pdm09 infection. BMC Research Notes. 2014;7(1):504. doi: 10.1186/1756-0500-7-504. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Centers for Diseases Control and Prevention (2009) CDC protocol of realtime RTPCR for influenza A(H1N1). In: Centers for Disease Control and Prevention, Atlanta, p 7
  • 13.Santos NPC, Ribeiro-Rodrigues EM, Ribeiro-dos-Santos ÂKC, Pereira R, Gusmão L, Amorim A, et al. Assessing individual interethnic admixture and population substructure using a 48-insertion-deletion (INSEL) ancestry-informative marker (AIM) panel. Hum Mutat. 2010;31(2):184–190. doi: 10.1002/humu.21159. [DOI] [PubMed] [Google Scholar]
  • 14.Ministério da Saúde do Brasil (2009) Brasil: Protocolo de manejo clínico e vigilância epidemiológica da influenza. In: SVS, Brasília, p 32
  • 15.Saloum de Neves Manta F, Pereira R, Vianna R, Rodolfo Beuttenmüller de Araújo A, Leite Góes Gitaí D, Aparecida da Silva D, et al. Revisiting the genetic ancestry of Brazilians using autosomal AIM-Indels. PLoS One. 2013;8(9):e75145. doi: 10.1371/journal.pone.0075145. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Liu R, Paxton WA, Choe S, Ceradini D, Martin SR, Horuk R, et al. Homozygous defect in HIV-1 coreceptor accounts for resistance of some multiply-exposed individuals to HIV-1 infection. Cell. 1996;86:11. doi: 10.1016/s0092-8674(00)80110-5. [DOI] [PubMed] [Google Scholar]
  • 17.Klein Robyn S. A moving target: the multiple roles of CCR5 in infectious diseases. J Infect Dis. 2008;197(2):183–186. doi: 10.1086/524692. [DOI] [PubMed] [Google Scholar]
  • 18.O’Brien SJ, Hendrickson SL. Host genomic influences on HIV/AIDS. Genome Biol. 2013;14(1):201–213. doi: 10.1186/gb-2013-14-1-201. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Lim Jean K, Louie Christine Y, Glaser C, Jean C, Johnson B, Johnson H, et al. Genetic deficiency of chemokine receptor CCR5 is a strong risk factor for symptomatic West Nile virus infection: a meta-analysis of 4 cohorts in the US epidemic. J Infect Dis. 2008;197(2):262–265. doi: 10.1086/524691. [DOI] [PubMed] [Google Scholar]
  • 20.Kindberg E, Mickienė A, Ax C, Åkerlind B, Vene S, Lindquist L, et al. A deletion in the chemokine receptor 5(CCR5) gene is associated with tickborne encephalitis. J Infect Dis. 2008;197(2):266–269. doi: 10.1086/524709. [DOI] [PubMed] [Google Scholar]
  • 21.Bautista E, Chotpitayasunondh T, Gao Z, Harper SA, Shaw M, Uyeki TM, et al. Clinical aspects of pandemic 2009 influenza A (H1N1) virus infection. N Engl J Med. 2010;362(18):1708–1719. doi: 10.1056/NEJMra1000449. [DOI] [PubMed] [Google Scholar]
  • 22.Vargas AE, Marrero AR, Salzano FM, Bortolini MC, Chies JA. Frequency of CCR5delta32 in Brazilian populations. Braz J Med Biol Res. 2006;39(3):321–325. doi: 10.1590/S0100-879X2006000300002. [DOI] [PubMed] [Google Scholar]

Articles from BMC Research Notes are provided here courtesy of BMC

RESOURCES