Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2016 Apr 1.
Published in final edited form as: Epigenomics. 2015;7(4):567–579. doi: 10.2217/epi.15.12

Gadd45b and N-methyl-D-aspartate induced DNA demethylation in postmitotic neurons

David P Gavin 1,2,*, Handojo Kusumo 1,2, Rajiv P Sharma 1,2, Marina Guizzetti 1,2,3, Alessandro Guidotti 2, Subhash C Pandey 1,2
PMCID: PMC4520229  NIHMSID: NIHMS708086  PMID: 26111030

Abstract

Aim

In nondividing neurons examine the role of Gadd45b in active 5-methylcytosine (5MC) and 5-hydroxymethylcytosine (5HMC) removal at a gene promoter highly implicated in mental illnesses and cognition, Bdnf.

Materials & methods

Mouse primary cortical neuronal cultures with and without Gadd45b siRNA transfection were treated with N-methyl-D-aspartate (NMDA). Expression changes of genes reportedly involved in DNA demethylation, Bdnf mRNA and protein and 5MC and 5HMC at Bdnf promoters were measured.

Results

Gadd45b siRNA transfection in neurons abolishes the NMDA-induced increase in Bdnf IXa mRNA and reductions in 5MC and 5HMC at the Bdnf IXa promoter.

Conclusion

These results contribute to our understanding of DNA demethylation mechanisms in neurons, and its role in regulating NMDA responsive genes implicated in mental illnesses.

Keywords: alcoholism, CpG, epigenetic, histone, schizophrenia

DNA methylation in postmitotic neurons is potentially the longest lasting form of gene regulation in the body with no requirement for turnover across a lifetime [1,2]. As such it is tightly connected with maintaining neuronal identity defined by factors including subtype, brain location and functional role in memory, learning and when aberrant, pathology [3–12]. The addition of methyl groups to the 5′ carbon of cytosines is catalyzed by three DNA methyltransferases, Dnmt1, 3a and 3b utilizing, S-adenosylmethionine as the methyl donor. All three Dnmts are expressed in the brain [13,14].

While the mechanisms underlying the addition of methyl groups to cytosine bases in postmitotic neurons has been well-established [14], whether and by what means the removal of these highly stable modifications occurs outside of cell division has been a source of controversy. Over the last several years there has been increasing support for an active DNA demethylation pathway that involves base excision repair (BER) processes (Figure 1A). The initial step in this pathway is the oxidation of 5-methylcytosine (5MC) to 5-hydroxymethylcytosine (5HMC) by the Tet family of enzymes [15–17]. Reductions of Tet1 in mouse embryonic stem cells reduce 5HMC and increase 5MC at discrete genomic regions. Conversely, overexpression reduces 5MC and increases 5HMC in the brain [16,18–23].

Figure 1. Hypothetical pathway of activity-dependent Bdnf DNA demethylation.

Figure 1

Open in a new tab

(A) Effects of neuronal depolarization on DNA demethylation pathway. (1) Neuronal activity decreases DNA methyltransferase (DNMT) expression leading to less production of 5-methylcytosine (5MC). This decreases the amount of substrate used to produce 5-hydroxymethylcytosine (5HMC). (2) Tet1-catalyzed conversion of 5MC to 5HMC at Bdnf IXa may maintain the promoter in a state primed for demethylation. However, once the neuron is depolarized Tet1 expression decreases lead to reduced 5HMC production. (3) Neuronal activity increases Gadd45b expression. Gadd45b participates in Bdnf IXa promoter demethylation by facilitating the removal of 5HMC directly, and as a direct or indirect negative regulator on Tet1 expression. Both these actions serve to decrease 5HMC. (B) Effects of Gadd45b knockdown on activity-dependent Bdnf demethylation. (1) In the current study, we knocked down Gadd45b expression using siRNA. This may prevent the Gadd45b-coordinated N-methyl-D-aspartate (NMDA)- induced removal of 5HMC. (2) Gadd45b knockdown may also prevent it from suppressing Tet1 expression following NMDA treatment. Inhibition of both actions of Gadd45b would lead to an accumulation of 5HMC at Bdnf promoters. This may explain why Gadd45b knockdown did not merely prevent the removal 5HMC from Bdnf promoters, but it actually led to an increase following NMDA treatment. (3) By preventing the removal of 5HMC, the pathway is blocked, leading to a failure in NMDA-dependent 5MC removal.

5HMC: 5-hydroxymethylcytosine; 5MC: 5-methylcytosine.

5HMC and 5MC are different cytosine modifications that likely have independent roles in regulating gene expression. This necessitates studying each of these separately. Most bisulfite sequencing or certain enzymatic methods provide a combined 5MC/5HMC measurement but cannot resolve these separately, and often only examine methylated cytosines in a CpG context. Therefore, we measured methylation changes using methylated DNA immunoprecipitation (MeDIP) and hydroxymethylated DNA immunoprecipitation (hMeDIP).

Following 5HMC production GADD45 proteins are thought to coordinate a process whereby 5HMC is removed. GADD45 proteins (GADD45a, b and g) are thought to participate in the removal of 5HMC/5MC by recruiting and acting as scaffolds for cytidine deaminases, such as APOBECs or AICDA, and DNA glycosylases, such as TDG, MBD4 or SMUG1 [15,24–31]. A direct physical interaction has been demonstrated between AICDA, TDG and GADD45a in cultured cells [28], while in zebrafish embryos a protein complex consisting of AICDA or APOBEC, MBD4 and GADD45a has been documented [29]. GADD45 proteins have also been shown to bind to nuclear hormone receptors [37] and preferentially to hyperacetylated nucleosomes [38], again suggesting that Gadd45 proteins may be involved in targeting promoters for 5HMC/5MC removal.

In vivo, Gadd45b is induced after long-term potentiation, and Gadd45b and Gadd45g increase in the mouse amygdala following fear conditioning [32–35]. In neuronal culture Gadd45b and Gadd45g have been shown to increase following depolarization [36].

One important target of this demethylation pathway is BDNF. BDNF is a growth factor that plays important roles in neurogenesis, synaptic plasticity, learning, memory and cognition [39,40]. The BDNF gene is comprised of multiple upstream 5′ exons which splice with a common 3′ protein coding exon [41]. One of these splice variants in mice and rats, Bdnf IV, has been shown in neuronal culture to be robustly increased by neuronal depolarization associated with a reduction in promoter 5HMC/5MC [42,43]. Bdnf IXa expression and removal of promoter 5HMC/5MC have been shown to be induced in the mouse brain following electroconvulsive seizures (ECS) [15,36]. Abnormalities in DNA methylation at BDNF promoters have been reported in various neuropsychiatric disorders including depression, alcoholism and schizophrenia [44–46].

Prior studies regarding the BER DNA demethylation pathway have shown that Gadd45b knockout mice fail to remove 5HMC/5MC from the Bdnf IXa promoter and consequently fail to increase Bdnf IXa expression following ECS [36]. Tet1 overexpression in mice leads to the removal of 5HMC/5MC from Bdnf IXa and Fgf1b promoters, and a reduction in Tet1 expression prevents ECS-induced removal of 5HMC/5MC from Bdnf IXa and Fgf1b promoters in vivo [15,23].

To our knowledge, activity-dependent changes in 5HMC measured independently from 5MC in neurons has not been previously documented, nor have the proteins involved in removal following N-methyl-D-aspartate treatment (NMDA) agonism. Further, many of the prior studies regarding the importance of the BER pathway in demethylation were conducted in vivo where it is difficult to discern passive DNA demethylation that results from cell division from active DNA demethylation that occurs in nondividing cells, including most neurons [15,36]. In the current study, we attempt to determine the role of Gadd45b in removing 5MC and 5HMC from the Bdnf IXa promoter using primary cultured neurons where the potential confounds of dividing non-neuronal cells or dividing neuronal stem cells such as in the dentate gyrus of the hippocampus are obviated [42,43].

Methods & materials

Primary cortical neuronal culture

Timed pregnant C57Bl/6 mice were purchased from Charles River. Cortical neurons from E18 mouse fetuses were prepared as previously described [47,48]. All procedures were conducted in accordance with the NIH guidelines for the Care and Use of Laboratory Animals and approved by the Institutional Animal Care and Use Committee. Briefly, mouse cortices were dissected into Hank’s balanced salt solution (HBSS) (Life Technologies; 14170–112; NY, USA), and treated with papain (2 mg/ml in HBSS) in the presence of DNase (40 μg/ml) (Sigma-Aldrich; D5025; MO, USA) and MgCl (5 mM) (Sigma-Aldrich; M1028) for 30 min at 37°C. The tissue was centrifuged, and resuspended in Neurobasal medium (Life Technologies; 10888–022) supplemented with 1.25 μg/ml Fungizone (Life Technologies; 15290–018), 100 μg/ml gentamicin (Life Technologies; 15750–078) and 10 mM D-(+)-glucose. Tissue was further dissociated by repeated passages through a Pasteur pipette, and cells were filtered through a nylon mesh of 40 μm pore size. Cells were then spun down and resuspended in Neurobasal complete media which included 2 mM GlutaMAX (Life Technologies; 35050-061) and 1× B27 supplement (Life Technologies; 17504-044). Cells were plated on 100 μg/ml poly-D-lysine (Sigma-Aldrich; P1149) coated plates at 1–2 × 106 cells/ml. At 3 days in vitro (DIV) cells were treated with cytosine arabinoside (5 μM) (Sigma-Aldrich; C6645). NMDA (Sigma-Aldrich; M3262) and MK-801 (Sigma- Aldrich; M107) were administered directly into the culture-well at 7–8 DIV with the appropriate vehicle control administered in parallel (water or DMSO). In preliminary dose and time experiments, we found that 2-h treatment with 45 μM of NMDA induces a robust increase in Gadd45b expression. Prior reports using a similar dose of NMDA indicate that Bdnf IV mRNA and protein levels begin to increase after 1 h with peak Bdnf IV mRNA expression at 6 h [49]. Based on our data and these prior reports we chose to conduct the rest of the experiments using NMDA 45 μM at 2 h. All experiments were conducted using at least four replicates per condition.

RNA interference of Gadd45b in postmitotic neuronal cell culture

Small interfering RNAs (siRNAs, 25 nt) were designed against Gadd45b mRNA (GenBank NM_008655.1). The 25 nt targeting sequence for the siRNA is as follows (5′–3′): CACTTCACCCTGATCCAGTCGTTCT (Life Technologies; 1320001). Cells were transfected with 30 nM siRNA using Dharmafect3 transfection reagent (Thermo Fisher; T-2003-03; MA, USA) at 6 DIV, media changed after 24 h and cells harvested at 8 DIV.

Quantitative reverse transcriptase-PCR

Total RNA was isolated using TRIZOL reagent (Life Technologies; 15596-026). DNA was removed using DNA-free™ DNA Removal Kit (Life Technologies; AM1906). Target gene expression was normalized to Hprt1 (see Table 1 for primer sequences). For qRT–PCR, cDNA samples were analyzed using PikoReal Real-Time PCR (Thermo Fisher) and Maxima® SYBR Green/ROX qPCR Master Mix (Thermo Fisher; K0222). To confirm amplification specificity, the PCR products were subject to a melting curve analysis, in which only one peak was observed. Crossing point values were measured with the PikoReal analysis software. Primers were designed to span at least one intron–exon boundary, with the exception of Bdnf IXa which lacks an intervening intron. The following cycling conditions were used: 10 min at 95°C, then 40 cycles at 95°C for 30 s, 60°C for 1 min and 72°C for 30 s.

Table 1.

Primer sequences used in this study.

Genes 5′ primer 3′ primer
mRNA expression primers
Apobec1 GCTCCTCCCTTGAAATCAGA GTCCTGGCTCATGATGTCCT
BdnfIV TCGCTGAAGGCGTGCGAGTA GCACACCTGGGTAGGCCAAG
BdnfIXa GCAGCTGGAGTGGATCAGTAA TGGTCATCACTCTTCTCACCTG
Dnmt1 AACCATCACCGTGCGAGACA AGGGTGCTGAATTGCCTGGA
Dnmt3a AGGAAGACCCCTGGAACTGCT ACGTCCCCGACGTACATGATCT
Dnmt3b GCGTCAGTACCCCATCAGTT CACGAGGTCACCTATTCCAAA
Gadd45a TGCGAGAACGACATCAACAT TCCCGGCAAAAACAAATAAG
Gadd45b GTTCTGCTGCGACAATGACA TTGGCTTTTCCAGGAATCTG
Gadd45g ATGACTCTGGAAGAAGTCCGT CAGGGTCCACATTCAGGACT
Hprt1 GCCGAGGATTTGGAAAAAGT ACAGAGGGCCACAATGTGAT
Mbd4 CAAACCTTGGGGACAACAGA TCACCAGGTCCTTTCCATCT
Parg GGTTCCGAAACCTTTTCCAA TACTCCCTGCAGTTCGCTCA
Parp1 AACTTTGCTGGCATCCTGTC TGCACTTTTGGACACCATGT
Smug1 AACCCGGTGGATTATGCTTG GTCCCGGACCACATTCACTT
Tdg TTCCTAACATGGCAGTCACG GCTCTGGGTTTCCTTTTCCT
Tet1 TGTGGGGAGTGCACCTACTG TTGGGGCCATTTACTGGTTT
Methylated DNA immunoprecipitation primers
Bdnf IV −156 to +31 CCCTGGAACGGAATTCTTCT AGTCCTCTCCTCGGTGAATG
Bdnf IXa −171 to +32 CATGAGACCGGGCAAGTC CCTTGGGAGGAATGTGTGAT
Open in a new tab

Methylated DNA immunoprecipitation or hydroxymethylated MeDIP

Primary cortical neuronal culture samples were sonicated to 200–500 bp segments in SDS lysis buffer. DNA was then extracted using proteinase K at 37°C overnight followed by phenol-chloroform extraction. One microgram of DNA was used for each IP and 0.3 μg for input. IP samples were diluted in 250 μl ChIP dilution buffer. Samples were boiled for 10 min and then immediately placed on ice. Samples were incubated with either 4 μl of 5MC monoclonal mouse (Diagenode; C15200081; NJ, USA) or 2 μl of rabbit polyclonal 5HMC antibodies (Active Motif; 39769; CA, USA) overnight on a rotator at 4°C. Subsequently, antibody-DNA complexes were precipitated using Protein A/G PLUS-Agarose beads (Santa Cruz Biotechnology; sc-2003; TX, USA) for 3 h on a rotator at 4°C. Following low salt, high salt, lithium chloride and TE washes, complexes were eluted from beads at 67°C for 2 h using elution buffer. DNA was then extracted using proteinase K at 37°C overnight followed by phenol–chloroform extraction and resuspended in water. Samples were measured using qPCR. IP samples were normalized to input.

We purchased 338 base pair oligonucleotides corresponding to a promoter region of the human adenomatous polyposis coli (APC) gene in which all the cytosines are replaced with either 5HMC, 5MC or unmethylated cytosine (UM; Active Motif; 55008). We performed the hMeDIP procedure as detailed above. We find that this procedure precipitated 99.8% less 5MC oligo, and 89.1% less UM oligo compared with 5HMC oligo, indicating the specificity of this procedure for the 5HMC base.

Bdnf immunoblotting

Primary cortical neuronal culture samples were lysed in buffer containing protease inhibitors. Bdnf quantification was carried out by SDS–PAGE. Nitrocellulose membranes were incubated overnight in 1% blocking solution with rabbit anti-Bdnf (Santa Cruz Biotechnology; sc-546) at a 1:200 dilution. Antirabbit secondary antibody was then used at a 1:2500 dilution in 1% blocking solution. β-actin was detected using mouse anti-β-actin antibody (Sigma-Aldrich; A5316) at a 1:2500 dilution in 5% blocking solution for 30 min followed by anti-mouse secondary antibody at a 1:2500 dilution in 5% blocking solution for 2 h. ECL Prime Western Blotting Detection Reagent (GE Healthcare Life Sciences; RPN2232; NJ, USA) was detected using a Kodak Image Station 4000R Pro and quantified using ImageJ software.

Statistics

Data were analyzed with Student’s t-test or one-way analysis of variance (ANOVA) with post hoc Bonferroni tests as appropriate. All statistical analyses were performed using GraphPad Prism (version 15.0 for Windows). All statistical tests were two sided.

Results

In mouse primary neuronal cultures NMDA increases DNA demethylating gene expression & decreases Dnmts

In NMDA-treated neurons we measured mRNA expression of genes responsible for DNA methylation and demethylation. We find that treatment with NMDA 45 μM for 2 h significantly decreases Dnmt3a (t18 = 2.211; p = 0.04), 3b (t18 = 6.012; p < 0.0001) and Tet1 (t17 = 3.065; p = 0.007) with a trend for a decrease in Dnmt1 (t18 = 1.969; p = 0.06) (Figure 2A & B). Additionally, NMDA induced Gadd45b mRNA expression (t16 = 3.578; p = 0.003), but not other BER pathway genes measured including Apobec1, thymidine and uracil glycosylases, and Parp1 (Figure 2C). A similarly robust induction of Gadd45b is produced by depolarization with veratridine 2 mM (Data not shown) and in prior reports by KCl [36].

Figure 2. N-methyl-D-aspartate induced changes in DNA methylating and demethylating factors in mouse primary cortical neuronal cultures.

Figure 2

Open in a new tab

(A) NMDA 45 μM at 2 h significantly reduces Dnmt3a and 3b mRNA expression with a trend for a decrease in Dnmt1. (B) NMDA induces significant reductions in the expression of Tet1 mRNA. (C) Gadd45b mRNA is significantly induced by NMDA, but expression of no other base excision repair pathway genes measured are affected. (D) NMDA significantly induces Gadd45b and g, which is prevented by co-treatment with NMDA antagonist MK-801 50 μM. MK-801 50 μM alone has no effect on Gadd45 expression. Error bars represent standard error of mean.

*p < 0.05, **p < 0.01, ***p < 0.001.

CTL: Control; NMDA: N-methyl-D-aspartate.

NMDA significantly induces Gadd45b (F3,31 = 6.940; Bonferroni post hoc test; p < 0.001) and g (F3,24 = 4.822; Bonferroni post hoc test; p < 0.05), which is prevented by treatment with NMDA antagonist MK-801 at a dose of 50 μM. MK-801 50 μM alone has no effect on Gadd45 expression (Figure 2D).

NMDA induces both the expression of Bdnf mRNA & protein & removal of 5HMC & 5MC at Bdnf IV & IXa promoters

We find that treatment with NMDA 45 μM for 2 h significantly induces the expression of Bdnf IV (t21 = 3.852; p = 0.0009) and IXa (t13 = 4.272; p = 0.0009) mRNA and Bdnf protein (t17 = 2.235; p = 0.04) (Figures 3B & C). We find significant reductions in 5HMC at both Bdnf IV (t8 = 2.570; p = 0.03) and IXa (t8 = 2.412; p = 0.04) promoters, and a reduction in 5MC at the Bdnf IXa (t7 = 2.301; p = 0.05), but not the IV promoter in primary neuronal cultures treated with NMDA 45 μM for 2 h (Figures 3D & E).

Figure 3. N-methyl-D-aspartate induces Bdnf DNA demethylation.

Figure 3

Open in a new tab

(A) Map of the Bdnf promoter regions examined in this study. The top figure represents the promoter region of Bdnf IV. Each CpG site is represented by a red vertical line. MeDIP and hydroxyl-MeDIP primers encompass a region from −156 to +31 relative to the transcription start site (black horizontal line). This region includes nine CpG sites. For Bdnf IXa, MeDIP and hMeDIP primers encompass a region from −171 to +32 (blue line) relative to the transcription start site. This region includes seven CpG sites. (B) NMDA significantly induces the expression of Bdnf IV and IXa mRNA. (C) NMDA increases Bdnf protein expression after 2 h. Below bar graph is a representative western blot with control (C) and NMDA (N) conditions. (D) NMDA treatment induces a reduction in 5HMC at Bdnf IV and IXa promoters. (E) NMDA treatment leads to a reduction in at Bdnf IXa, while having no effect on Bdnf IV 5MC levels. Error bars represent standard error of mean.

*p < 0.05, ***p < 0.001.

5HMC: 5-hydroxymethylcytosine; 5MC: 5-methylcytosine; CTL: Control; MeDIP: Methylated DNA immunoprecipitation; NMDA: N-methyl-D-aspartate.

For color images please see online at: www.futuremedicine.com/doi/full/10.2217/EPI.15.12

Gadd45b siRNA knockdown (siGadd45b) in primary cortical neuronal cultures

Prior studies have suggested that Gadd45b plays a role in activity-dependent DNA demethylation [36]. However, these studies were conducted in vivo and in the dentate gyrus of the hippocampus [36]. Therefore, it is difficult to discern whether the demethylation event was primarily in neurons or glia, and whether it was truly independent of cell division as glia can divide and dividing neuronal stem cells are found in the dentate gyrus. We transfected siGadd45b into primary mouse cortical neuronal cultures at 6 DIV and harvested cells at 8 DIV. Successful knockdown was assessed based on a significant reduction in Gadd45b mRNA (t22 = 5.884; p < 0.0001) (Figure 4A), without impacting mRNA expression of the other Gadd45 genes. This reduction in Gadd45b affected baseline levels of Bdnf IV (t16 = 6.950; p < 0.0001) but not Bdnf IXa mRNA expression, Bdnf protein levels, nor 5MC or 5HMC at either Bdnf IV or IXa promoters. Gadd45b knockdown also does not affect Tet1 mRNA levels (Figure 4B). However, it did reduce expression of Dnmt3a (t16 = 2.259; p = 0.04) and 3b (t16 = 2.575; p = 0.02).

Figure 4. Effect of Gadd45b knockdown via siRNA in mouse primary cortical neuron culture.

Figure 4

Open in a new tab

(A) Neurons were transfected with either a scrambled nontargeting siRNA (siScr) or a Gadd45b specific siRNA (siGadd45b) at the sixth day in vitro (DIV). Successful knockdown of Gadd45b was assessed based on reduced mRNA expression. siGadd45b produces no significant changes to, Gadd45a or g, the other two Gadd45 isoforms. (B) siGadd45b transfection also has no effect on Tet1 mRNA expression. Error bars represent standard error of mean.

***p < 0.001.

Impaired NMDA-induced changes in gene expression in neurons with reduced Gadd45b levels

We treated neuronal cultures that had been transfected with siGadd45b 48 h earlier with NMDA 45 μM for 2 h. Cells transfected with scrambled RNA (siScr) behaved similarly to nontransfected cells (Figure 3B & C), in that Bdnf IV (t13 = 12.30; p < 0.0001) and IXa mRNA (t16 = 4.077; p = 0.0009) and Bdnf protein expression (t18 = 3.138; p = 0.005) are induced by NMDA (Figure 5A & B). On the other hand, in siGadd45b transfected neurons there is an inability to induce Bdnf IXa mRNA expression, while induction of Bdnf IV is not attenuated (Figure 5A). Similarly, NMDA fails to induce Bdnf protein expression in siGadd45b transfected neurons (Figure 5B). Additionally, Tet1, which decreases in nontransfected and siScr transfected neurons treated with NMDA (t17 = 3.013; p = 0.008), does not in siGadd45b transfected cells (Figure 5C). siGadd45b transfection reduced Dnmt3a and 3b expression with no further significant reduction following NMDA treatment.

Figure 5. Gadd45b is necessary for N-methyl-D-aspartate induction of Bdnf expression.

Figure 5

Open in a new tab

(A) Neurons were transfected with a scrambled nontargeting siRNA (siScr) or a Gadd45b specific siRNA (siGadd45b) at the sixth day in vitro, then treated with NMDA 45 μM for 2 h on day in vitro 8. Results and significance levels are expressed as fold change in NMDA treated cells relative to no NMDA control condition (dotted line). NMDA induces the expression of Bdnf IV and Bdnf IXa in cells transfected with siScr compared with control condition. siGadd45b transfection does not affect NMDA-induced increase in Bdnf IV, but does prevent the induction of Bdnf IXa mRNA expression relative to no NMDA control. (B) Similarly, NMDA induces Bdnf protein expression based on western blot in siScr transfected cells, but fails to in siGadd45b transfected cells. (C) NMDA induces a reduction in Tet1 mRNA expression in siScr neurons relative to control, but siGadd45b transfected cells showed no decrease in expression. Error bars represent standard error of mean.

**p < 0.01, ***p < 0.001.

NMDA: N-methyl-D-aspartate; NS: Non significant.

Impaired NMDA-dependent DNA demethylation in neurons with reduced Gadd45b levels

We measured NMDA-induced Bdnf IXa and Bdnf IV promoter demethylation in siGadd45b transfected neurons. Similar to nontransfected cells (Figure 3D & E), we find that in siScr transfected cells NMDA induces a significant reduction in both 5MC (t25 = 2.407; p = 0.02) and 5HMC (t23 = 3.762; p = 0.001) at the Bdnf IXa promoter and a reduction in 5HMC at the Bdnf IV promoter (t23 = 2.717; p = 0.01) (Figure 6A & B). However, in siGadd45b transfected neurons, NMDA fails to reduce 5MC at the Bdnf IXa promoter (Figure 6A). Moreover, in siGadd45b transfected neurons, NMDA does not merely fail to reduce 5HMC at the Bdnf IXa and Bdnf IV promoters but actually leads to significant increases at Bdnf IV (t14 = 2.682; p = 0.02) and IXa (t15 = 2.981; p = 0.009) (Figure 6B).

Figure 6. Gadd45b is necessary for N-methyl-D-aspartate induced demethylation of Bdnf.

Figure 6

Open in a new tab

(A) Neurons were transfected with a scrambled nontargeting siRNA (siScr) or a Gadd45b-specific siRNA (siGadd45b) at day 6 in vitro (DIV), then treated with NMDA 45 μM for 2 h on day 8 in vitro. Results and significance levels are expressed as fold change in NMDA treated cells relative to no NMDA control condition (dotted line). In siScr transfected cells, NMDA treatment significantly reduces Bdnf IXa promoter 5MC, but does not alter 5MC at the Bdnf IV promoter. siGadd45b eliminates the NMDA-induced reduction in 5MC at the Bdnf IXa promoter. (B) In siScr transfected cells, NMDA treatment significantly reduces Bdnf IV and IXa promoter 5HMC. siGadd45b does not merely prevent the reduction in 5HMC, but in fact causes increases in 5HMC at Bdnf IV and IXa promoters. Error bars represent SEMs.

*p < 0.05, **p < 0.01.

5HMC: 5-hydroxymethylcytosine; 5MC: 5-methylcytosine; NMDA: N-methyl-D-aspartate.

Discussion

The role of Gadd45b as a key coordinator of active DNA demethylation has been largely based on in vivo experiments where it is difficult to distinguish active DNA demethylation that nondividing neurons use exclusively from passive demethylation that can occur in dividing cells such as glia. To avoid these confounding factors we used a homogeneous population of postmitotic cells, mouse E18 primary cortical neuronal cultures. We find that NMDA agonism induces Gadd45b, Bdnf IV and IXa mRNA expression, while reducing Tet1, Dnmt3a and Dnmt3b mRNA expression. In addition, NMDA treatment leads to the removal of 5HMC but not 5MC at the Bdnf IV promoter, and the removal of both 5MC and 5HMC at the Bdnf IXa promoter.

When primary neuronal cultures were transfected with Gadd45b siRNA (siGadd45b) and treated with NMDA, Bdnf IV mRNA expression increases as it does in siScr and nontransfected cells, however there is a lack of Bdnf IXa mRNA or Bdnf protein induction. We find that siGadd45b leads to an increase in 5HMC at Bdnf IV and IXa promoters following NMDA treatment and a lack of removal of 5MC from the Bdnf IXa promoter. These changes are associated with a lack of induction of Bdnf IXa, but they do not appear to affect Bdnf IV induction. In the brain 5HMC accounts for 10–40% of modified cytosines, and exclusively occurs in a CpG context unlike 5MC [50,51]. When located in intragenic regions 5HMC positively correlates with gene transcript levels in the brain [50,52–54], and is abundant in euchromatin in neuronal tissue [20,53,55]. On the other hand, 5HMC at transcription start sites (TSS) often correspond to decreases in gene expression [51,53,56–58]. The fact that an increase in promoter 5HMC was associated with a lack of Bdnf IXa increased expression and did not affect the induction of Bdnf IV may indicate that 5MC is more important in terms of regulating activity-dependent gene expression than 5HMC. Similar to prior reports [36], we did not find neuronal activity to induce the removal of 5MC at the Bdnf IV promoter after an acute treatment and using MeDIP procedures. Overall, the reliable interaction between Gadd45b and Bdnf IXa, in which Gadd45b appears to serve as a factor in the removal of Bdnf IXa promoter 5MC and 5HMC, is a consistent finding from this study, while the regulation of Bdnf IV may involve different mechanisms.

The current study was limited by the fact that we examined two of the nine Bdnf transcripts, one time point was selected, and we did not examine CpGs with single base pair resolution. Bdnf IV was selected in the current study because prior reports indicated that Bdnf IV is demethylated in primary neuronal cultures by depolarization [42,43], and Bdnf IXa was selected because in vivo studies demonstrated that Gadd45b has a role in demethylating its promoter [36]. Other Bdnf transcripts have also been shown to be induced by excitatory neuronal activity [59], but less is known about the dynamics of their promoters’ DNA methylation statuses or whether Gadd45b is involved in their regulation. The lack of base-specific resolution of our methylation assays is also a limitation of the current study. However, there are few established assays capable of independently measuring 5HMC and 5MC outside of a CpG context. While MeDIP is unable to provide base-specific resolution, it is able to measure 5HMC and 5MC separately and without regard to whether the modified cytosine is followed by a guanine.

In the current study, we find that Tet1 expression paralleled changes in 5HMC at the Bdnf IV and IXa promoters. NMDA led to decreases in 5HMC at both promoters and, in agreement with data from the Sweatt lab in which neurons were treated with KCl, decreases in Tet1 mRNA expression [23]. On the other hand, in siGadd45b transfected cells Tet1 expression was not suppressed following NMDA treatment which was associated with an increase in 5HMC at both promoters. Prior studies indicate that Tet1 overexpression is associated with globally increased 5HMC [23]. Basal Bdnf expression in neurons has been shown to be unaffected by Tet1 knockdown and increased by Tet1 overexpression [15,23]. However, the effects of nonsuppression of Tet1 during excitatory neuronal activity on Bdnf expression to our knowledge have not been documented previously. Future studies utilizing immunoprecipitation under control and NMDA conditions are required to identify whether Gadd45b directly binds to the Tet1 promoter. However, it is also possible that under NMDA stimulation Gadd45b affects the expression of other transcription factors or epigenetic enzymes that decrease Tet1.

Conclusion

In conclusion, our results indicate the importance of Gadd45b in NMDA-induced demethylation. Based on these results we propose a mechanism whereby neuronal excitatory activity initiates the suppression of Dnmt expression and in part through Gadd45b leads to a reduction in Tet1 enzyme expression, thereby reducing the production of 5MC and 5HMC (Figure 1A). On the other hand, when Gadd45b is reduced via siRNA there is an elimination of Tet1 suppression. This leads to greater production of 5HMC from 5MC. Moreover, the Gadd45b deficit directly affects the removal of 5HMC in that it is no longer able to coordinate the BER machinery [15,28,29]. Thus, Gadd45b knockdown does not merely prevent the removal of 5HMC, but in fact leads to an increase. Ultimately, this may increase 5MC as the result of a backup of the demethylation pathway or it may be possible that Gadd45b removes 5MC at times independently of 5HMC (Figure 1B). Furthermore, these results suggest a nonlinear relationship between 5HMC in gene promoter regions and gene expression. By elucidating the roles of these modifications and the proteins that mediate their removal independently in neurons it may become possible to develop targeted therapeutics that enhance expression of genes implicated in mental illnesses such as Bdnf.

Future perspective

Without the existence of active DNA demethylation, neurons once misprogrammed could never be reprogrammed as the DNA methyl mark can persist across a lifetime as well as be passed to subsequent generations [60–63] The potential to pharmacologically alter this code would then be minimal due to the stability of the covalent bonds that link methyl groups to cytosines. In other words, if not for the DNA demethylation pathway chronic mental illnesses characterized by dysfunctional neuronal networks in part encoded by aberrant DNA methyl marks would be irreversible because of the stability of the methyl-cytosine bond. By elucidating the key players in the DNA demethylation pathway it may become possible to pharmacologically target this pathway to rewrite neuronal identity, thereby forming new more beneficial networks. This would allow for not merely treating an otherwise chronic mental illness, but actually reversing its underlying pathology.

Executive summary.

  • The role of Gadd45b as a key coordinator of active DNA demethylation has been largely based on in vivo experiments where it is difficult to distinguish active DNA demethylation that nondividing neurons use exclusively from passive demethylation that can occur in dividing cells such as glia.

  • To avoid these confounding factors we used a homogeneous population of postmitotic cells, mouse E18 primary cortical neuronal cultures.

  • We find that N-methyl-D-aspartate (NMDA) agonism induces Gadd45b, Bdnf IV and IXa mRNA expression, while reducing Tet1, Dnmt3a and Dnmt3b mRNA expression.

  • NMDA induces a significant reduction in 5-hydroxymethylcytsine (5HMC) at both Bdnf IV and IXa promoters, and a reduction in 5-methylcytosine (5MC) at the Bdnf IXa but not the IV promoter in primary neuronal cultures.

  • In siGadd45b siRNA transfected neurons the increase in Bdnf IXa mRNA and decrease in Tet1 mRNA expression is abolished following NMDA treatment.

  • In Gadd45b siRNA transfected neurons, NMDA fails to reduce 5MC at the Bdnf IXa promoter, and in fact leads to significant increases of 5HMC at Bdnf IV and IXa promoters.

  • Our results indicate that Gadd45b might be involved in the removal of 5MC and 5HMC at Bdnf promoters.

  • These results contribute to our understanding of DNA demethylation mechanisms in neurons, and their roles in regulating NMDA regulated genes implicated in mental illnesses.

Acknowledgments

The authors thank X Zhang and M Sharma for their technical assistance.

Footnotes

For reprint orders, please contact: reprints@futuremedicine.com

Ethical conduct of research

The authors state that they have obtained appropriate institutional review board approval or have followed the principles outlined in the Declaration of Helsinki for all human or animal experimental investigations. In addition, for investigations involving human subjects, informed consent has been obtained from the participants involved.

Financial & competing interests disclosure

This work was supported by the Department of Veterans Affairs Career Development Award (CDA-2) (IK2BX001650) (DP Gavin), Merit Review Grant; Research Career Scientist award (SC Pandey), and VHA (I01BX001819) (M Guizzetti), and NIH/National Institute on Alcohol Abuse and Alcoholism Grants (NIAAA) (AA-010005) (SC Pandey), (AA021876) (M Guizzetti), and NARSAD Young Investigator Award donation from The Family of Joseph M Evans (DP Gavin). The authors have no other relevant affiliations or financial involvement with any organization or entity with a financial interest in or financial conflict with the subject matter or materials discussed in the manuscript apart from those disclosed.

No writing assistance was utilized in the production of this manuscript.

References

Papers of special note have been highlighted as:

• of interest; •• of considerable interest

  • 1.Weaver IC, Cervoni N, Champagne FA, et al. Epigenetic programming by maternal behavior. Nat Neurosci. 2004;7(8):847–854. doi: 10.1038/nn1276. [DOI] [PubMed] [Google Scholar]
  • 2.Sharma RP, Gavin DP, Grayson DR. CpG methylation in neurons: message, memory, or mask? Neuropsychopharmacology. 2010;35(10):2009–2020. doi: 10.1038/npp.2010.85. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Bird A. DNA methylation patterns and epigenetic memory. Genes Dev. 2002;16(1):6–21. doi: 10.1101/gad.947102. [DOI] [PubMed] [Google Scholar]
  • 4.Cortese R, Lewin J, Backdahl L, et al. Genome-wide screen for differential DNA methylation associated with neural cell differentiation in mouse. PLoS ONE. 2011;6(10):e26002. doi: 10.1371/journal.pone.0026002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5•.De Carvalho DD, You JS, Jones PA. DNA methylation and cellular reprogramming. Trends Cell Biol. 2010;20(10):609–617. doi: 10.1016/j.tcb.2010.08.003. Review indicating the potential to target DNA methylation to reprogram terminally differentiated cells. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Deaton AM, Webb S, Kerr AR, et al. Cell type-specific DNA methylation at intragenic CpG islands in the immune system. Genome Res. 2011;21(7):1074–1086. doi: 10.1101/gr.118703.110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Iwamoto K, Bundo M, Ueda J, et al. Neurons show distinctive DNA methylation profile and higher interindividual variations compared with non-neurons. Genome Res. 2011;21(5):688–696. doi: 10.1101/gr.112755.110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Levenson JM, Roth TL, Lubin FD, et al. Evidence that DNA (cytosine-5) methyltransferase regulates synaptic plasticity in the hippocampus. J Biol Chem. 2006;281(23):15763–15773. doi: 10.1074/jbc.M511767200. [DOI] [PubMed] [Google Scholar]
  • 9.Mill J, Petronis A. Profiling DNA methylation from small amounts of genomic DNA starting material: efficient sodium bisulfite conversion and subsequent whole-genome amplification. Methods Mol Biol. 2009;507:371–381. doi: 10.1007/978-1-59745-522-0_27. [DOI] [PubMed] [Google Scholar]
  • 10.Abdolmaleky HM, Cheng KH, Faraone SV, et al. Hypomethylation of MB-COMT promoter is a major risk factor for schizophrenia and bipolar disorder. Hum Mol Genet. 2006;15(21):3132–3145. doi: 10.1093/hmg/ddl253. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Abdolmaleky HM, Cheng KH, Russo A, et al. Hypermethylation of the reelin (RELN) promoter in the brain of schizophrenic patients: a preliminary report. Am J Med Genet B Neuropsychiatr Genet. 2005;134B(1):60–66. doi: 10.1002/ajmg.b.30140. [DOI] [PubMed] [Google Scholar]
  • 12.Guidotti A, Auta J, Chen Y, et al. Epigenetic GABAergic targets in schizophrenia and bipolar disorder. Neuropharmacology. 2011;60(7–8):1007–1016. doi: 10.1016/j.neuropharm.2010.10.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Feng J, Chang H, Li E, Fan G. Dynamic expression of de novo DNA methyltransferases Dnmt3a and Dnmt3b in the central nervous system. J Neurosci Res. 2005;79(6):734–746. doi: 10.1002/jnr.20404. [DOI] [PubMed] [Google Scholar]
  • 14.Feng J, Zhou Y, Campbell SL, et al. Dnmt1 and Dnmt3a maintain DNA methylation and regulate synaptic function in adult forebrain neurons. Nat Neurosci. 2010;13(4):423–430. doi: 10.1038/nn.2514. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15••.Guo JU, Su Y, Zhong C, Ming GL, Song H. Hydroxylation of 5-methylcytosine by TET1 promotes active DNA demethylation in the adult brain. Cell. 2011;145(3):423–434. doi: 10.1016/j.cell.2011.03.022. Provides evidence that Tet1 and 5-hydroxymethylcytosine (5HMC) are involved in the activity-dependent regulation of Bdnf. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Ito S, D’Alessio AC, Taranova OV, Hong K, Sowers LC, Zhang Y. Role of Tet proteins in 5mC to 5hmC conversion, ES-cell self-renewal and inner cell mass specification. Nature. 2010;466(7310):1129–1133. doi: 10.1038/nature09303. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Pastor WA, Pape UJ, Huang Y, et al. Genome-wide mapping of 5-hydroxymethylcytosine in embryonic stem cells. Nature. 2011;473(7347):394–397. doi: 10.1038/nature10102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Wu H, D’Alessio AC, Ito S, et al. Dual functions of Tet1 in transcriptional regulation in mouse embryonic stem cells. Nature. 2011;473(7347):389–393. doi: 10.1038/nature09934. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Xu Y, Wu F, Tan L, et al. Genome-wide regulation of 5hmC, 5mC, and gene expression by Tet1 hydroxylase in mouse embryonic stem cells. Mol Cell. 2011;42(4):451–464. doi: 10.1016/j.molcel.2011.04.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Ficz G, Branco MR, Seisenberger S, et al. Dynamic regulation of 5-hydroxymethylcytosine in mouse ES cells and during differentiation. Nature. 2011;473(7347):398–402. doi: 10.1038/nature10008. [DOI] [PubMed] [Google Scholar]
  • 21.Koh KP, Yabuuchi A, Rao S, et al. Tet1 and Tet2 regulate 5-hydroxymethylcytosine production and cell lineage specification in mouse embryonic stem cells. Cell Stem Cell. 2011;8(2):200–213. doi: 10.1016/j.stem.2011.01.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Williams K, Christensen J, Pedersen MT, et al. TET1 and hydroxymethylcytosine in transcription and DNA methylation fidelity. Nature. 2011;473(7347):343–348. doi: 10.1038/nature10066. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23••.Kaas GA, Zhong C, Eason DE, et al. TET1 controls CNS 5-methylcytosine hydroxylation, active DNA demethylation, gene transcription, and memory formation. Neuron. 2013;79(6):1086–1093. doi: 10.1016/j.neuron.2013.08.032. Elucidates the role of Tet1 in the brain and indicates which DNA demethylation genes are induced by neuronal depolarization. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Morgan HD, Dean W, Coker HA, Reik W, Petersen-Mahrt SK. Activation-induced cytidine deaminase deaminates 5-methylcytosine in DNA and is expressed in pluripotent tissues: implications for epigenetic reprogramming. J Biol Chem. 2004;279(50):52353–52360. doi: 10.1074/jbc.M407695200. [DOI] [PubMed] [Google Scholar]
  • 25.Popp C, Dean W, Feng S, et al. Genome-wide erasure of DNA methylation in mouse primordial germ cells is affected by AID deficiency. Nature. 2010;463(7284):1101–1105. doi: 10.1038/nature08829. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Hendrich B, Hardeland U, Ng HH, Jiricny J, Bird A. The thymine glycosylase MBD4 can bind to the product of deamination at methylated CpG sites. Nature. 1999;401(6750):301–304. doi: 10.1038/45843. [DOI] [PubMed] [Google Scholar]
  • 27.He YF, Li BZ, Li Z, et al. Tet-mediated formation of 5-carboxylcytosine and its excision by TDG in mammalian DNA. Science. 2011;333(6047):1303–1307. doi: 10.1126/science.1210944. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Cortellino S, Xu J, Sannai M, et al. Thymine DNA glycosylase is essential for active DNA demethylation by linked deamination-base excision repair. Cell. 2011;146(1):67–79. doi: 10.1016/j.cell.2011.06.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Rai K, Huggins IJ, James SR, Karpf AR, Jones DA, Cairns BR. DNA demethylation in zebrafish involves the coupling of a deaminase, a glycosylase, and Gadd45. Cell. 2008;135(7):1201–1212. doi: 10.1016/j.cell.2008.11.042. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Spruijt CG, Gnerlich F, Smits AH, et al. Dynamic readers for 5-(hydroxy)methylcytosine and its oxidized derivatives. Cell. 2013;152(5):1146–1159. doi: 10.1016/j.cell.2013.02.004. [DOI] [PubMed] [Google Scholar]
  • 31.Kemmerich K, Dingler FA, Rada C, Neuberger MS. Germline ablation of SMUG1 DNA glycosylase causes loss of 5-hydroxymethyluracil- and UNG-backup uracil-excision activities and increases cancer predisposition of Ung−/−Msh2−/− mice. Nucleic Acids Res. 2012;40(13):6016–6025. doi: 10.1093/nar/gks259. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Hevroni D, Rattner A, Bundman M, et al. Hippocampal plasticity involves extensive gene induction and multiple cellular mechanisms. J Mol Neurosci. 1998;10(2):75–98. doi: 10.1007/BF02737120. [DOI] [PubMed] [Google Scholar]
  • 33.Keeley MB, Wood MA, Isiegas C, et al. Differential transcriptional response to nonassociative and associative components of classical fear conditioning in the amygdala and hippocampus. Learn Mem. 2006;13(2):135–142. doi: 10.1101/lm.86906. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Leach PT, Poplawski SG, Kenney JW, et al. Gadd45b knockout mice exhibit selective deficits in hippocampus-dependent long-term memory. Learn Mem. 2012;19(8):319–324. doi: 10.1101/lm.024984.111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Sultan FA, Wang J, Tront J, Liebermann DA, Sweatt JD. Genetic deletion of Gadd45b, a regulator of active DNA demethylation, enhances long-term memory and synaptic plasticity. J Neurosci. 2012;32:17059–17066. doi: 10.1523/JNEUROSCI.1747-12.2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36••.Ma DK, Jang MH, Guo JU, et al. Neuronal activity-induced Gadd45b promotes epigenetic DNA demethylation and adult neurogenesis. Science. 2009;323(5917):1074–1077. doi: 10.1126/science.1166859. Initial report on the role of Gadd45b in DNA demethylation of Bdnf in the brain. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Yi YW, Kim D, Jung N, Hong SS, Lee HS, Bae I. Gadd45 family proteins are coactivators of nuclear hormone receptors. Biochem Biophys Res Commun. 2000;272(1):193–198. doi: 10.1006/bbrc.2000.2760. [DOI] [PubMed] [Google Scholar]
  • 38.Carrier F, Georgel PT, Pourquier P, et al. Gadd45, a p53- responsive stress protein, modifies DNA accessibility on damaged chromatin. Mol Cell Biol. 1999;19(3):1673–1685. doi: 10.1128/mcb.19.3.1673. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Greenberg ME, Xu B, Lu B, Hempstead BL. New insights in the biology of BDNF synthesis and release: implications in CNS function. J Neurosci. 2009;29(41):12764–12767. doi: 10.1523/JNEUROSCI.3566-09.2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Zuccato C, Cattaneo E. Brain-derived neurotrophic factor in neurodegenerative diseases. Nat Rev Neurol. 2009;5(6):311–322. doi: 10.1038/nrneurol.2009.54. [DOI] [PubMed] [Google Scholar]
  • 41.Aid T, Kazantseva A, Piirsoo M, Palm K, Timmusk T. Mouse and rat BDNF gene structure and expression revisited. J Neurosci Res. 2007;85(3):525–535. doi: 10.1002/jnr.21139. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42••.Chen WG, Chang Q, Lin Y, et al. Derepression of BDNF transcription involves calcium-dependent phosphorylation of MeCP2. Science. 2003;302(5646):885–889. doi: 10.1126/science.1086446. Initial report of active DNA demethylation of Bdnf in nondividing cells. [DOI] [PubMed] [Google Scholar]
  • 43.Martinowich K, Hattori D, Wu H, et al. DNA methylation-related chromatin remodeling in activity-dependent BDNF gene regulation. Science. 2003;302(5646):890–893. doi: 10.1126/science.1090842. [DOI] [PubMed] [Google Scholar]
  • 44.Sales AJ, Biojone C, Terceti MS, Guimaraes FS, Gomes MV, Joca SR. Antidepressant-like effect induced by systemic and intra-hippocampal administration of DNA methylation inhibitors. Br J Pharmacol. 2011;164(6):1711–1721. doi: 10.1111/j.1476-5381.2011.01489.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Gavin DP, Chase KA, Sharma RP. Active DNA demethylation in post-mitotic neurons: A reason for optimism. Neuropharmacology. 2013;75:233–245. doi: 10.1016/j.neuropharm.2013.07.036. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Ikegame T, Bundo M, Sunaga F, et al. DNA methylation analysis of BDNF gene promoters in peripheral blood cells of schizophrenia patients. Neurosci Res. 2013;77(4):208–214. doi: 10.1016/j.neures.2013.08.004. [DOI] [PubMed] [Google Scholar]
  • 47.Guizzetti M, Moore NH, Giordano G, Costa LG. Modulation of neuritogenesis by astrocyte muscarinic receptors. J Biol Chem. 2008;283(46):31884–31897. doi: 10.1074/jbc.M801316200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.VanDeMark KL, Guizzetti M, Giordano G, Costa LG. The activation of M1 muscarinic receptor signaling induces neuronal differentiation in pyramidal hippocampal neurons. J Pharmacol Exp Ther. 2009;329(2):532–542. doi: 10.1124/jpet.108.150128. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Jiang X, Tian F, Mearow K, Okagaki P, Lipsky RH, Marini AM. The excitoprotective effect of N-methyl-D-aspartate receptors is mediated by a brain-derived neurotrophic factor autocrine loop in cultured hippocampal neurons. J Neurochem. 2005;94(3):713–722. doi: 10.1111/j.1471-4159.2005.03200.x. [DOI] [PubMed] [Google Scholar]
  • 50.Szulwach KE, Li X, Li Y, et al. 5-hmC-mediated epigenetic dynamics during postnatal neurodevelopment and aging. Nat Neurosci. 2011;14(12):1607–1616. doi: 10.1038/nn.2959. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51•.Lister R, Mukamel EA, Nery JR, et al. Global epigenomic reconfiguration during mammalian brain development. Science. 2013;341(6146):1237905. doi: 10.1126/science.1237905. Important report indicating the importance and high amount of non-CpG DNA methylation in the brain. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Jin SG, Wu X, Li AX, Pfeifer GP. Genomic mapping of 5-hydroxymethylcytosine in the human brain. Nucleic Acids Res. 2011;39(12):5015–5024. doi: 10.1093/nar/gkr120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Hahn MA, Qiu R, Wu X, et al. Dynamics of 5-hydroxymethylcytosine and chromatin marks in Mammalian neurogenesis. Cell Rep. 2013;3(2):291–300. doi: 10.1016/j.celrep.2013.01.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Song CX, Szulwach KE, Fu Y, et al. Selective chemical labeling reveals the genome-wide distribution of 5-hydroxymethylcytosine. Nat Biotechnol. 2011;29(1):68–72. doi: 10.1038/nbt.1732. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Mellen M, Ayata P, Dewell S, Kriaucionis S, Heintz N. MeCP2 binds to 5hmC enriched within active genes and accessible chromatin in the nervous system. Cell. 2012;151(7):1417–1430. doi: 10.1016/j.cell.2012.11.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Wen L, Li X, Yan L, et al. Whole-genome analysis of 5-hydroxymethylcytosine and 5-methylcytosine at base resolution in the human brain. Genome Biol. 2014;15(3):R49. doi: 10.1186/gb-2014-15-3-r49. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Sun Z, Terragni J, Borgaro JG, et al. High-resolution enzymatic mapping of genomic 5-hydroxymethylcytosine in mouse embryonic stem cells. Cell Rep. 2013;3(2):567–576. doi: 10.1016/j.celrep.2013.01.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Yu M, Hon GC, Szulwach KE, et al. Base-resolution analysis of 5-hydroxymethylcytosine in the mammalian genome. Cell. 2012;149(6):1368–1380. doi: 10.1016/j.cell.2012.04.027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Sharma RP, Tun N, Grayson DR. Depolarization induces downregulation of DNMT1 and DNMT3a in primary cortical cultures. Epigenetics. 2008;3(2):74–80. doi: 10.4161/epi.3.2.6103. [DOI] [PubMed] [Google Scholar]
  • 60.Anway MD, Leathers C, Skinner MK. Endocrine disruptor vinclozolin induced epigenetic transgenerational adult-onset disease. Endocrinology. 2006;147(12):5515–5523. doi: 10.1210/en.2006-0640. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Heijmans BT, Tobi EW, Stein AD, et al. Persistent epigenetic differences associated with prenatal exposure to famine in humans. Proc Natl Acad Sci USA. 2008;105(44):17046–17049. doi: 10.1073/pnas.0806560105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Morgan HD, Sutherland HG, Martin DI, Whitelaw E. Epigenetic inheritance at the agouti locus in the mouse. Nat Genet. 1999;23(3):314–318. doi: 10.1038/15490. [DOI] [PubMed] [Google Scholar]
  • 63.Rakyan VK, Chong S, Champ ME, et al. Transgenerational inheritance of epigenetic states at the murine Axin(Fu) allele occurs after maternal and paternal transmission. Proc Natl Acad Sci USA. 2003;100(5):2538–2543. doi: 10.1073/pnas.0436776100. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES