Abstract
This work provides insight into several mechanisms involved in boron (B) regulation pathway in response to high B conditions in Citrus. The study was carried out in Citrus macrophylla W. (Cm) seedlings cultured “in vitro” in media with 50 or 400 μM H3BO3 (control, Ct, and B-excess, +B, plants, respectively). Growth parameters, B concentration, leaf chlorophyll (Chl) concentration, the expression of the main putative genes involved in B transport and distribution, and leaf and root proline and malonaldehyde (MDA) concentrations, were assessed. Excess B led to high B concentration in +B plants (3.8- and 1.4-fold in leaves and roots, respectively) when compared with Ct ones. However, a minor effect was recorded in the plant (incipient visual symptoms, less than 27% reduction in root growth and 26% decrease in Chl b concentration). B toxicity down-regulated by half the expression level of putative B transporter genes NIP5 and PIP1. CmBOR1 gene was not repressed in +B plants and B accumulated in the shoots. High B level increased the transcripts of putative gene TIP5, involved in B transport across the tonoplast, by 3.3- and 2.4-fold in leaves and roots, respectively. The activity of V-PPiase proton pump, related with the electrochemical gradient in the vacuole, was also enhanced in +B organs. B toxicity up-regulated putative BOR4 gene (2.1- and 2.7-fold in roots and leaves, respectively), which codifies for an active efflux B transporter. Accordingly, B was located in +B plants preferently in an insoluble form on cell walls. Finally, excess B caused a significant rise in proline concentration (51% and 34% in roots and leaves, respectively), while the MDA level did not exceed 20%. In conclusion, Cm tolerance to a high B level is likely based on the synergism of several specific mechanisms against B toxicity, including: 1/ down-regulation of NIP5 and PIP1 boron transporters; 2/ activation of B efflux from cells due to the up-regulation of putative BOR4 gene; 3/ compartmentation of B in the vacuole through TIP5 transporter activation and the acidification of the organelle; 4/ insolubilisation of B and deposition in cell walls preventing from cytoplasm damage; and, 5/ induction of an efficient antioxidant system through proline accumulation.
Introduction
Boron (B) is an essential micronutrient required in major physiological functions for the normal growth and development of higher plants [1]. This element participates in cell wall structure formation through the borate-diol bonding of two rhamnogalacturonan II molecules. It is also involved in root elongation, carbohydrate metabolism, phenol accumulation, pollen-tube growth and cell membrane integrity [2]. Boron excess occurs mostly by irrigation with high B level in water, or in arid and semiarid areas where water reaches topsoil by capillarity and then evaporates to cause B accumulation.
As boron accumulates in leaves as they age, B toxicity symptoms usually appear on older leaves, first as leaf tip and margin yellowing or mottling, then with a brownish burnt appearance, which finally ends in premature fall at high concentration levels [3]. It can also occasionally appear resinous gum spots on the undersides of leaves and it is as well associated with a shortened distance between leaf nodes. Therefore, severe B toxicity may induce loss of vigour, shorter branches, and even twig dieback.
It is widely accepted that Citrus is a sensitive crop to B excess, whose toxicity causes major disorders that lead to loss of yield [4]. However, further research is needed to better understand the regulation of the mechanisms involved in the whole response of citrus plants to the presence of high B levels in the media. Thus, after entering roots, boron is transported through xylem vessels, mostly bound to cell wall structures (insoluble B pool) or accumulated in apoplastic fluids (soluble B pool), while only another low soluble portion enters cells [4]. In plants, boron homeostasis seems to be related to the synergic regulation of several genes involved in B uptake, transport and partitioning in the aerial part [5]. Moreover, vacuolar compartmentation might also play a key role in B tolerance of cells [6].
On the molecular basis, the first B transporter identified in a biological system was Arabidopsis thaliana BOR1, an essential efflux-type B transporter for efficient loading of B in the xylem [7]. This gene is expressed mainly in root pericycle cells and its overexpression enhances root to shoot B translocation under B-limiting conditions [8]. When analysing the complete A. thaliana genome, six sequences were found to have a high homology with AtBOR1 [1]. Among them, only AtBOR4 has been characterised [9], and its overexpression markedly improves A. thaliana growth under high B conditions through B efflux. In fruit crops, VvBOR1 and CmBOR1 have been recently characterised as B transporters in Vitis vinfera and Citrus macrophylla, respectively [10,11].
Moreover, NIP5 is a boric acid channel that facilitates B influx to root cells in A. thaliana and B. napus [12,13]. It is localised to the plasma membrane on the outer side of epidermal, cortical and endodermal cells in roots. NIP5;1 is required for the uptake of B from the root surface and its accumulation is regulated in response to B deprivation [12]. In A. thaliana, the overexpression of AtNIP5;1 results in root elongation under B-deficient conditions, which improves short-term B uptake [14]. Also, some evidences indicate that other PIPs aquaporins are also involved in B transport [15].
Finally, the vacuolar compartmentation of B has been related to the activity of AtTIP5, an aquaporin family member localised to the cell tonoplast membrane [16]. Under toxic B conditions, the AtTIP5;1 overexpression has been reported to lower the cytoplasmic B concentration by accumulating B in the vacuole to, therefore, confer cell tolerance to toxic B levels [16]. Moreover, some proton pumps located in the vacuolar membrane, particularly tonoplast adenosine-triphosphatase subunit A (V-ATPase A) and tonoplast pyrophosphatase (V-PPiase), have been reported to be altered under different environmental stresses, such as B toxicity or salinity [17,18].
In addition to molecular regulation, some biochemical indicators related with oxidative stress and osmoprotective compounds, notably proline, have been well-defined in studies of plants subjected to different stresses [19,20]. The possible roles attributed to proline are balance of osmotic pressure, preservation of enzymes in the cytoplasm, detoxification of reactive oxygen species (ROS) and protection of membranes against lipid peroxidation [21]. However, data on proline and B toxicity are still scarce, and the role of this molecule regarding such nutritional stress is still not clear.
Citrus species differ in their susceptibility to B concentration [3,21]. Citrus macrophylla stands for a clementine species [22] and is classified as a potential tolerant one to B toxicity [23]. Hence the study of this plant’s global response when cultured under extreme B availability conditions could provide prospective insights into the mechanisms that determine Citrus tolerance to B excess. For this purpose, seedlings of C. macrophylla were cultured in media with normal B and at a high B level to study: A) the expression level of the main putative genes controlling B homeostasis within the plant under the above-mentioned conditions; B) boron distribution in different plant organs and compartmentation inside cells; C) the role of osmoprotective regulation against oxidative stress due to B excess.
Materials and methods
Ethics statement
The experiments were conducted in the Department of Citriculture and Vegetal Production from Valencian Institute of Agrarian Research (Moncada, Spain). Dr. Mary-Rus Martínez-Cuenca was response for experimental analysis in this manuscript and can be contacted in the future. The authors declare that this manuscript does not matter the any ethic issue and it does not involve endangered or protected species.
Plant material and treatments
Seeds of Citrus macrophylla W. were sterilised for 5 min in a 2% v/v commercial bleach (0.5 M NaClO) solution prior to seed coat removal, rinsed 3 times with sterilized deionized water and transferred to a media containing distilled water (pH 6.0) with 0.4% agar added (Difco Bacto). Media were previously autoclaved at 120ºC for 20 min and distributed in 150 x 25-mm tubes (40 mL per tube). Seeds (one seed per tube) were germinated in a growth chamber (Sanyo MCR-350H, Sanyo Electric Biochemical Co, Japan) at 20-22/26-28ºC night/day temperatures, 80% relative humidity and 250 µmol m-2 s-1 photosynthetic photon flux density for 16 h per day.
After 20 days, seedlings with a single shoot were selected for uniformity and transferred individually after removing cotyledons in plastic 50 mL tubes containing a basic nutrient solution [1.5 mM Ca(NO3)2, 1.5 mM KNO3, 1 mM MgSO4, 1.2 mM H3PO4, 20 µM Fe-EDDHA, 7.65 µM ZnSO4·7H2O, 54.4 µM MnSO4·H2O, 0.55 µM MoO3, 0.5 µM CuSO4·5H2O] and 50 or 400 µM H3BO3 (Ct or +B, respectively). All the media were supplemented with 0.25% agar (pH 6.0) and sterilized as previously described. Seedlings were kept for 25 days under the same growth chamber conditions as described above.
Plant growth
After 25 days of conditioning, seedlings were removed from culture tubes, rinsed with distilled water and divided into leaves, stems and roots. The length (in cm) of stems and roots was measured. Organs were fresh weighed and dried in a forced draft oven at 70ºC for 48 h until constant weight (DW, in mg).
Total, soluble and insoluble B fractions
Roots and leaves samples were split into two subsamples each (0.5 g) and used for determination of B total (Bt) and B fractions (Bf) concentrations. Stem samples were used only for Bt determination. Bt concentration was measured according to [24]. Dry tissues (0.5 g) were burnt in a muffle furnace at 550ºC for 12 h. B was extracted with 0.1 N hydrochloridric acid, HCl, (Hiperpur Panreac) to a final volume of 5 mL. Bf (soluble in water, soluble in organic solvents and insoluble) concentration was measured according to [25]. Samples were frozen and ground into fine powder in liquid nitrogen (N2) by a mortar. The powder was homogenized with 10 volumes of ice-cold water and centrifuged at 1,000 rpm for 10 min. The precipitate was washed with 10 volumes of ice-cold water and re-centrifuged. The combined supernatants were defined as water-soluble B fraction, which is B mainly found in the cells free space. The residue was washed 3 times with 10 volumes of 80% ethanol, once with 10 volumes of methanol:chloroform mixture (1:1, v/v) and once with 10 volumes of acetone, to extract B inside the protoplast and apparently linked to organic molecules. The insoluble pellet was used for B bound to cell wall. All fractions were dried and ashed similarly as Bt samples. Bt and Bf concentrations were determined by inductively coupled plasma atomic emission spectroscopy (ICP-AES iCAP 6000, Thermo Scientific).
Leaf Chl concentration
Leaf chlorophyll (Chl) concentration was measured according to Moran and Porath [26]. Samples from the two youngest fully expanded leaves per plant were separately ground with a mortar in N2. Fresh material (0.05 g) was incubated in 4 mL N,N-dimethylformamide at 4ºC for 72 h and centrifuged at 4,000 rpm and 4ºC for 15 min (Eppendorf Centrifuge 5810R, AG, Hamburg, Germany). Supernatant was left for 1 h in the presence of Na2SO4 and the absorbance was measured at 664 and 647 nm (Lambda 25, PerkinElmer, Shelton, CT, USA). The average value of the two leaves was considered representative of each plant.
Proline and MDA concentration
Free-proline concentration in leaves and roots was determined according to Delauney and Verma [19]. Fresh tissue was ground with a mortar in N2. Sample material (0.1 g) was homogenized (Vortex) in 1.5 mL sulphosalicylic acid (3%) for 1 min, centrifuged at 14,000 rpm for 5 min (Eppendorf Centrifuge 5810R, AG, Hamburg, Germany) and the supernatant was stored at 4ºC. An aliquot (0.2 mL) was incubated with 0.5 mL sulphosalicylic acid (3%), 0.7 mL reactive ninhydrin acid reagent (ninhydrin, phosphoric acid 6 M, glacial acetic acid 60%) and 0.6 mL glacial acetic acid (99%) in a dry bath at 100ºC for 1 h (Thermostatic Bath BD, Bunsen SA, Humanes, Spain). Samples were cooled down in an ice bath for 15 min and absorbance was measured at 520 nm (SmartSpec Plus, Bio-Rad, West Berkeley, California, USA).
Lipid peroxidation in leaves and roots was determined by measuring the malondialdehyde (MDA) concentration according to Hodges et al. [27]. Frozen sample material (0.1 g) was homogenized (Polytron PT 3100, Lucerne, Switzerland) in 5 mL of cold ethanol (80%) at 10,000 rpm for 1 min, centrifuged at 3,000 rpm for 30 min and 4ºC (Eppendorf Centrifuge 5810R, AG, Hamburg, Germany) and the supernatant was stored at 4ºC: (a) an aliquot (1 mL) was combined with an equal volume of a 20% trichloroacetic solution (TCA), while (b) another aliquot (1 mL) was combined with an equal volume of a 0.5% thiobarbituric acid (TBA) and 20% TCA solution. Test tubes were covered with glass marbles to avoid evaporation and incubated at 90ºC for 1 h in a water bath (Thermostatic Bath BD, Bunsen SA, Humanes, Spain). Samples were cooled down in an ice bath for 15 min and centrifuged at 1,000 rpm for 15 min and 4ºC (Eppendorf Centrifuge 5810R, AG, Hamburg, Germany). Absorbance of supernatant (a) was measured at 532 and 600 nm (SmartSpec Plus, Bio-Rad, West Berkeley, California, USA) using 20% TCA as a blank. Absorbance of supernatant (b) was measured at 440, 532 and 600 nm using a solution of 0.5% TBA and 20% TCA as a blank. Concentration of MDA was calculated using an extinction coefficient of 155 mM-1 cm-1.
RNA extraction and real-time RT-PCR analysis
Total plant RNA from leaf and root tissues was extracted using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany). Fresh samples (0.1 g) were ground with a mortar in N2. To remove genomic DNA, RNA samples were treated with RNase free DNase (Qiagen) following the manufacturer’s instructions. RNA quality and concentration were assessed with ND-1000 full spectrum UV-Vis spectrophotometer (Nanodrop Technologies, Thermo Fisher Scientific, Delaware, USA). Quantitative real-time polymerase chain reactions (RT-PCR) were run in a LightCycler 2.0 Instrument (Roche, Diagnostics GmbH, Mannheim, Germany) equipped with version 4.0 of the Light Cycler Software. Reactions contained 2.5 units of MultiScribe Reverse Transcriptase (Applied Biosystems, Roche Molecular Systems, New Yersey, USA), 1 unit of RNase Inhibitor (Applied Biosystems), 2 µL of LC Fast Start DNA Master PLUS SYBR Green I (Roche), 25 ng of total RNA, and 250 nM of the specific forward and reverse primers in a total volume of 10 µL. The PCR programme was run at 48ºC for 30 min, 95ºC for 10 min, followed by 45 cycles at 95ºC for 2 s, 58ºC for 8 s and 72ºC for 8 s. The fluorescent intensity data were acquired during the 72ºC extension step and were transformed into relative mRNA values using a 10-fold dilution series of an RNA sample as a standard curve. The relative mRNA levels were normalized to total RNA amounts as previously described [28]. Actin was used as the reference gene [29] and the specificity of the amplification reactions was assessed by post-amplification dissociation curves and by sequencing the reaction product. At least three independent RNA extractions and real-time reactions with three technical replicates per sample were performed. Putative BOR4 and TIP5 genes were identified by a homology search in the clementine genome full-length Phytozome v9.0 database [30]. The expression levels of NIP5, PIP1, PIP2, CmBOR1, V-PPiase and V-ATPase A genes were evaluated using the forward and reverse primers described by other authors [11,31,32,33]. Details of the forward and reverse primers used in the RT-PCR are listed in Table 1. Gene-predicted products ranged from 75 to 156 bp.
Table 1. List of the primers used for quantitative real-time PCR.
Annotation | Code | Forward/reverse primer (5'-3') | Reference |
---|---|---|---|
NIP5 | JQ277272 1 | AGCTTCCCGGATATTCCAGT | [31] |
ACTATGGGTCCTGCTGTTGC | |||
CmBOR1 | EF581174 1 | GGGCATATAGTCCCCGTGTT | [11] |
CCGGGACTGGGAACTTTC | |||
PIP1 | Ciclev10012384 2 | AGGATTACACGGAGCCACCT | [33] |
TGCTTTTGGATTTGGACACG | |||
PIP2 | Ciclev10029003 2 | TGTGTTCATGGTTCACTTGG | [33] |
TGAATGGTCCAACCCAGAAG | |||
BOR4 | Ciclev10019073 2 | CTGAAAAGCCGAAAAGCAAG | |
CACGCCGTAGTCTGCTATGA | |||
TIP5 | Ciclev10006865 2 | CCGGAAGTTTCAAAAACCAG | |
ACCGCAGTTCCATCAGAAAC | |||
V-PPiase | JN580556 1 | GCATACAGCCCTGTGCAAGATA | [32] |
CCTCCAGCATTGTCACTGATG | |||
V-ATPase A | JN580555 1 | TCCTGTAACATCTGCCACCCTCA | [32] |
TTATCTCCTTCAGCCAAAGCATC |
1Accession number in NCBI reference sequence database (http://www.ncbi.nlm.nih.gov).
2Code refers to the transcript name in the database available in the International Citrus Genome Consortium (http://www.phytozome.net/search.php).
Statistical analyses
For statistical analyses, the values of growth parameters, chlorophyll concentration, proline and MDA concentrations are the mean of six independent plants per treatment. Values from other analyses are the mean and the standard deviation of at least three replicates from three independent groups of ten plants per treatment. Data were submitted to an analysis of variance (ANOVA) with Statgraphics Plus, version 5.1 (Statistical Graphics, Englewood Cliffs, NJ), prior to testing for normality and homogeneity. When the ANOVA showed a statistical effect, means were separated by least significant differences (LSD) at P < 0.05.
Results and Discussion
Symptoms, plant growth parameters, total B and chlorophyll concentrations
Twenty-five days after plants were grown in the presence of 400 μM H3BO3, +B plants showed incipient symptoms of B toxicity on a few leaves (Fig 1), consisting in small yellowish zones near their apical end and borders resembling those previously reported for other citrus species [3,21].
Fig 1. Visual symptoms in leaves of Citrus macrophylla seedlings grown for 25 days in B-normal (50 μM, Ct) and B-toxic (400 μM, +B) nutrient solutions.
Regarding plant growth, +B plants showed significant reductions in root dry weight and root length of 27.3% and 14.0%, respectively, related to Ct ones (Table 2), while no significant differences in growth parameters were observed in the shoots. Stunted root growth is a typical symptom in plants grown under B-excess conditions [21,34]. However, this effect was not evidenced in the shoot, which seems capable of maintaining a relatively high growth index despite accumulating large B concentrations in leaves, as occurs in some Solanum and Puccinellia plants considered to be B toxicity tolerants [35,36].
Table 2. Growth parameters [dry weight (DW, mg) and length (cm)], total boron concentration ([Bt], μg g-1 DW) and total B content (Bt, μg) measured in roots, stems and leaves of Citrus macrophylla seedlings grown for 25 days in B-normal (50 μM, Ct) and B-toxic (400 μM, +B) nutrient solutions.
Root | Stem | Leaf | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Ct | +B | Ct | +B | Ct | +B | |||||||
DW (mg) 1 | 12.8±1.1 | a | 9.3±0.2 | b | 2.9±0.1 | 2.7±0.2 | 13.3±0.9 | 12.8±0.5 | ||||
Length (cm) 1 | 15.7±1.6 | a | 13.5±0.7 | b | 4.0±0.3 | 3.5±0.3 | ||||||
[Bt] concentration(μg g-1 DW) 2 | 39.4±3.1 | b | 55.6±5.4 | a | 34.5±2.8 | b | 57.9±5.7 | a | 92.2±7.4 | b | 345.8±22.4 | a |
Bt content (μg) 2 | 504±70 | 517±45 | 98.±9 | b | 153±13 | a | 1226±101 | b | 4426±326 | a |
1Values of DW and length are the means ± SE of six independent plants per treatment (n = 6).
2Values of [Bt] and Bt are the means ± SE of three independent experiments (n = 3).
For a comparison of means, an ANOVA followed by the LSD test, calculated at the 95% confidence level, was performed. Different letters indicate significant differences for each parameter and within each plant organ (P <0.05).
Moreover, +B plants registered a substantial rise in B concentration in the leaves (3.8-fold) when compared with Ct ones (Table 2) and reached a level close to 350 μg g-1 DW, which is considered to fall within the excess range (> 250 μg g-1 DW; [37]). Roots from +B seedlings also showed higher B concentration (1.4-fold increase) than Ct ones, being much lower than that observed in leaves (Table 2).
Finally, we also determined chlorophylls concentration (a, b and total) in leaves as stress indicator to check the degree of tolerance of Cm seedlings to B toxicity in citrus [3,38]. The results indicated that B excess only led to a significant 26.3% reduction of Chl b values in +B seedlings when compared to Ct ones (Fig 2).
Fig 2. Chlorophyll (Ch) a, b and total content (µg g FW−1) measured in fully developed leaves of Citrus macrophylla seedlings grown for 25 days in B-normal (50 μM, Ct) and B-toxic (400 μM, +B) nutrient solutions.
Values are the means ± SE of six independent plants per treatment (n = 6). For a comparison of means, an ANOVA followed by the LSD test, calculated at 95% confidence level, was performed. Different letters in the same row indicate significant differences between treatments (P <0.05).
The data of shoot growth and chlorophyll concentration in leaves, together with the incipient B toxicity symptoms shown by the seedlings cultured at a high external B level, suggest that, despite the elevated B concentration reached by leaves, Cm behaves as a B-excess-tolerant plant. Therefore, the present work studied some of the mechanisms that likely enable Cm seedlings to tolerate B excess in accordance with previous proposals [11,21].
Transcription analysis of candidate genes related with B homeostasis in the plant
Expression of putative NIP5, PIP1 and PIP2 genes and its relation with B transport in the plant
Acquisition of boron by cells is associated with the activity of some members of the aquaporin family codified by the genes NIP5, PIP1 and PIP2 (Fig 3). The expression level of putative NIP5 gene lowered in roots as a result of high B levels. Thus, +B seedlings contained 52% fewer NIP5 transcripts in roots than Ct ones. It is noteworthy that no effect on the NIP5 transcript level was recorded when analysed in +B leaves. In A. thaliana, this gene codified a boric acid channel for efficient B acquisition under limited B supply [12]. This result was also found in Carrizo citrange roots, where CiNIP5 expression increased under B-deficiency conditions [31]. In contrast, its down-expression under B-excess conditions in the roots of Citrus plants has revealed a point of regulation of B uptake efficiency of different citrus rootstocks. Similar behaviour had been previously described by Schnurbusch et al. [39], which showed a relation between HvNIP2:1 gene expression and B toxicity tolerance in barley. Moreover, Tanaka et al. [40] suggested the importance of AtNIP5:1 degradation for plant acclimation to high B conditions.
Fig 3. Relative expression of NIP5, PIP1 and PIP2 genes measured by real-time RT-PCR analysis, in roots and leaves of Citrus macrophylla seedlings grown for 25 days in B-normal (50 μM, Ct) and B-toxic (400 μM, +B) nutrient solutions.
Values are the means ± SE of three independent experiments (n = 3). For a comparison of means, an ANOVA followed by the LSD test, calculated at 95% confidence level, was performed. Different letters in the same organ indicate significant differences between treatments (P <0.05).
PIP1 expression level was also reduced when analyzed in +B seedlings related to Ct ones (Fig 3). In particular, +B plants registered a 50% and 40% reduction in PIP1 transcript levels, in leaves and roots respectively, when compared with Ct ones. This indicates the possibility of reduced cell permeability to B under excess conditions. In this way, the expression of ZmPIP1 in Xenopus laevis oocytes indicates that this aquaporin is involved in B transport within cells [41]. In contrast, no differences in the PIP2 expression level were found between Ct and +B treated seedlings (Fig 3).
Expression of CmBOR1 gene under B toxicity conditions and its relation with B transport in the plant
We also monitored the expression level of CmBOR1 gene (Fig 4), which has been reported to modulate B transport in plants due to its role in loading B into the xylem, and therefore to translocate B from roots to shoots [7,12]. However, no differences in the CmBOR1 expression level in the leaves and roots of Ct and +B seedlings were found. This is in accordance with the high capacity of Citrus to accumulate B in their leaves at high external B levels, which suggests that citrus plants have an effective system for B transport from roots to leaves, even under B-excess conditions. Therefore, the presented data indicate that B toxicity tolerance is not linked to a repressible B transport mechanism. To support this, it has been reported that the CmBOR1 transcript level is not affected by high B supply and the activity of this gene does not prevent high B accumulation in citrus leaves [11]. In Oryza sativa, OsBOR1 loads B into the xylem and also participates in the absorption of this element in roots [42]. In Brassica napus, BnBOR1;1c and BnBOR1;2a are up-regulated in roots under low B stress, but no differences in their expression have been found between B-efficient and B-inefficient cultivars in low or normal B environments [13]. However, some evidence has indicated that the removal of the BOR1 protein from membranes and its rapid degradation through the endocytic pathway may occur in response to high B levels in A. thaliana [43]. This suggests that this mechanism in other species could be involved in the regulation of B transport from roots to shoots at high B levels.
Fig 4. Relative expression of CmBOR1 and BOR4 genes measured by real-time RT-PCR analysis, in roots and leaves of Citrus macrophylla seedlings grown for 25 days in B-normal (50 μM, Ct) and B-toxic (400 μM, +B) nutrient solutions.
Values are the means ± SE of three independent experiments (n = 3). For a comparison of means, an ANOVA followed by the LSD test, calculated at 95% confidence level, was performed. Different letters in the same organ indicate significant differences between treatments (P <0.05).
Accumulation of putative BOR4 transcripts under B toxicity conditions
The transcript level of the putative BOR4 gene was considerably enhanced in the roots and leaves of +B seedlings (2.1- and 2.7-fold increase, respectively) when compared with Ct ones (Fig 4). BOR4 gene has been reported to codify for a transporter to allow an active efflux of B across the plasma membrane [44]. BOR4 gene overexpression might lead to B excess to be pumped out of the cell and mitigate B toxicity stress in the cytoplasm. It is likely that a large amount of B exported from cells remains linked to the cell wall. In Arabidopsis, GFP fluorescence derived from BOR4-GFP strongly localised BOR4 to the plasma membranes of the distal sides of epidermal cells in the elongation zone. This is of strategic importance for directional export of B to avoid high concentrations in the xylem and growing cells [9] and likely to limit B accumulation in the symplasm. BOR4 is likely to operate at high B concentrations (low-affinity transporter), but not to mediate B efflux under low B conditions. To support this notion, it has been reported that high B-tolerant barley and wheat cultivars are able to maintain low B concentrations in shoots and roots by active B efflux mediated by the overexpressions of Hv-BOR2 and Ta-BOR2 [45], which suggests a positive correlation between these genes and the degree of tolerance among different cultivars in these species.
Accumulation of putative TIP5 transcripts under B toxicity conditions and its relation with B compartmentation in the vacuole
The expression of the TIP5 gene coding for a B transporter related with B sequestration across the tonoplast, and V-ATPase A and V-PPiase genes coding for two H+-ATPases pumps in the vacuole membrane, were checked to know if increased B accumulation in the vacuole could constitute a mechanism of B toxicity tolerance.
In this study, boron excess promoted the expression level of putative gene TIP5, and the number of transcripts increased in the leaves and roots of +B seedlings by 3.3- and 2.4-fold, respectively, in comparison with Ct ones (Fig 5). Aquaporin TIP5 has been related to a decreasing B concentration in the cytoplasm through its transport across the tonoplast membrane and to compartmenting it into the vacuole complexed with B-polyols [6]. Thus at high B levels in culture media, the up-regulation of putative gene TIP5 might be responsible for the intracellular B allocation, which could contribute to B tolerance in Citrus. Pang et al. [16] pointed out this capacity in A. thaliana, and provided evidence to support that this gene may be involved in B transport to vacuoles. Vacuolar sequestration has also been widely assumed to play a fundamental role in plant tolerance to excess micronutrients and heavy metals [46].
Fig 5. Relative expression of TIP5, V-PPiase and V-ATPase A genes measured by real-time RT-PCR analysis, in roots and leaves of Citrus macrophylla seedlings grown for 25 days in B-normal (50 μM, Ct) and B-toxic (400 μM, +B) nutrient solutions.
Values are the means ± SE of three independent experiments (n = 3). For a comparison of means, an ANOVA followed by the LSD test, calculated at 95% confidence level, was performed. Different letters in the same organ indicate significant differences between treatments (P <0.05).
A raised expression level of V-PPiase in +B organs, in comparison to those of Ct plants, suggests that V-PPiase is likely involved in the acidification of the vacuole while no effect was recorded on V-ATPase A. The protonmotive force generated by this vacuolar H+-translocating enzyme, enhances antiporters involved in B transport to increase their activity and, consequently, B sequestration into this organelle is more efficient, similarly to what is described for sodium tonoplast antiporters during salt stress conditions [47,48]. Maybe even the action of putative tonoplast antiporters of polyols (due to their ability to complex with B) might play here as secondary transporters energized by the tonoplast H+ gradient and its role should not be discarded.
The synergism of both responses in the vacuole will probably help to the active B influx in this organelle through the tonoplast, alleviating from B toxic concentrations in the cytoplasm.
Cellular B allocation under B toxicity conditions: partitioning in soluble and insoluble B fractions in roots and leaves
Plants contain boron in both soluble and insoluble forms [4]. According to Liu et al. [4], B extracted in water is likely to be localized in the plant free space, or apoplast, while the remaining soluble B, extracted using organic solvents, belongs to B located inside cells or the protoplast and linked to sugars, alcohols and polyhydroxycarbolates [49]. Both fractions represent not only mobile B, but also the only form in plant tissues that can be re-translocated in the phloem [5]. Finally, the B-insoluble fraction represents the B bound to cell walls linked to peptic polysaccharides [25]. Fig 6 shows the partitioning of B in soluble (water and organic solvents) and insoluble forms in roots and leaves. Insoluble B (Fig 6C) was mostly the main fraction of B in both Ct and +B seedlings (more than 65.8% of total B), followed by the water-soluble fraction (ranging from 31.8% to 9% of total B; Fig 6A), and lastly by soluble B in the organic solvents fraction (below 7.6%; Fig 6B). However, the seedlings grown under B-excess conditions increased the concentration and total amount of B located in cell walls and in the soluble fraction from the apoplast when compared with Ct plants, which is likely in equilibrium with the external medium. Nevertheless, the concentration and the amount of B extracted with organic solvents, which is attributed to cytoplasmic B, was similar in the organs from both +B and Ct seedlings. As boron exerts its toxicity inside rather than outside cells, the capability to retain increased B amounts linked to cell walls under B-excess conditions enables this genotype to block excess B in an insoluble form, thus preventing its entry to the cytoplasm to protect cells from B toxicity. Accordingly, Nozawa et al. [50] found a negative correlation between the B concentration inside yeast cells and the degree of tolerance to a high external B level, and concluded that cells with lower protoplasmic B were more tolerant to high B levels. Other authors have also observed a lower B concentration in leaf protoplasts of B-toxicity-tolerant cultivars of barley and wheat, which suggests different B partitioning within the shoot as a tolerance mechanism [42]. Hence it is likely that insolubilisation of B outside the cytoplasm might constitute another mechanism of B toxicity tolerance.
Fig 6. Boron concentration ([Bf], μg g-1 DW) and boron content (Bf, μg) in (A) soluble in water, (B) soluble in organic solvents and (C) insoluble fractions measured in roots and leaves of Citrus macrophylla seedlings grown for 25 days in B-normal (50 μM, Ct) and B-toxic (400 μM, +B) nutrient solutions.
Values are the means ± SE of three independent experiments (n = 3). For a comparison of means, an ANOVA followed by the LSD test, calculated at the 95% confidence level, was performed. Different letters indicate significant differences for each parameter and within each plant organ (P <0.05).
Accumulation of proline in roots and leaves: possible role in antioxidant response to MDA concentration
Boron effects on proline concentration have been studied in organs since this amino acid usually accumulates in response to several abiotic stresses [19,20]. Boron excess caused a significant rise in the proline concentration recorded in the roots and leaves of +B seedlings (50.7% and 33.6%, respectively) when compared to Ct ones (Table 3). Among other functions, proline acts as a detoxifier of hydroxyl radicals in plants [19,51]. Accordingly, proline levels enhanced by high B concentrations have been recorded in tomato and pepper [35,52]. MDA concentration increased by approximately 18.3% and 20.2% in the roots and leaves, respectively, of +B seedlings when compared with Ct ones (Table 3). The reduced effect of excess B on MDA concentration detected in both organs of +B seedlings indicates a low response to oxidative stress under B toxicity. Likewise, Gimeno et al. [21] did not find any effect on MDA concentration measured in the roots and leaves of Verna lemon trees when grown at high B levels.
Table 3. Proline (µmol g FW−1) and malonaldehyde (MDA, nmol g FW−1) concentrations measured in roots and leaves of Citrus macrophylla seedlings grown for 25 days in B-normal (50 μM, Ct) and B-toxic (400 μM, +B) nutrient solutions.
Ct | +B | |||
---|---|---|---|---|
Proline (µmol g FW−1) 1 | ||||
Root | 487±28 | b | 734±44 | a |
Leaf | 660±56 | b | 882±45 | a |
MDA (nmol g FW−1) 1 | ||||
Root | 251±24 | b | 297±12 | a |
Leaf | 426±36 | b | 512±36 | a |
1Values are the means ± SE of six independent plants per treatment (n = 6).
For a comparison of means, an ANOVA followed by the LSD test, calculated at 95% confidence level, was performed. Different letters in the same row indicate significant differences between treatments (P <0.05).
It has been reported that proline levels are inversely related with MDA concentration in the leaves of several woody species grown under B-excess conditions [38,53,54]. Accordingly, it was described that elevated proline avoids the generation of free radical levels as measured by MDA [55,56]. This coincides with the data presented herein and suggests that, at high external B concentration, Cm seedlings display a sharp rise in proline levels in both leaves and roots, whereas the increased MDA concentration was much lower. This suggests the existence of an efficient antioxidant system in Cm that is able to cope with ROS species generated as a result of B toxicity. As reported by Xiong and Zhu [56], proline is capable of detoxifying ROS by forming a stable complex with them to, thus, inhibit the lipid peroxidation process. This points at the role of this amino acid as part of a likely efficient antioxidant system able to cope with ROS species generated as a result of B toxicity in Cm plants. However, the function of other key antioxidant enzymes as catalase, superoxide dismutase and glutathione reductase should not be discarded [34,57], as they might also play an important role in the efficiency of the whole antioxidant system of the plant.
Conclusion
In Citrus, boron exerts its toxicity more markedly in leaves than in root system. However, the low degree of B toxicity symptoms in Cm leaves indicates that this species substantially behaves as a tolerant plant to high B levels. This aptitude is likely based on: A) the down-regulation of the main B transport channels in the root, NIP5 and PIP1 genes, which blocks the plant’s B uptake capacity; B) although B transport faculty is not repressed, the overexpression of putative gene BOR4, facilitates the export of B excess from cells and avoids cytoplasm damage; C) the capacity to hold B in an insoluble form in the leaves mainly allocated in cell walls; D) the compartmentalization of toxic B from the cytoplasm inside the vacuole due to the up-regulation of aquaporin TIP5 and the induction of the protonmotive gradient in the tonoplast; and, E) the activation of an antioxidant system against oxidative stress through proline accumulation.
Acknowledgments
We thank Isabel Herrero, Carmen Casamayor, Ramón Pardo and Jesús Asensi for help with the laboratory and field works.
Data Availability
All relevant data are within the paper.
Funding Statement
This work was funded by the National Institute of Research and Agrarian and Food Technology (RTA2011-00127), Valencian Generalitat and FEDER funds. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1. Frommer WB, von Wiren N (2002) Plant biology: ping-pong with boron. Nature 420: 282–283. [DOI] [PubMed] [Google Scholar]
- 2. O´Neill MA, Ishii T, Albersheim P, Darvill AG (2004) Rhamnogalacturonan II structure and function of a borate cross-linked cell wall peptic polysaccharide. Ann Rev Plant Biol 55: 109–139. [DOI] [PubMed] [Google Scholar]
- 3. Papadakis IE, Dimassi KN, Bosabalidis AM, Therios IN, Patakas A, Giannakoula A (2004) Boron toxicity in `Clementine´ mandarin plants grafted on two rootstocks. Plant Sci 166: 539–547. [Google Scholar]
- 4. Liu GD, Wang RD, Liu LC, Wu LS, Jiang CC (2013) Cellular boron allocation and pectin composition in two citrus rootstock seedlings differing in boron–deficiency response. Plant Soil 370: 555–565. [Google Scholar]
- 5. Hajiboland R, Bahrami-Rad S, Bastani S, Tolrà R, Poschenrieder C (2013) Boron re-translocation in tea (Camellia sinensis (L.) O. Kuntze) plants. Acta Physiol Plant 35: 2373–2381. [Google Scholar]
- 6. Kaur S, Nicolas ME, Ford R, Norton R, Taylor PWJ (2006) Physiological mechanisms of tolerance to high boron concentration in Brassica rapa . Funct Plant Biol 33: 973–980. [DOI] [PubMed] [Google Scholar]
- 7. Takano J, Noguchi K, Yasumori M, Kobayashi M, Gajdos Z, Miwa K, et al. (2002) Arabidopsis boron transporter for xylem loading. Nature 420: 337–340. [DOI] [PubMed] [Google Scholar]
- 8. Miwa K, Takano J, Fujiwara T (2006) Improvement of seed yields under boron-limiting conditions through overexpression of BOR1, a boron transporter for xylem loading in Arabidopsis thaliana . Plant J 46: 1084–1091. [DOI] [PubMed] [Google Scholar]
- 9. Miwa K, Takano J, Omori H, Seki M, Shinozaki K, Fujiwara T (2007) Plants tolerant to high boron levels. Science 318: 1417 [DOI] [PubMed] [Google Scholar]
- 10. Pérez-Castro R, Kasai K, Gainza-Cortes F, Ruiz-Lara S, Casaretto JA, Pena-Cortes H, et al. (2012) VvBOR1, the grapevine orthologue of AtBOR1, encodes an efflux boron transporter that is differentially expressed throughout reproductive development of Vitis vinifera L. Plant Cell Physiol 53: 485–494. 10.1093/pcp/pcs001 [DOI] [PubMed] [Google Scholar]
- 11. Cañón P, Aquea F, Rodríguez-Hoces de la Guardia A, Arce-Johnson P (2013) Functional characterization of Citrus macrophylla BOR1 as a boron transporter. Physiol Plantarum 10.1111/ppl.12037 [DOI] [PubMed] [Google Scholar]
- 12. Takano J, Wada M, Ludewig U, Schaaf G, von Wiren N, Fujiwara T (2006) The Arabidopsis major intrinsic protein NIP5;1 is essential for efficient boron uptake and plant development under boron limitation. Plant Cell 18: 1498–1509. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Sun JH, Shi L, Zhang CY, Xu FS (2012) Cloning and characterization of boron transporters in Brassica napus . Mol Biol Rep 39: 1963–1973. 10.1007/s11033-011-0930-z [DOI] [PubMed] [Google Scholar]
- 14. Kato Y, Miwa K, Takano J, Wada M, Fujiwata T (2009) Highly boron deficiency-tolerant plants generated by enhanced expression of NIP5;1, a boric acid channel. Plant Cell Physiol 50: 58–66. 10.1093/pcp/pcn168 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Martínez-Ballesta MC, Bastías E, Zhu C, Schäffner AR, González-Moro B, González-Murua C, et al. (2008) boric acid and salinity effects on Maize roots. Response of aquaporins ZmPIP1 and ZmPIP2, a plasma membrane H+-ATPase, in relation to water and nutrient uptake. Physiol Plantarum 132: 479–490. [DOI] [PubMed] [Google Scholar]
- 16. Pang Y, Li L, Ren F, Lu P, Wei P, Cai J, et al. (2010) Overexpression of the tonoplast aquaporin AtTIP5;1 conferred tolerance to boron toxicity in Arabidopsis . J Genet Genomics 37: 389–397. 10.1016/S1673-8527(09)60057-6 [DOI] [PubMed] [Google Scholar]
- 17. Atik AE, Bozdag GO, Akinci E, Kaya A, Koc A, Yalcin T, et al. (2011) Proteomic changes during boron tolerance in barley (Hordeum vulgare) and the role of vacuolar proton-translocating ATPase subunit E. Turk J Bot 35: 379–388. [Google Scholar]
- 18. Hanitzsch M, Schnitzer D, Seidel T, Golldack D, Dietz KJ (2007) Transcript level regulation of the vacuolar H(+)-ATPase subunit isoforms VHA-a, VHA-E and VHA-G in Arabidopsis thaliana . Mol Membr Biol 24: 507–18. [DOI] [PubMed] [Google Scholar]
- 19. Delauney AJ, Verma DPS (1993) Proline biosynthesis and osmoregulation in plants. Plant J 4: 215–223. [Google Scholar]
- 20. Mittler R (2002) Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci 7: 405–410. [DOI] [PubMed] [Google Scholar]
- 21. Gimeno V, Simon I, Nieves M Martinez V, Camara-Zapata JM, Garcia AL, et al. (2012) The physiological and nutritional responses to an excess of boron by Verna lemon trees that were grafted on four contrasting rootstocks. Tress 26: 1513–1526. [Google Scholar]
- 22. Legua P, Forner JB, Hernández F, Forner-Giner MA (2014) Total phenolics, organic acids, sugars and antioxidant activity of mandarin (Citrus clementina Hort. Ex Tan.): Variation from rootstock. Sci Hortic 174: 60–64. [Google Scholar]
- 23. Zekri M (2002) Salinity and citrus. Citrus industry 83: 17–19. [Google Scholar]
- 24. Mei L, Sheng O, Peng S, Zhou G, Wei Q, Li Q (2011) Growth, root morphology and boron uptake by citrus rootstocks seedlings differing in boron-deficiency responses. Sci Hortic 129: 426–432. [Google Scholar]
- 25. Hu H, Brown PH, Labavitch JM (1996) Species variability in boron requirement is correlated with cell wall pectin. J Exp Bot 47: 227–232. [Google Scholar]
- 26. Moran R, Porath D (1980) Chlorophyll determination in intact tissues using N,N-dimethylformamide. Plant Physiol 65: 478–479. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Hodges DM, DeLong JM, Forney CF, Prange RK (1999) Improving the thiobarbituric acid-reactive-substances assay for estimating lipid peroxidation in plant tissues containing anthocyanin and other interfering compounds. Planta 207: 180–198. [DOI] [PubMed] [Google Scholar]
- 28. Bustin SA (2002) Quantification of mRNA using real-time reverse transcription PCR (RT-PCR): trends and problems. J Mol Endocrinol 29: 23–39. [DOI] [PubMed] [Google Scholar]
- 29. Yan J, Yuan F, Long G, Qin L, Deng Z (2012) Selection of reference genes for quantitative real-time RT-PCR analysis in citrus. Mol Biol Rep 39: 1831–1838. 10.1007/s11033-011-0925-9 [DOI] [PubMed] [Google Scholar]
- 30. Goodstein DM, Shu S, Howson R, Neupane R, Hayes RD, Fazo J, et al. (2012) Phytozome: a comparative platform for green plant genomics. Nucleic Acids Res 40: D1178–D1186. 10.1093/nar/gkr944 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. An J, Liu Y, Yang C, Zhou G, Wei Q, Peng S (2012) Isolation and expression analysis of CiNIP5, a citrus boron transport gene involved in tolerance to boron deficiency. Sci Hortic 142: 149–154. [Google Scholar]
- 32. Yang LT, Jiang HX, Qi YP, Chen LS (2012) Differential expression of genes involved in alternative glycolytic pathways, phosphorus scavenging and recycling in response to aluminum and phosphorus interactions in Citrus roots. Mol Biol Rep 39: 6353–6366. 10.1007/s11033-012-1457-7 [DOI] [PubMed] [Google Scholar]
- 33. Rodríguez-Gamir J, Ancillo G, González-Mas MC, Primo-Millo E, Iglesias DJ, Forner-Giner MA (2011) Root signalling and modulation of stomatal closure in flooded citrus seedlings. Plant Physiol Biochem 49: 636–645. 10.1016/j.plaphy.2011.03.003 [DOI] [PubMed] [Google Scholar]
- 34. Reid RJ, Hayes JE, Post A, Stangoulis JCR, Graham RD (2004) A critical analysis of the causes of boron toxicity in plants. Plant Cell Environ 25: 1405–1414. [Google Scholar]
- 35. Cervilla LM, Blasco B, Rios JJ, Romero L, Ruiz JM (2007) Oxidative stress and antioxidants in tomato (Solanum lycopersicum) plants subjected to boron toxicity. Ann Bot 100: 747–756. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Stiles AR, Bautista D, Atalay E, Babaoˇglu M, Terry N (2010) Mechanisms of boron tolerance and accumulation in plants: a physiological comparison of the extremely boron tolerant plant species, Puccinellia distans, with the moderately boron-tolerant Gypsophila arrostil . Environ Sci Technol 44: 7089–7095. 10.1021/es1016334 [DOI] [PubMed] [Google Scholar]
- 37. Embleton TW, Reitz NJ, Jones WW (1973) Citrus fertilization In: The citrus industry, vol 3. University of California, Berkeley, p145. [Google Scholar]
- 38. Keles Y, Oncel I, Yenice N (2004) Relationship between boron content and antioxidant compounds in citrus leaves taken from fields with different water source. Plant Soil 265: 345–353. [Google Scholar]
- 39. Schnurbusch T, Hayes J, Hrmova M, Baumann U, Ramseh SA, Tyerman SD, et al. (2010) Boron toxicity tolerance in barley through reduced expression of the multifunctional aquaporins HvNIP2;1 . Plant Physiol 153: 1706–1715. 10.1104/pp.110.158832 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40. Tanaka M, Takano J, Chiba Y, Lombardo F, Ogasawara Y, Onouchi H, et al. (2011) Boron-dependent degradation of NIP5;1 mRNA for acclimation to excess boron conditions in Arabidopsis . Plant Cell 23: 3547–3559. 10.1105/tpc.111.088351 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41. Chaumont F, Barrieu F, Jung R, Chrispeels MJ (2000) Plasma membrane intrinsic proteins from maize cluster in two sequence subgroups with differential aquaporin activity. Plant Physiol 122: 1025–1034. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42. Nakagawa Y, Hanaoka J, Kobayashi M, Miyoshi K, Miwa K, Fujiwara T (2007) Cell-type specificity of the expression of OsBOR1, a rice efflux boron transporter gene, is regulated in response to boron availability for efficient boron uptake and xylem loading. Plant Cell 19: 2624–2635. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43. Takano J, Miwa K, Yuan L, von Wiren N, Fujiwara T (2005) Endocytosis and degradation of BOR1, a boron transporter of Arabidopsis thaliana, regulated by boron availability. Proc Natl Acad Sci USA 102: 12276–12281. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44. Miwa K, Fujiwara T (2010) Boron transport in plants: co-ordinated regulation of transporters. Ann Bot 105: 1103–1108. 10.1093/aob/mcq044 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45. Reid R (2007) Identification of boron transporter genes likely to be responsible for tolerance to boron toxicity in wheat and barley. Plant Cell Physiol. 48: 1673–1678. [DOI] [PubMed] [Google Scholar]
- 46. Hall JL (2002) Cellular mechanisms for heavy metal detoxification and tolerance. J Exp Bot 53: 1–11. [PubMed] [Google Scholar]
- 47. Silva P, Gerós H (2009) Regulation by salt of vacuolar H+-ATPase and H pyrophosphatase activities and Na+/H+ exchange. Plant Signal Behav 8: 718–726. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48. Martínez-Alcántara B, Martínez-Cuenca MR, Quiñones A, Iglesias DJ, Primo-Millo E, Forner-Giner MA (2015) Comparative expression of candidate genes involved in sodium transport and compartmentation in citrus. Environ Exp Bot 111: 52–62. [Google Scholar]
- 49. Makkee M, Kreboom APG, Van Bekkum H (1985) Studies on borate esters III. Borate esters of D-mannitol, D-glucitol, D-fructose and D-glucose in water. Reel Trav Chim Pays-Bas 104: 230–235. [Google Scholar]
- 50. Nozawa A, Takano J, Kobayashi M, Von Wiren N, Fujiwara T (2006) Roles of BOR1, DUR3 and FPS1 in boron transport and tolerance in Saccharomyces cerevisiae . FEMS Microbiol Lett 262: 216–222. [DOI] [PubMed] [Google Scholar]
- 51. Claussen W (2005) Proline as a measure of stress in tomato plants. Plant Sci 168: 241–248. [Google Scholar]
- 52. Eraslan F, Inal A, Gunes A, Alpaslan M (2007) Boron toxicity alters nitrate reductase activity, proline accumulation, membrane permeability and mineral constituents of tomato and pepper plants. J Plant Nutr 30: 981–994. [Google Scholar]
- 53. Gunes A, Soylemezoglu G, Inal A, Bagci EG, Coban S, Sahin O (2006) Antioxidant and stomatal responses of grapevine (Vitis vinifera L.) to boron toxicity. Sci Hortic 110: 279–284. [Google Scholar]
- 54. Molassiotis A, Sotiropoulos T, Tanou G, Diamantidis G, Therios I (2006) Boron-induced oxidative damage and antioxidant and nucleolytic responses in shoot tips culture of the apple rootstock EM 9 (Malus domestica Borkh). Environ Exp Bot 56: 54–62. [Google Scholar]
- 55. Hong Z, Lakkineni K, Zhang Z, Verma DPS (2000) Removal of feedback inhibition of Δ1-pyrroline-5-carboxylate synthetase results in increased proline accumulation and protection of plants from osmotic stress. Plant Physiol 122: 1129–1136. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56. Xiong L, Zhu JK (2002) Molecular and genetic aspects of plant responses to osmotic stress. Plant Cell Environ 25: 131–139. [DOI] [PubMed] [Google Scholar]
- 57. Pandey N, Archana (2013) Antioxidant responses and water status in Brassica seedlings subjected to boron stress. Acta Physiol Plant 35: 697–706. [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
All relevant data are within the paper.