Functional and Structural Characterization of the Antiphagocytic Properties of a Novel Transglutaminase from Streptococcus suis

Background: SsTGase was a newly identified secreted immunogenic protein of S. suis 2.

Results: Anti-phagocytic ability of SsTGase-N was dependent on its TGase activity, and its crystal structure revealed that dimerization was crucial for maintaining functional activities.

Conclusion: SsTGase was a novel virulence factor of Ss2 by acting as a TGase in dimer form.

Significance: The presented research suggested that SsTGase could serve as a new therapeutic target.

Abstract

Streptococcus suis serotype 2 (Ss2) is an important swine and human zoonotic pathogen. In the present study, we identified a novel secreted immunogenic protein, SsTGase, containing a highly conserved eukaryotic-like transglutaminase (TGase) domain at the N terminus. We found that inactivation of SsTGase significantly reduced the virulence of Ss2 in a pig infection model and impaired its antiphagocytosis in human blood. We further solved the crystal structure of the N-terminal portion of the protein in homodimer form at 2.1 Å. Structure-based mutagenesis and biochemical studies suggested that disruption of the homodimer directly resulted in the loss of its TGase activity and antiphagocytic ability. Characterization of SsTGase as a novel virulence factor of Ss2 by acting as a TGase would be beneficial for developing new therapeutic agents against Ss2 infections.

Introduction

Streptococcus suis serotype 2 is an important swine and human zoonotic pathogen, causing septicemia, arthritis, endocarditis, meningitis, and even acute death in pigs and humans (1, 2). Although several virulence factors have been identified, including capsule polysaccharide, extracellular protein factor, suilysin, factor H-binding surface protein, and adenosine synthase (3–9), the underlying mechanism of Ss2 pathogenesis remains unclear. In our previous study, we identified a new secreted protein from Ss2 culture supernatant encoded by SSU05_1815 locus with a high immunogenicity through an immunoproteomic approach (10). However, genetic studies and sequence analyses revealed that this protein was a transmembrane protein with a single transmembrane segment at the C terminus, suggesting that this protein was released into culture supernatant. Moreover, a highly conserved eukaryotic-like transglutaminase (TGase)⁵ domain (residues 247–348) was found at the N terminus. The TGase domain belongs to the TGase-like superfamily (PF01841 in the PFAM database) (11), which contains a highly conserved catalytic triad Cys³⁰²-His³³³-Asp³⁴⁸. Therefore, we named this protein as SsTGase in Ss2. TGases, also named protein-glutamine γ-glutamyltransferase, constitute a large superfamily of enzymes widely distributed in eukaryotes and prokaryotes and have been extensively studied because they were first extracted from animal liver (12–15). The enzyme catalyzes an acyl transfer reaction between glutamine residues and lysine or other primary amine, leading to inter- or intramolecular cross-linking and polymerization of the proteins (16–20). The catalytic reaction of TGases is based on a highly conserved catalytic center: a Cys-His-Asp triad or less frequently a Cys-His dyad. TGases are involved in regulation of a myriad of physiological processes by acting as biological glues, including blood clotting, wound healing, epidermal keratinization, neoplastic diseases, and membrane repair (13, 21, 22, 24). Furthermore, the enzyme has been applied in the food, cosmetic, and textile industries as a biocatalyst (25).

To date, several crystal structures of TGases have been resolved in mammals (26–31), including human factor XIII, fish-derived transglutaminase (FTGs), and human transglutaminase 2 (28, 31). Previous studies have mainly focused on the biochemical characteristics of TGases in mammals, but the roles of TGases played in microorganisms remain largely unknown. Among microorganisms, only TGases from Streptoverticillium mobaraense (microbial TGase) and Phytophthora have been studied, and they represent a completely different structure fold compared with those in mammals (27, 29). Therefore, bacterial TGases of the PF01841 superfamily are currently largely unknown for their structural features and specific activities.

In the present study, we showed that the SsTGase was secreted by Ss2 and developed strong antiphagocytic activity. Inactivation of SsTGase significantly reduced virulence in a pig infection model and impaired antiphagocytic resistance of Ss2 in human blood. To further investigate the molecular mechanism underlying the pathogenesis of SsTGase in Ss2, we determined the crystal structure of the N-terminal portion of SsTGase (residues 38–437; referred to as SsTGase-N hereafter) that also included the TGase domain at 2.1 Å. The structure reveals that although the C-terminal domain of SsTGase-N contains a catalytic core region similar to other TGases its N-terminal domain displays a new structural fold. The overall folding of the SsTGase-N homodimer was novel and different from other known structures of TGases. Inactivation of the protein directly resulted in the loss of its antiphagocytic ability, indicating that antiphagocytic ability of SsTGase-N was dependent on its TGase activity. Furthermore, structure-based mutagenesis and biochemical studies suggested that dimerization of the protein was critical for its activation and antiphagocytic ability. These observations provide a novel insight into the activation mechanism and functions of SsTGase that would be valuable for the development of novel antibiotic strategies targeting SsTGase.

Experimental Procedures

Generation of the Mutant Strain ΔSsTGase and the Complemented Strain CΔSsTGase

The ΔSsTGase mutant was obtained from the 05ZYH33 WT by in-frame deletion of the sstgase gene (SSU05_1815) as described previously (9). Briefly, DNA fragments corresponding to the upstream and downstream regions of the sstgase gene were amplified using primer pairs sstgase KOP1/sstgase KOP2 and sstgase KOP5/sstgase KOP6, respectively (Table 1). The chloramphenicol cassette was amplified from plasmid pSET1 with primers CM-F and CM-R (Table 1). The primer pairs sstgase KOP2/CM-F and CM-R/sstgase KOP5 were designed to be fused as an intact fragment by overlap extension PCR. PCR amplicons were cloned into the temperature-sensitive S. suis-Escherichia coli shuttle vector pSET4s, giving rise to the knock-out vector pSET4s::sstgase. The procedures for the selection of mutants by double crossover were described previously (32). The resulting mutant strain was verified by PCR using three pairs of primers, sstgase IN1/sstgase IN2, sstgase-F/sstgase-R, and sstgase KOP1/sstgase KOP6 (Table 1), and direct DNA sequencing analysis of the mutation sites using genomic DNA as the template. For complementation assays, a DNA fragment containing the entire sstgase gene and its upstream promoter was amplified using primers CΔsstgase-F and CΔsstgase-R. The amplicon was subsequently cloned into the E. coli-S. suis shuttle vector pAT18 (33), resulting in the recombinant plasmid pAT18::sstgase. This plasmid was transformed into the ΔSsTGase mutant, and the complemented ΔSsTGase strain was screened on Todd-Hewitt broth agar with selective pressure by erythromycin. Reverse transcription-PCR (RT-PCR) analyses of the CΔSsTGase, 05ZYH33, and ΔSsTGase strains were used to further identify transcription of the gene sstgase in CΔSsTGase.

TABLE 1.

Summary of cloning primers in generation of the mutant strain ΔSsTGase and the complemented strain CΔSsTGase

Primers	Sequencea (5′–3′)	PCR products
sstgase KOP1	GCAGGATCCTTAATCAAGGCAGTTTTGGG	The sstgase gene and its upstream flanking regions
sstgase KOP2	CCTCGGAACCCATCGAATTACAACCGGTTGTGATGTTCCG
CM-F	TAATTCGATGGGTTCCGAGG	Chloramphenicol resistance gene
CM-R	CACCGAACTAGAGCTTGATG
sstgase KOP5	CATCAAGCTCTAGTTCGGTGCAGCTTAGTAACAATTTGGG	The sstgase gene and its downstream flanking regions
sstgase KOP6	TGCG[b]GAATTCGTAGCGCTCCTTAAATTCTGCTG
sstgase IN1	GCTGCTCCTTCTCAACAAAC	Internal region of sstgase gene
sstgase IN2	TTAATTCCGGTGCTTCTGTT
SPC-F	GTGTTCGTGAATACATGTTATA	Spectinomycin resistance gene
SPC-R	GTTTTCTAAAATCTGATTACCA
CΔsstgase-F	CGGAATTCGATTAGAGTTTGCCATTGTTG	The open reading frame of sstgase gene and its upstream promoter
CΔsstgase-R	CGGGATCCCACCTCCTAGTCACAATAAC

^a The underlined bold sequences are the restriction sites.

Western Blotting

A rabbit SsTGase antibody was generated against recombinant SsTGase-N protein. 05ZYH33, ΔSsTGase, and CΔSsTGase samples were separated on a 12% (v/v) polyacrylamide vertical slab gel with a 5% (v/v) stacking gel. Then the proteins were electrotransferred to polyvinylidene fluoride (PVDF) membrane (GE Healthcare). The membrane was blocked with 5% skimmed milk followed by incubation with 1:200 diluted preimmune rabbit serum/rabbit anti-SsTGase-N serum at room temperature for 1 h. The membrane was then washed with TBST buffer (25 mm Tris-HCl, pH 7.5, 150 mm NaCl, 0.1% (v/v) Tween 20) and incubated with goat anti-rabbit IgG (heavy + light)-horseradish peroxidase (HRP) (1:8000) (Santa Cruz Biotechnology) at room temperature for 1 h. After washing, the membrane was developed in SuperSignal West Pico Chemiluminescent Substrate (Pierce).

Blood Survival Assay

Diluted strains of the wild type (05ZYH33), ΔSsTGase, and CΔSsTGase (50 μl; 2 × 10⁴ colony-forming units (cfu)/ml) were added to fresh human blood (450 μl), and the mixtures were rotated at 20 rpm at 37 °C under 5% CO₂ after which aliquots were incubated with a final concentration of 0.1% (w/v) saponin on ice for 15 min to lyse cells. Viable bacterial counts were determined by plating diluted samples onto Todd-Hewitt broth agar. The percentage of live bacteria was subsequently calculated as (cfu on plate/cfu in original inoculum) × 100%.

Polymorphonuclear Leukocyte (PMN) Killing Assay

After being isolated from heparinized venous blood, PMNs were infected with S. suis serotype 2 at a multiplicity of infection of 1:15 in 50% nonimmune human serum at 37 °C under 5% CO₂. Samples were taken at time points and analyzed immediately. Colonies were counted, and the percentage of surviving bacteria was calculated as follows: (cfu_PMN+/cfu_PMN−) × 100%. The data are presented as means ± S.D. from three or four separate experiments.

Experimental Infections of Piglets

To evaluate the effects of deletion of sstgase on the virulence of 05ZYH33, specific pathogen-free piglets (4 weeks old; six piglets/group) were challenged with 05ZYH33, ΔSsTGase, and CΔSsTGase strains and the avirulent strain 1330 (dose of 2 × 10⁸ cfu/piglet), respectively. Survival time, clinical signs, and bacterial loads in blood and tissue samples were recorded for 12 days postinoculation. To have a better understanding of the difference between 05ZYH33 and ΔSsTGase and to reduce the individual differences in infection, groups of four specific pathogen-free piglets were inoculated intravenously with a 1:1 mixture of 05ZYH33/ΔSsTGase (dose of 10⁸ cfu/piglet). When the infected piglets showed typical Ss2 infection symptoms, the capability of 05ZYH33/ΔSsTGase surviving in blood and colonizing the various tissues of piglets was analyzed by plating samples on plates without antibiotics or with chloramphenicol resistance selection. All animal experiments were performed in a biosafety level 3 facility and were approved by the local ethics committee.

Ethics Statement

The healthy donors who provided the blood in this study gave written informed consent in accordance with the Declaration of Helsinki. Approval was obtained from the medical ethics committee of the 307 hospital. This research was approved by the ethics committee on Animal Experimentation of the Chinese Association for the Accreditation of Laboratory Animals Care, including the relevant local animal welfare bodies in China. In addition, the permit number of all animal work was SCXK-(JUN) 2013-008, approved by the animal ethics committee of Beijing Institute of Microbiology and Epidemiology. All efforts were made to minimize suffering of animals used in this study.

Measurement of Transglutaminase Activity

TGase (EC 2.3.2.13) activity was assayed by a transglutaminase colorimetric microassay kit (TCM kit, Covalab), which uses immobilized N-carbobenzoxy-Gln-Gly as amine acceptor and biotin-conjugated cadaverine as amine donor. Protein samples were incubated in a 96-well microtiter plate coated with N-carbobenzoxy-Gln-Gly at 37 °C for 15 min with calcium, DTT, and biotinylated cadaverine both in the presence and the absence of EDTA supplied in the kit. The wells were washed three times with phosphate buffer containing 0.1% Tween 20. To assay the formation of cadaverine covalently linked to N-carbobenzoxy-Gln-Gly (γ-glutamyl-cadaverine-biotin) by TGase, the wells were filled with streptavidin-labeled HRP and incubated for 15 min at 37 °C. Following three washes with phosphate buffer containing 0.1% Tween 20, the wells were filled with HRP substrate/chromogen solution containing H₂O₂ as the substrate and tetramethylbenzidine as the electron acceptor (chromogen). After incubation for 10 min at room temperature, 50 μl of reaction blocking reagent was added, and the mixture was quantified by measuring A₄₅₀. As a reference for the TGase activity, the kit includes the purified guinea pig TGase with a specific activity of 0.1 unit/mg. By definition, 1 unit of TGase catalyzes the formation of 1 μmol of hydroxamate/min at pH 6.0 at 37 °C using l-glutamic acid γ-monohydroxamate as the standard.

Circular Dichroism (CD) Spectroscopic Analysis

For CD spectroscopic analysis, the purified proteins from peak 1 and peak 2 solubilized in buffer containing 20 mm Hepes, pH 7.5 and 200 mm NaCl were concentrated to 1 mg/ml. CD spectroscopy was carried out using an Applied Photophysics Chirascan Plus spectropolarimeter with a 10-mm-path length cell and a bandwidth of 1.0 nm. Spectra were recorded from 260 to 180 nm at an interval of 1 nm and were repeated three times. All resultant spectra were obtained by subtraction of the spectrum of the buffer.

Cloning, Expression, and Purification of SsTGase-N

The coding sequence of sstgase-N (residues 39–437) was cloned into the pGEX6p-1 vector (Novagen), generating an N-terminal PreScission protease cleavage site following the GST tag that was confirmed by DNA sequencing. Overexpression of SsTGase-N was induced in E. coli BL21(DE3) strain by 0.5 mm isopropyl β-d-thiogalactoside when the cell density reached an A_{600 nm} of 1.2. After growth for 6 h at 30 °C, the cells were collected, resuspended in buffer (25 mm Tris-HCl, pH 8.0, 200 mm NaCl), and lysed by sonication. Recombinant GST-tagged protein was purified by glutathione affinity chromatography and gel filtration chromatography with buffer containing 20 mm Hepes, pH 7.5, 200 mm NaCl, and 2 mm DTT. Notably, the GST tag of purified homodimer was cleaved off by PreScission protease (Amersham Biosciences) before gel filtration. The selenomethionine (Se-Met)-substituted SsTGase-N derivative was expressed in E. coli B834 strain, grown in selenomethionine medium (Molecular Dimensions Ltd.), and purified similarly (34).

According to procedures described previously (35), point mutations (C302S, H333S, D348S, T215A, and R311A) of SsTGase-N were generated by two-step PCR and confirmed by DNA sequencing. All the mutants were purified in the same way as wild-type protein.

Crystallization, Data Collection, and Structure Determination

Crystals of SsTGase-N were generated by mixing 1 μl of protein solution with 1 μl of well buffer using the hanging drop vapor diffusion method at 18 °C. Crystals appeared after 2 weeks in the reservoir solution (0.2 m sodium chloride, 0.1 m Hepes, pH 7.2, 20% (w/v) polyethylene glycol 4000). The crystals were cryoprotected in reservoir solution plus 15–20% (v/v) glycerol and flash frozen in liquid nitrogen prior to data collection.

All the data were collected at the Shanghai Synchrotron Radiation Facility BL17U beamline and integrated and scaled using the HKL2000 package (36). Further processing was carried out using programs from the CCP4 suite (37). Data collection statistics are summarized in Table 2. The selenium sites were located using SHELXD from Bijvoet differences in the selenium single wavelength anomalous diffraction data (38). Heavy atom positions were defined, and the phases were calculated with the single wavelength anomalous diffraction experimental phasing module of Phaser (39). The real space constraints were applied to the electron density map in density modification. The final model rebuilding was performed with Coot (40), and the protein structure was refined with PHENIX (41) using non-crystallographic symmetry and stereochemistry information as restraints. Structural figures were generated in PyMOL (42). The structure factors of SsTGase-N have been deposited in the Protein Data Bank (accession code 4XZ7).

TABLE 2.

Statistics of data collection and structure refinement

Values in parentheses are for the highest resolution shell. R_sym = Σ_hΣ_i|I_h,i − I_h|/Σ_hΣ_iI_h,i where I_h is the mean intensity of the i observations of symmetry-related reflections of h. r = Σ|F_obs − F_calc|/ΣF_obs where F_calc is the calculated protein structure factor from the atomic model (R_free was calculated with 5% of the reflections). r.m.s.d., root mean square deviation; Se-SAD, selenium single wavelength anomalous diffraction.

	Se-SAD	Native
Data collection
Space group	P212121	P212121
Unit cell (Å)	85.503, 95.047, 106.051	89.133, 91.935, 102.172
Wavelength (Å)	0.979	0.979
Resolution (Å)	2.75 (2.85–2.75)	2.10 (2.18–2.10)
Rsym (%)	11.7 (92.2)	8.7 (73.7)
I/σ	16.0 (2.5)	26.1 (3.25)
Completeness (%)	96.3 (77.7)	100 (100)
Redundancy	8.0 (8.2)	10.2 (10.3)
Wilson B factor (Å2)	44.91	24.2
Refinement
R factor		0.1934
Rfree		0.2384
No. atoms		6493 protein atoms + 447water atoms
B factors
Overall		38.1
Main chain		36.3
Side chain		39.9
r.m.s.d. bond lengths		0.008
r.m.s.d. bond angles		1.074
Ramachandran plot statistics (%)
In preferred regions		95.89
In allowed regions		3.85
Outliers		0.27

Results

SsTGase Was Secreted by Ss2 and Possessed Strong Antiphagocytic Ability

SsTGase is encoded by the SSU05_1815 locus of China pathogenic strain 05ZYH33 (NC_009442.1) isolated from a deceased streptococcal toxic shock syndrome patient. To investigate the specific roles of the protein, we constructed a mutant strain (ΔSsTGase) and a complemented strain (CΔSsTGase) derived from wild-type strain 05ZYH33 (WT). First, we identified that SsTGase was secreted by Ss2 through Western blotting despite the fact it contained a predicted transmembrane segment (Fig. 1, A and B). This secreted form was possibly produced through proteolysis of the full-length protein during biological processes. The results from the PMN killing assay suggested that the survival rates of the ΔSsTGase strain were much lower than those of the WT and CΔSsTGase strains by 1–3 h (Fig. 1C). Furthermore, to investigate the antiphagocytic activity of SsTGase, we carried out a blood survival assay with the culture supernatant of the WT, CΔSsTGase, and ΔSsTGase strains. The results showed that culture supernatant of WT and CΔSsTGase, but not that of ΔSsTGase, improved the survival rates of the three strains of Ss2 (WT, ΔSsTGase, and CΔSsTGase) in human blood (Fig. 2A). In addition, the survival rate of the ΔSsTGase strain was also improved significantly after incubating the strain with different amounts of SsTGase-N (residues 39–437) protein in human blood (Fig. 2B), which suggested that both SsTGase and SsTGase-N possessed significant antiphagocytic activity.

FIGURE 1.

SsTGase developed strong antiphagocytic ability in the supernatant of Ss2. A, domain organization of SsTGase-N. The numbers of the amino acid residues identifying the boundaries between adjacent domains are indicated below. S, signal sequence; TGase, transglutaminase-like domain; TM, transmembrane segment. The region spanning residues 38–437 was used in crystallization of SsTGase-N. B, SsTGase present in the supernatant was detected by Western blotting after incubation with preimmune rabbit serum (left) and anti-SsTGase-N serum (right). Each of the lanes is labeled at the top. Sup, supernatant. Lane M, molecular mass markers. C, decreased resistance of SsTGase to PMN-mediated killing. The wild-type strain 05ZYH33, the mutant strain ΔSsTGase (Δ 1815), the complemented strain CΔSsTGase (CΔ 1815), and 05ZYH33 plus monodansylcadaverine (MDC) were co-incubated with human PMNs at a multiplicity of infection of 1:15 in 50% non-immune human serum at 37 °C under 5% CO₂. Samples were taken at time points and analyzed immediately. Colonies were counted, and error bars represent S.D. of three independent measurements. **, p < 0.01.

FIGURE 2.

SsTGase was a new virulence factor of Ss2. A, SsTGase developed strong antiphagocytic ability. The culture supernatant (Sup) of the WT and CΔSsTGase strains markedly enhanced Ss2 survival in human blood. Samples of culture supernatant of WT, ΔSsTGase, and CΔSsTGase strains and PBS were incubated with the WT, ΔSsTGase, or CΔSsTGase bacteria, respectively, in fresh human blood for 1 h. The surviving bacteria were counted on Todd-Hewitt broth plates. Error bars represent S.D. of three to four independent measurements. ***, p < 0.001. B, SsTGase-N strongly improved ΔSsTGase strain survival in human blood. Different amounts of SsTGase-N (1, 5, 10, 20, and 50 μg) were incubated with culture supernatant of the ΔSsTGase strain for 30 min and then mixed with fresh human blood and the ΔSsTGase strain for 1 h. Error bars represent S.D. of three to four independent measurements. C, survival curves of piglets after challenge with Ss2. Piglets were inoculated with the 05ZYH33 (solid circles), ΔSsTGase (open circles), or CΔSsTGase strain (solid inverted triangles) or with avirulent strain 1330 (open triangles). Bacteria (2 × 10⁸ cfu) were administered to each animal (n = 6 piglets per group) by intravenous injections. D, bacterial growth in blood after intravenous challenge. Results from individual piglets are shown as log₁₀ of bacterial counts (cfu/ml). 05ZYH33, ΔSsTGase, and CΔSsTGase strains are represented as black solid circles, white open circles, and black solid squares, respectively. Horizontal lines indicate the mean for each group. E, bacterial growth in blood after intravenous challenge by competitive infection assay. Groups of four specific pathogen-free piglets were inoculated intravenously with a 1:1 mixture of 05ZYH33/ΔSsTGase strains (dose of 10⁸ cfu/piglet), respectively. Results from individual piglets are shown as log₁₀ of bacterial counts (cfu/ml). 05ZYH33 and ΔSsTGase strains are shown as solid circles and open squares, respectively. Horizontal lines indicate the mean for each group. F, bacterial counts in various organs by competitive infection assay. Groups of four specific pathogen-free piglets were inoculated intravenously with a 1:1 mixture of 05ZYH33/ΔSsTGase strains (dose of 10⁸ cfu/piglet). Results from individual piglets are shown as log₁₀ of bacterial counts (cfu/0.5g). 05ZYH33 and ΔSsTGase strains are shown as solid circles and open squares, respectively. Horizontal lines indicated the mean for each group.

SsTGase Was a New Virulence Factor of Ss2

To determine whether SsTGase is a potential virulence factor of Ss2, a piglet infection model was used to test the virulence of the WT, ΔSsTGase, and CΔSsTGase strains with the North American avirulent strain 1330 considered as a negative control. Each piglet was injected with 2 × 10⁸ cfu of bacteria, and the survival rates of infected piglets were measured over 12 days. All the piglets infected with the WT strain died within 6 days after infection in contrast to a survival rate of 83.33% in the group infected by the ΔSsTGase strain, 33.33% in the group infected by the CΔSsTGase strain, and 100% in the group infected by the 1330 strain (Fig. 2C). Severe symptoms such as high fever, limping, swollen joints, shivering, and central nervous system failure were observed among the groups infected by the WT and CΔSsTGase strains, whereas only mild symptoms were observed in the groups infected by the ΔSsTGase strain. Additionally, the efficiencies of colonization by the WT and CΔSsTGase strains in blood were much higher than that of the ΔSsTGase strain from 12 to 132 h (Fig. 2D).

To avoid the individual differences in piglets, the competitive infection assay was adopted to further compare the virulence of the WT and ΔSsTGase strains in which a group of four piglets was challenged with a 1:1 mixture of the WT and ΔSsTGase strains. Consequently, the cell numbers of the WT bacteria in blood and various tissue samples (heart, liver, kidney, spleen, lung, tonsil, and lymph) were much higher than those of the ΔSsTGase bacteria (Fig. 2, E and F). Taken together, these data indicated that SsTGase was a new virulence factor of Ss2 with antiphagocytic activity.

Antiphagocytic Ability of SsTGase-N Was Dependent on Its TGase Activity

SsTGase-N corresponds to an active form with a high TGase activity (0.72971 unit/mg) compared with TGase from guinea pig liver (0.10789 unit/mg), whereas no activity could be detected after mixing it with monodansylcadaverine, a potent inhibitor of TGases (Fig. 3A). Similar to other TGases from microorganisms, the SsTGase-N enzyme activity is Ca²⁺-independent (Fig. 3A). In addition, we generated three point mutations of the catalytic residues (C302A, H333A, and D348A) to study the effect of each single active residue. All three point mutations displayed dramatically decreasing TGases activity, suggesting that these three residues played an important role in catalyzing the TGase reaction (Fig. 3C).

FIGURE 3.

Antiphagocytic ability of SsTGase-N was dependent on its TGase activity. A, transglutaminase activity of SsTGase-N was Ca²⁺-independent. The assay of transglutaminase activity of purified SsTGase-N was performed using a transglutaminase colorimetric microassay kit (TCM kit). The TCM kit uses immobilized N-carbobenzoxy-Gln-Gly as the amine acceptor and biotin-conjugated cadaverine as the amine donor. As a reference for TGase activity, purified guinea pig TGase (gpTGase) with specific activity of 0.1 unit/mg was incubated under the same conditions. A representative result for each condition is shown. Error bars represent S.D. of three to four independent measurements. B, antiphagocytic abilities of SsTGase-N and mutants were demonstrated by blood survival assay. Error bars represent S.D. of three to four independent measurements. ***, p < 0.001. C, assay of transglutaminase activity of purified SsTGase-N and mutants using a transglutaminase colorimetric microassay kit (TCM kit). Error bars represent S.D. of three to four independent measurements. ***, p < 0.001.

Notably, antiphagocytic abilities of the three point mutations also decreased to an extremely low level (Fig. 3B). Moreover, the survival rate of WT strain dropped dramatically after incubation with monodansylcadaverine (Fig. 1C). These results indicated that the antiphagocytic ability of SsTGase-N was dependent on its TGase activity.

Overall Structure of SsTGase-N

To better understand the biological functions of SsTGase, we solved the crystal structure of SsTGase-N that also included a TGase domain (residues 247–348). The structure reveals that SsTGase-N forms a homodimer in an antiparallel manner (Fig. 4A). In each protomer, the region spanning residues 353–363 is invisible probably due to intrinsic flexibility (Fig. 4B). Each protomer forms an elongated and twisted dumbbell-like fold, which can be divided into three regions: an N-terminal domain (residues 38–208; referred to as NTD hereafter), a C-terminal TGase-like domain (residues 221–437; referred to as CTD hereafter), and a connecting helix (α5 helix; residues 209–220). The NTD consists of two antiparallel β-sheets in the center with four and three β-strands, respectively. Each of the two β-sheets is flanked by two helices. Similar to other solved structures of TGases, a deep cleft is generated at the edge of the CTD where catalytic residues Cys³⁰², His³³³, and Asn³⁴⁸ are located (Fig. 5B). Clusters of helices formed in the N terminus of the CTD are composed of α6, α6′, α7, and α7′ followed by an antiparallel β-sheet comprising three β-strands (β8, β9, and β10). In the C terminus of CTD, two parallel β-strands and two α-helices wrap around the whole domain. The two protomers are compacted together, and the CTD from one protomer lies opposite to the NTD of the other (Fig. 4A).

FIGURE 4.

Overall structure of SsTGase-N. A, ribbon representation of the structure of SsTGase-N with its N and C termini indicated. NTDs with α5 helices are shown as blue and magenta, and CTDs are shown as red and cyan. B, the topology of SsTGase-N. NTD and α5 helix are depicted in pink, and CTD is depicted in cyan. The regions where catalytic residues are located are shown in green color. The missing region between β10 strand and α8 helix (residues 353–363) is represented as a dotted line.

FIGURE 5.

Common feature of the active site in TGase-like family. A, sequence alignment among SsTGase-N and homologous functional TG domains of human coagulation factor XIII, FTG, human TGase3, and WbmE protein from Bordetella bronchiseptica. Conserved residues of the catalytic triad are indicated by red arrows. B, graphic representation of the catalytic active cavity of SsTGase-N. NTDs with α5 helices are shown as blue and magenta, and CTDs are shown as red and cyan. Catalytic active residues and residues involved in stabilizing catalytic active cavity are shown in yellow and magenta sticks, respectively. Hydrogen bonds are represented as red dashed lines. Enlarged views of catalytic active cavity in the left panel are shown in the right panel. C, stereoviews of structural alignment of the catalytic region of SsTGase-N (cyan), human coagulation factor XIII (pink; Protein Data Bank code 1GGT), and fish-derived transglutaminase (orange; Protein Data Bank code 1G0D). Detailed views of the superposition of catalytic residues in the left panel are shown in the right panel.

The interactions between the two protomers are distributed in two regions mainly composed of hydrogen-bonding interactions and water-mediated interactions. In one region, Thr²¹⁵ from one protomer interacts with Ser²¹⁸ of the other through hydrogen-bonding interactions, stabilizing the interactions between the two α5 helices in an antiparallel orientation (Fig. 6A). In the other region, water-mediated interactions could be observed among the main-chain carbonyl group of Leu¹⁷⁶ located at α4 helix (residues 172–179), the side-chain guanidine group of Arg³¹¹, and the carbonyl group of Leu⁴¹² (Fig. 6A). Notably, Arg³¹¹ sits on the same α-helix where the catalytic residue Cys³⁰² is located.

FIGURE 6.

Dimerization of the protein could promote activation of the protein by stabilizing the architecture of catalytic cavity. A, graphic representation of the interface between two monomers. NTDs with α5 helices are shown as blue and magenta, and CTDs are shown as red and cyan. Residues involved in interactions are indicated and shown in yellow sticks. Hydrogen bonds are represented as red dashed lines. Enlarged views of the parts in the black box in the left panel are shown in the right panel. B, the mutant proteins used in the measurement of antiphagocytic abilities and transglutaminase activities fold as well as wild-type protein. The purification profiles of the wild-type and mutant proteins, protein from peak 1, and the protein from peak 2 are shown after gel filtration. The sizes of the molecular markers are marked on top of the peaks. C, the protein in peak 2 is correctly folded like the protein in peak 1. The purified proteins (1 mg/ml) from peak 1 (black curve) and peak 2 (red curve) solubilized in buffer containing 20 mm Hepes, pH 7.5 and 200 mm NaCl were subjected to CD, and spectra are shown. mdeg, millidegrees.

CTD of SsTGase-N Contains a Conserved Catalytic Core Region

Although SsTGase-N shares low primary sequence similarity with known TGases from mammals or bacteria, it possesses an active region consisting of a consensus sequence motif of thiol proteases (Fig. 5A). Cys³⁰² sits on the N terminus of α7′ helix and is known to supply a thiolate ion for nucleophilic assault. The sulfhydryl group of Cys³⁰² forms a hydrogen bond with His³³³ at a loop between β8 and β9 (Fig. 5B). Additionally, the imidazole ring of His³³³ forms a hydrogen bond with Asp³⁴⁸, which is in a loop connecting β10 strand and α8 helix (Fig. 5B). Thr³⁵⁰ and Tyr³⁷⁷ also participate in the hydrogen bonding pattern in the active cavity (Fig. 5B). Specifically, both Tyr³⁷⁷ and Thr³⁵⁰ form hydrogen bonds with Asp³⁴⁸, whereas Tyr⁵⁶⁰ in human factor XIII suppresses enzyme activity by forming a hydrogen bond with the active site residue Cys³¹⁴ (31). Hydrogen bonds formed by Cys³⁰², His³³³, Asp³⁴⁸, Tyr³⁷⁷, and Thr³⁵⁰ could enhance the stability of the entire active cavity, indicating that substrates approaching the enzyme might disrupt the stable state of the active cavity by breaking the hydrogen bonds mentioned above.

Structural alignment of the entire TGase domain of SsTGase-N with the corresponding regions of human factor XIII and FTG, which are representatives of TGases from mammals, reveals that overall folding of the active site region of SsTGase-N adopts a fold similar to that of human factor XIII and FTG with root mean square deviations of 3.24 and 0.517 Å, respectively (Fig. 5C). In addition, the three active residues of SsTGase superimpose well with the catalytic triads of human factor XIII and FTG (28, 31) (Fig. 5C). Therefore, CTD of SsTGase-N has a conserved catalytic core region similar to other TGases.

Interestingly, a Dali search with the NTD of SsTGase-N only returned entries with low Z-scores of 4.1–2.0, suggesting that no known structure was identified to share significant homology with this domain (43). That is, the NTD of SsTGase-N likely represents a newly identified structural fold. Moreover, the overall folding of how SsTGase-N packs into homodimer is novel and differs from other known structures of TGases.

A New Activation Mechanism of SsTGase-N in Solution Environment

The zymogen forms of TGases require proteolytic activation or the presence of Ca²⁺ to gain their activities. For instance, microbial TGase is secreted from the cytoplasmic membrane as a zymogen and is activated by proteolytic processing (44). During the purification of the recombinant protein, two peaks (peak 1 and peak 2) of SsTGase-N emerged in the gel filtration profile corresponding to the dimer and monomer forms, respectively, as deduced from the peak positions in the gel filtration assay (Fig. 6B). The protein from the peak 1 rerun on gel filtration assay remained a single peak, whereas the protein from the peak 2 rerun on gel filtration resulted in a shift into peak 1 position (Fig. 6B). Therefore, there is a dynamic equilibrium between these two forms, and the dimer form possibly represents the more stable state. Notably, although we have conducted crystallization experiments with proteins of both conformations, only the dimer form could be crystallized. Importantly, circular dichroism results showed that the protein from peak 2 shared a similar spectrogram profile with the protein from peak 1, indicating that the monomer form was also properly folded (Fig. 6C). Unexpectedly, the monomer form displayed extremely low TGase enzyme activity and antiphagocytic capacity compared with the dimer form (Fig. 3, B and C). All the protein we used for the activity assay, unless otherwise specified, came from peak 1. Thus, we proposed that dimerization of the protein could promote activation of the protein. To test that, we set out to examine the interface between the monomers. Because our structure indicated that interactions between the two monomers are mainly mediated by hydrogen-bonding interactions between Thr²¹⁵ from one monomer and Ser²¹⁸ of the other as well as water-mediated interactions between Leu⁴¹² and Arg³¹¹ from one monomer and Leu¹⁷⁶ of the other, we generated two point mutations, T215A and R311A. No conformational changes of the protein appeared after mutating Thr²¹⁵ to Ala, and the protein from peak 1 and peak 2 displayed a TGase activity and antiphagocytic ability similar to those of the wild type (Figs. 6B and 3, B and C). Interestingly, the SsTGase-N^R311A protein only displayed a single peak at the monomer position in the gel filtration profile, implying that the conformation of the protein changed into a monomer completely and that Arg³¹¹ played an important role in stabilizing the dimerization of the protein (Fig. 6B). TGase activity and antiphagocytic ability of SsTGase-N^R311A decreased to quite a low level (Fig. 3, B and C), suggesting that dimerization of the protein is crucial for maintaining functional activities. Structural analysis revealed that Arg³¹¹ and the catalytic amino acid Cys³⁰² from one monomer sit on the same α-helix (α7′ helix), which can be stabilized by water-mediated interactions mediated by α4 helix of the other monomer. To our knowledge, similar interactions have not been observed in other solved structures, such as human factor XIII and human TGase 3 (27, 29, 31). Taken together, we propose that the SsTGase-N monomer was not stable enough to catalyze the reaction in solution environment, whereas dimerization of the protein could promote its activation by stabilizing the architecture of the catalytic cavity.

Discussion

In this study, we identified SsTGase as a new virulence factor in the infection process with antiphagocytic function, which was dependent on its TGase activity. Structural analyses show that SsTGase-N shares a common feature of active site cavity with eukaryotic TGases but with a novel activation mechanism. Because of their ubiquitous distribution, TGases play important roles in physiological and pathological processes by post-translational modifications of substrates. For instance, glycoprotein gp42 present in the cell wall of Phytophthora sojae can induce plenty of defense mechanisms, eliciting a hypersensitive response, resulting in death of the infected cells (21, 45). Moreover, some bacterial toxins, including the cytotoxic factor 1 of E. coli, act as a TGase (46). Thus, we propose that SsTGase is secreted from the cytoplasmic membrane and activated by disruptions of the physiological homoeostatic environment after invasion, and then the mature SsTGase could modify the surface proteins of Ss2 and/or host to avoid phagocytosis. Obviously, the details of how SsTGase functions as a virulence factor in the infection process of Ss2 need further investigation.

Interestingly, mapping the electrostatic potential of SsTGase-N onto its surface revealed that the active site was mainly surrounded by highly negatively charged residues (Fig. 7). Indeed, a similar situation was also observed in the structure of GP42 in which a strong negative potential delineates a groove adjacent to the active site (29). To our knowledge, identification of the target proteins of TGase has been very challenging due to the highly cross-linked property and insolubility of the product (47). Therefore, to date, no substrates of SsTGase-N have been identified. This structural feature prompted us to propose that the enzyme likely interacts with positively charged substrates.

FIGURE 7.

Electrostatic surface model of the monomer of SsTGase-N. The graphic and electrostatic surface representations are shown in the left and right panels, respectively. The catalytic region is indicated with a black dashed circle.

Structurally directed mutagenesis studies revealed that dimerization was required for the enzymatic activity of SsTGase-N. Based on this, we have proposed a new activation mechanism of SsTGase-N. Notably, human transglutaminase 2 undergoes a large conformational change upon activation, whereas overall structures of microbial TGase zymogen and mature microbial TGase are essentially the same (30, 48). Therefore, structural changes of SsTGase-N upon activation still await the determination of the structure of SsTGase-N in a monomer state. Detailed description of the activated mechanism will clearly require additional biochemical characterizations.

The characterization of SsTGase as a novel virulence factor of Ss2 by acting as a new TGase in TGase-like superfamily (PF01841) will facilitate the development of new therapeutic agents capable of efficiently interfering with Ss2 infection. In addition, compared with the high cost of transglutaminase of animal origin (23, 25), SsTGase might have the potential to be applied as a new biocatalyst in the biomedical and biotechnology fields.

Author Contributions

M. Y., Y. J., and Y. Y. designed the study and wrote the paper. J. Y. purified and crystallized SsTGase-N protein. J. Ge. determined the x-ray structure of SsTGase-N. J. Y. and Y. P. designed and constructed vectors for expression of the mutant protein and analyzed antiphagocytic ability and TGase activity of the mutant protein. Y. P., J. Gu., Y. Z., H. J., and H. H. performed the blood survival assay, neutrophil (PMN) killing assay, experimental infections of piglets, and Western blotting. All authors analyzed the results and approved the final version of the manuscript.