Skip to main content
Physiology and Molecular Biology of Plants logoLink to Physiology and Molecular Biology of Plants
. 2015 Jul 6;21(3):375–384. doi: 10.1007/s12298-015-0308-0

RETRACTED ARTICLE: RAPD and ISSR marker mediated genetic polymorphism of two mangroves Bruguiera gymnorrhiza and Heritiera fomes from Indian Sundarbans in relation to their sustainability

Nirjhar Dasgupta 1, Paramita Nandy 2, Chandan Sengupta 3, Sauren Das 1,
PMCID: PMC4524862  PMID: 26261402

Abstract

Increased salinity distresses some key species severely in Indian Sundarbans. Geomorphic characteristics coupled with demographic obligations have proven to be pivotal factor towards the prevalence of elevated salinity in this zone. Better adaptation to rapid changes in microclimate demands wide range of genetic polymorphism as well. RAPD and ISSR molecular markers were used for this genetic diversity study. Degree of polymorphism was found relatively higher in Bruguiera gymnorrhiza (26.43 % in RAPD and 24.36 % in ISSR) than the other taxa, Heritiera fomes (14.43 and 12.76 % respectively) in case of RAPD and ISSR. Dendrogram constructed based on the similarity matrix showed that for H. fomes, least saline and highest saline zones are positioned in the same clade; whereas in B. gymnorrhiza the higher saline areas were clustered together. Nei’s gene diversity (h) as revealed from RAPD and ISSR analysis were found to be 0.0821, 0.0785 and 0.0647, 0.0592 in B. gymnorrhiza and H. fomes respectively. The higher degree of polymorphism as revealed from UPGMA Dendrogram and Nei’s genetic diversity might be attributed towards the comfortable growth of B. gymnorrhiza all along the Indian Sundarbans. On the other hand the relatively lesser degree of genetic polymorphism of H. fomes might be attributed towards their precarious status in present days elevated salinity in Indian Sundarbans.

Keywords: Adaptation, ISSR, Mangrove, RAPD, Sundarbans

Introduction

Mangrove represents a divergent group of plant species possessing certain unique adaptive homogeneity to colonize in tropical and subtropical brackish world. The uniqueness of mangroves is in their adaptability in extreme weather conditions and fluctuating soil salinity. Different mangrove species adopt diverse salt management strategies to cope with the inhospitable environment of high salinity in terms of anatomical, physiological and molecular mechanisms (Das 1999; Nandy et al. 2007, 2009; Dasgupta et al. 2010). Mangroves, the most fascinating, both economically and ecologically, imperative vegetation have been studied comprehensively for decades (Chapman 1976; Saenger et al. 1983; Tomlinson 1986; Kathiresan and Bingham 2001; Lacerda et al. 2002). Mangrove forests are considered as enormous productive and protective ecosystems for the coastal environment and inhabitants. According to FAO report (2007), the anticipated economic valuation is predictably to be worth about US$186 million per year. The dense root systems of mangrove species act as good soil binder and mitigate periodic sea surges. Hiraishi and Harada (2003) indicated that a mangrove stand of 30 trees per 0.01 hectare with a depth of 100 m can decrease the destructive force of a tsunami by up to 90 %. Mangrove forests are domicile to a large variety of fish, crab, shrimp, and mollusk species. Recently, the annual valuation of mangrove forest product (The combined values of collected wood and non-wood forest products and coastal protection) is estimated at US$12,392 ha−1 (Barbier 2007). The existence crisis of this important habitat initiated after industrialization and development; conversion of agricultural land, aquaculture, human habitation, industrial runoff, and over exploitation are all considered as much threats on this estuarine vegetation (Alongi 2002; Giri et al. 2008, 2011). Mangrove ecosystems currently cover 146,530 km2 across the tropical world which represents a decline from 198,000 km2 of mangroves in 1980 and 157,630 km2 in 1990 (FAO 2007). Spalding et al. 1997 and Spiers 1999 commented that the current estimate of mangrove forests of the world is less than half of what it was once and maximum of which exists in a lean condition. Duke et al. (2007) opined that the decline of the mangrove forest occurs at a faster rate than any other inland tropical forest. The relative sea level rise could be the greatest threat to mangrove formation (Gilman et al. 2008) and it is postulated that 30–40 % of coastal wet lands and 100 % of the mangrove forest could be lost in the next 100 years if the current rate of denudation continues (Duke et al. 2007). These losses correspond to about 2.0 % per year since 1980–1990 and 0.7 % per year within 1990–2000 (FAO 2007).

Sundarbans, the largest mangrove forest in the world, extended between 69°E-89.5°E longitude and 7°N-23°N latitude, is formed by the two important rivers of Indian subcontinent, the Ganga and the Bramhaputra, with their numerous tributaries. With the highest species diversity (36 true mangroves, 28 associates and seven obligate mangrove species representing 29 families and 49 genera) the forest area covers approximately 2152 km2 in Indian territory (one third of the total delta, rest under Bangladesh) (Naskar and GuhaBakshi 1983; FSI 2009). Karim (1994) classified the whole Sundarbans using the salinity scale described by Walter (1971) as follows – a) Oligohaline Zone (soil Salinity ≤5 ppt), b) Mesohaline Zone (soil salinity ≤10 ppt) and c) Polyhaline Zone (soil salinity >10 ppt). Indian Sundarbans is placed in the Polyhaline zone (Fig. 1d). Since the late twentieth century, damming on the lower Gangetic plain cut off a generous amount of freshwater influx through Hooghly and its tributaries to the delta region. Moreover, tectonic plate movement, has been leading to slow uplifting of the Bengal plate towards northwest (India) and subsidence in the east (Bangladesh) and thus the majority of the sweet water influx through the river system is being diverted to lower part of the delta, ultimately an elevated salinity persists in the western part (India) of Sundarbans; which has a direct impact on mangrove vegetation pattern. Urban sewage and industrial effluent accelerate silt formation in the riverbed causing decreased runoff of sweet water influx and caused elevation of salinity level in the delta region. As a result, the soil salinity in western Sundarbans reaches as high as 27 ppt (Nandy et al. 2007). These geomorphic and demographic adversities have proven to be distressing for some key plant species in Indian Sundarbans like Aegialitis rotundifolia, Heritiera fomes, Nypa fruticans, Xylocarpus granatum and Xylocarpus mekongensis (Banerjee 1999; Upadhyay et al. 2002; IUCN Red List 2013). It has been experimentally proven that Heritiera fomes prefers less than 5 ppt salinity that prevails in Oligohaline zone (Huq et al. 1999) and the ridges of higher elevation that are inundated only during spring tide (Alim 1979). Previously in the Western part of Sundarbans, the trees of Heritiera fomes used to be 2 m in girth, but even 1 m girth are no longer common and top dying disease is very frequent (Curtis 1993). Decrease in sweet water influx in Sundarbans due to damming in major rivers and other anthropogenic activities have been evident in increased soil salinity and in addition to that unexplained top dying disease is putting H. fomes population at risk (GBP-IIT-ENB-DAT Report 2012). This species can be abundant in some parts of its range in Bangladesh part of Sundarbans, but has limited overall distribution. In Indian Sundarban, this species is rapidly declining. In India, this species could only be found in 6 % of 100 sampling sites (Kathiresan 2008).

Fig. 1.

Fig. 1

a-c Location of the study area. d. Spatial saline zones

A species without wide genetic diversity is considered to be incompetent to cope with changing environments (Schaal et al. 1991) and also adaptive response to hostility depends on the level of genetic diversity it contains (Ayala and Kiger 1984). Mangrove plant communities have been the subject of taxonomic, floristic, physiological and ecological studies time to time (Muller and Hou-Liu 1966; McCoy and Heck 1976; Weber-El Ghobary 1984; Juncosa 1988; Juncosa and Tomlinson 1988). Developments of molecular methods have provided opportunities to take mangrove research in new directions and to address unresolved issues in mangrove studies. Molecular markers have a number of apparent advantages over the morphological characters evaluation of genetic diversity. Most of the morphological characters are sensitive to environmental conditions and growths stages, whereas molecular markers are not prone to such factors and are abundantly present. Among the molecular marker techniques, RAPD has a number of advantages, such as ease of use, low cost and the use of small amount of plant material. RAPD was proved to be better as genetic marker in the case of self-pollinating species with a relatively low level of intra-specific polymorphism inferences concerning the histories of phylogenetic groups and geographical structure of populations are based on divergence of DNA sequences between lineages and on frequencies of allelic forms of genes within populations and differences in frequencies between populations. Studies on mangroves have also been benefited by molecular marker assisted techniques as reports on genetic diversity and molecular phylogenies of mangroves are emerging (Abeysinghe et al. 2000; Lakshmi et al. 1997, 2002; Parani et al. 2000; Mehta et al. 2005). Genetic diversity is a trait of ecosystems and gene pools that depicts a characteristic, which is commonly held to be advantageous for survival (Parani et al. 1997; Ge and Sun 1999; Maguire et al. 2002). Studies on RAPD and ISSR markers are necessary, in order to establish base line information to assist future conservation and breeding programs of these species. Mangrove plants are defined ecologically by their occurrence in tidal zones along shorelines and in estuaries and physiologically by their ability to withstand high salt concentrations and low soil aeration. A rapid change of ecology affects the vegetation pattern of mangroves and it is now degrading to a large extent. Apart from the ecological and economic significance, its preservation is essential to maintain biodiversity and ecological balance. It is possible to characterize a plant species at a morphological basis, but it remains difficult to identify in a mixed population. Therefore, the use of molecular markers might develop the understanding of such situation. One major use of DNA techniques in conservation is to reveal genetic diversity within and between populations. Inter-simple sequence repeats (ISSR) is a DNA marker and this marker can be used without the knowledge of the sequence information of genomic DNA (Zietkiewicz et al. 1994). DNA is amplified though polymerase chain reaction (PCR) using a single primer designed of a microsatellite sequence in this ISSR marker technique. Li and Xia 2005 and Chen et al. 2005 opined that ISSR has reasonable cost, good reproducibility and mild technical complexity; permitting it’s application in genetic studies of population. In view of the above, the present work aims to measure the comparative level of genetic diversity of the degrading taxa Heritiera fomes and the profusely growing taxa Bruguiera gymnorrhiza across different geographical regions with differential salinity level. Two molecular marker mediated techniques RAPD and ISSR were used for assessing the genetic diversity of both the plant taxa.

Materials and method

Collection sites

The above mentioned two taxa were collected from naturally occurring five different islands of Sundarbans mangrove swamps. All sites are included in the core region, at the north-eastern part of western Sundarbans (Indian part) to southern extremity towards the sea (Bay of Bengal), without any demographic interference., namely Sajnakhali (22° 07′ 26″ N 88° 49′ 51″ E), Sudhanyakhali (22° 06′ 05″ N 88°48′ 06″ E), Sonargaon (22° 06′ 29″ N 88°46′ 23″ E), Jharkhali (22° 01′ 13″ N 88°41′ 10″ E) and Dobanki (21° 59′ 04″ N 88°44′ 38″ E) (Fig. 1). For each island or site, sampling was done from 6 locations with a minimum distance of 10 ft. The substrate salinity of these sites were in increasing gradient and measured as 11.77 ± 2.1, 12.25 ± 1.96, 12.4 ± 1.18, 13.98 ± 2.29 and 15.23 ± 2.16 ppt respectively (Dasgupta et al. 2012). The controlled mesophytic replicas of the studied taxa, well matured up to 15–17 years old, collected from the premises of Indian Statistical Institute, Kolkata, where the soil salinity was 2 ppt (Dasgupta et al. 2012) were also taken for comparative study.

Isolation of genomic DNA

Young leaf buds were used as the material for isolation of total genomic DNA for both of the plant samples i.e. Bruguiera gymnorrhiza and Heritiera fomes. The desired amount of leaf buds were weighed from all these plant species, which was followed by washing them with double distilled water. Qiagen DNeasy Plant Mini Kit was used for extraction of DNA from these samples following maceration with liquid nitrogen in a mortar pestle, in aseptic condition.

RAPD and ISSR analysis

For RAPD and ISSR analysis 20 ng of genomic DNA was PCR amplified. 26 decamer RAPD primers and 20 ISSR primers were used for assessing the genetic diversity of the plant species (Tables 1 and 2). Each reaction or amplification mixture of 25 μl consisted of 1.5 μl of 10X reaction Buffer, 25 mM Magnesium Chloride (MgCl2), 20 pM of the RAPD primer, 2 mM DNTPs, 1 Unit of Taq Polymerase enzyme (Bioline) and Millipore water. The amplification was carried out in a Thermocycler (PEQLAB Primus 25 Advanced thermocycler). At the beginning, before the start of the cycles the DNA was subjected to denaturation at 94 °C for 5 min. In the following 45 cycles the denaturation period was 45 sec, Primer annealing period was 1 min and primer extension period at 72 °C was 1.30 min. The temperature for primer annealing period was adjusted based on the melting temperature (Tm) of the individual primers. One last cycle of only primer extension at 72 °C for 7 min. was performed following which the temperature of the reaction mixture was allowed to come down to 10 °C. PCR products were separated by electrophoresis using 1.5 % agarose gel containing ethidium bromide (0.5 μg/ml). The sizes of the amplicons were determined using size standards (Bioline make Hyper Ladder II). DNA bands were observed under UV transilluminator and photographed, which was later analyzed using various statistical software.

Table 1.

List of RAPD primers

Sl. No. Nucleotide Sequence Sl. No. Nucleotide Sequence
1.OPA1 5′ CTGGGCAACT 3′ 14.OPA14 5′ GTGACGTAGG 3′
2.OPA2 5′ GTCTTGCGGA 3′ 15.OPA15 5′ GGGTAACGCC 3′
3.OPA3 5′ ACTGAACGCC 3′ 16.OPA16 5′ GTGATCGCAG 3′
4.OPA4 5′ TCGGCACGCA 3′ 17.OPA17 5′ CAATCGCCGT 3′
5.OPA5 5′ TCGCCCAGTC 3′ 18.OPA18 5′ TCGGCGATAG 3′
6.OPA6 5′ AACGGCGACA 3′ 19.OPA19 5′ CAGCACCCAC 3′
7.OPA7 5′ CAGGCCCTTC 3′ 20.OPA20 5′ TCTGTGCTGG3′
8.OPA8 5′ TGCCGAGCTG3′ 21.RAPD21 5′ TTCCGAACCC3′
9.OPA9 5′ AGTCAGCCAC 3′ 22.RAPD22 5′AGCCAGCGAA3′
10.OPA10 5′ AATCGGGCTG 3′ 23.RAPD23 5′GACCGCTTGT3′
11.OPA11 5′ AGGGGTCTTG 3′ 24.RAPD24 5′AGGTGACCGT3′
12.OPA12 5′ GGTCCCTGAC 3′ 25.RAPD25 5′ CAAACGTCGG3′
13.OPA13 5′ GAAACGGGTG 3′ 26.RAPD26 5′GTTGCGATCC3′

Table 2.

List of ISSR primers

Sl. No. Nucleotide sequence No. of nucleotides Sl. No. Nucleotide sequence No. of nucleotides
1.ISSR1 5′ AGAGAGAGAGAGAGAGT 3′ 17 11.ISSR11 5′ CACACACACACACACARC 3′ 18
2.ISSR2 5′ AGAGAGAGAGAGAGAGG 3′ 17 12.ISSR12 5′ CTCCTCCTCCTCCTCCTC 3′ 18
3.ISSR3 5′ AGAGAGAGAGAGAGAGC 3′ 17 13.ISSR13 5′ DBDACACACACACACAC 3′ 17
4.ISSR4 5′ GAGAGAGAGAGAGAGAT 3′ 17 14.ISSR14 5′ AGAGAGAGAGAGAGAGCTC 3′ 19
5.ISSR5 5′ GAGAGAGAGAGAGAGAC 3′ 17 15.ISSR15 5′ AGAGAGAGAGAGAGAGCTA 3′ 19
6.ISSR6 5′ CACACACACACACACAG 3′ 17 16.ISSR16 5′ AGTACGAGTTCTCTCTCTCTCTC3′ 23
7.ISSR7 5′ ACACACACACACACACT 3′ 17 17.ISSR17 5′ ACACACACACACACACYA 3′ 18
8.ISSR8 5′ AGAGAGAGAGAGAGAGYT 3′ 18 18.ISSR18 5′ ACACACACACACACACYT 3′ 18
9.ISSR9 5′ AGAGAGAGAGAGAGAGYC 3′ 18 19.ISSR19 5′ ACACACACACACACACCTG 3′ 19
10.ISSR10 5′GAGAGAGAGAGAGAGAYG 3′ 18 20.ISSR20 5′ ACAGTGTGTGTGTGTGT 3′ 17

Statistical analysis

In RAPD and ISSR analysis, the presence or absence of the bands was considered. From RAPD and ISSR data a binary matrix was obtained and calculated using the multivariate analysis program NTSYS-PC (Rohlf 1993). Jaccard’s coefficient (Jaccard 1998) was used to create a similarity matrix from the binary matrix. Phylogenetic dendrogram was obtained from this matrix by cluster analysis following the unweighted pair group with arithmetic mean (UPGMA) method (Sneath and Sokal 1973), using NTSYS version 2.1, Exeter Software, New York, USA. POPGENE 32 (Yeh et al. 1997) Statistical software was used for calculating mean of observed no of allele per loci (na), mean effective no of allele per loci (ne), Nei’s gene diversity value (h), Shannon’s Information index (I).

Results

RAPD analysis

A total of 26 primers were used for this study. These primers produced a total of 227 bands in case of B. gymnorrhiza, with an average of around 9 bands which ranged from 8 to 11 bands per primer. Out of these 60 were polymorphic, that makes a total of 26.43 % of the loci were found to be polymorphic. Polymorphism was found to be relatively high in B. gymnorrhiza in primers OPA03, OPA08, OPA09, OPA 14, OPA 17, OPA19, RAPD 21, RAPD23, RAPD 25 and RAPD 26. The degrading taxa H. fomes reproduced relatively less polymorphism (14.43 %). H. fomes produced a total of 201 bands; of which 29 were polymorphic. Around 8 bands were produced on an average per primer which ranged between 6 and 9 bands per primer. OPA3, OPA7 and RAPD22 produced relatively higher no. of polymorphic bands for H. fomes among the 26 primer used. Figure 2a,b shows gel photograph of amplified DNA bands with two RAPD primers for each of the two species.

Fig. 2.

Fig. 2

a,b RAPD Gel Photograph (OPA3, OPA4 in a and OPA17, RAPD 22 in b)from six sites 1-Mesophytic, 2-Sajnekhali, 3- Sudhanyakhali, 4-Sonargaon, 5-Jharkhali and 6-Dobanki. c,d ISSR Gel Photograph (ISSR5, ISSR6 in c and ISSR12, ISSR13 in d) from six sites 1-Mesophytic, 2-Sajnekhali, 3- Sudhanyakhali, 4-Sonargaon, 5-Jharkhali and 6-Dobanki. a and c Bruguiera gymnorrhiza, b and d Heritiera fomes

ISSR analysis

A total of 20 primers were selected for this study. Here also the polymorphism was found to be relatively higher in case of the profusely growing plant taxa B. gymnorrhiza, as we observed in RAPD analysis. B. gymnorrhiza produced a total of 48 polymorphic loci among total 197 amplified bands producing 24.36 % polymorphism. Total no. of bands expressed ranged between 8 and 12 per primer. Nine primers i.e. ISSR3, ISSR5, ISSR7, ISSR8, ISSR 10, ISSR14, ISSR15, ISSR16 and ISSR19 produced the higher no. of polymorphic bands. H. fomes expressed a total of 188 bands, among which 24 were found to be polymorphic; which make the total percentage of polymorphism as 12.76 for this species. Total no. of bands per primer was found to be in the range of 7 to 12. ISSR5, ISSR7, ISSR13 & ISSR19 produced relatively higher no of polymorphic bands. Figure 2c,d shows gel photograph of amplified DNA bands with two ISSR primers for each of two species.

Statistical analysis

RAPD analysis of B. gymnorrhiza produced a total of 227 bands out of which 60 were polymorphic. The mean of observed no of allele per loci (na) was 1.1757 and the mean effective no of allele per loci (ne) was found to be 1.1387 (Table 3). The Nei’s gene diversity value (h) was 0.0821 and Shannon’s Information index (I) recorded 0.1192. H. fomes recorded na value of 1.1169, ne value of 1.0647, h value of 0.0647 and I value of 0.0874. The genetic similarity calculated from the RAPD analysis data showed a higher rate of similarity UPGMA Dendrogram based on Similarity matrix constructed for RAPD analysis (Fig. 3a,b) shows in H. fomes the non-saline site, site I and the two most saline sites, i.e. site V and VI are clustered together, where as in other taxa they are in distant clusters. Whereas in B. gymnorrhiza samples from the more saline zones are clustered in the same clade.

Table 3.

Statistical analysis of DNA polymorphism by RAPD and ISSR molecular markers for the two species

Names of the investigated taxa No. of Loci No. of polymorphic loci Percentage of polymorphic loci na ne h I
B. gymnorrhiza RAPD 227 60 26.43 1.1757 1.1387 0.0821 0.1192
H. fomes 201 29 14.43 1.1169 1.0647 0.0647 0.0874
B. gymnorrhiza ISSR 197 48 24.36 1.1651 1.1338 0.0785 0.1187
H. fomes 188 24 12.76 1.0841 1.0501 0.0591 0.0787

* na Observed number of alleles

* ne Effective number of alleles (Kimura and Crow (1964))

* h Nei’s (1973) gene diversity

* I Shannon’s Information index (Lewontin (1972))

Fig. 3.

Fig. 3

Dendrogram Analysis a,b RAPD analysis, c,d ISSR analysis, e,f RAPD and ISSR Combined

ISSR analysis of B. gymnorrhiza produced a total of 197 bands out of which 48 were polymorphic. na, ne, h, I for this species was recorded as 1.1651, 1.1338, 0.0785 and 0.1187 respectively. One hundred eighty-eight bands were produced in H. fomes, out of which 24 were polymorphic. 1.0841, 1.0501, 0.0591 and 0.0787 were the respective na, ne, h and I values for H. fomes. For ISSR analysis UPGMA Dendrogram based on Similarity matrix was also constructed (Fig. 3c,d). It again showed that site I, V and VI are clustered together in H. fomes; where as in other taxa they are in distant clusters. The data of both RAPD and ISSR were pooled and based on that UPGMA dendrogram was constructed following Jaccard’s similarity matrix (Fig. 3e,f). Here also in B. gymnorrhiza the samples from more and less saline zones were found in the same clade, where as samples from the most and least saline zones were clustered together.

Discussion

Dodd et al. 2002 proposed that to understand the evolution of mangrove populations and predict their likely response to climate change, considerating the historical factors that shaped the present-day populations is of immense importance. The study of genetic diversity in natural mangrove populations has not been done in detail till date, except for Avicennia species (Maguire et al. 2002; Arnoud-Haond et al. 2006; Nettel and Dodd 2007). Thus, it is necessary to examine how genetic information in natural population may vary across different geographic and climatic areas by molecular markers. Molecular markers, unlike morphological markers, are not prone to environmental influences and therefore offer the vital information in the direction of the priority areas for conservation strategies. In this study with RAPD markers, it was found that the degree of genetic diversity or polymorphism is relatively much lower in H. fomes (14.43 %). The relatedness (proximity or distance) of genetic polymorphic expression of the studied taxa is evident from the constructed dendrogram (based on similarity matrix). The degrading species H. fomes, in extreme saline zone and mesophytic zone are clustering together (they are in the same clade). These two species have also showed their weaker efficiency in antioxidants (both enzymatic and non-enzymatic) production along the increasing substrate salinity (Dasgupta et al. 2013), which in turn points towards lean sustainability in increasing saline zones. Whereas the other species i.e. B. gymnorrhiza has relatively higher degree of genetic polymorphism (26.43 %), which might be attributed to protection against Reactive Oxygen Species; thus posing this species more sustainable in the increasing saline condition of the present days’ Sundarbans. On the other hand the relatively low polymorphism level as proven by RAPD and ISSR analysis in Heritiera fomes might be attributed to relatively less ability to scavenge ROS at higher saline areas which might in turn be attributed to one of the major reasons for the unfavourable existence leading to gradual natural demolition of this taxa from the Indian part of Sundarbans. Genetic Diversity is regarded as the prerequisite for any species to cope with changing environments or evolving competitors and parasites (Schaal et al. 1991; Ayala and Kiger 1984). Therefore, studies of genetic structure within and between species may not only illustrate the evolutionary process and mechanism, it would also provide valuable information for natural conservation of the stressed plant species. Askari et al. (2011) commented that retaining the integrity of species as well as their genetic diversity is one of the vital interests for policies and serious steps are to be taken in order to protect individual which are in danger of extinction. Thus, marker assisted polymorphic study is essential for determining the genetic diversity among a population.

The high reproducibility of ISSR markers may be because of using longer and site specific primers and higher annealing temperature than those used for RAPD. Zietkiewicz et al. 1994 commented that ISSR technique, based on its unique characters, has higher reproducibility than isozyme and has superior stability than RAPD. In this experiment, the percentage of genetic polymorphic nature expressed by B. gymnorrhiza (24.36 %) was found to be superior to the other one, H. fomes (12.76 %). In the clustering analysis on the basis of allelic similarity, H. fomes showed least distances occur among the mesophytic and higher salinity grown individuals. To clarify genetic diversity, genetic structure, the relationship between genetic distance and geographical distance, and to provide basic data and scientific basis for effective protection, ISSR molecular marker technology is considered to be a useful tool to study the genetic diversity of the studied taxa. Shen et al. (2005) opined that the genetic diversity at the species level, the product of long-term evolution, is a prerequisite for survival and development. Studying the genetic diversity and genetic structure of a species is the basis of exploring its adaptability and viability. Adaptability and evolution of a species are based on the level of genetic diversity present in populations, which reflect the richness of diverse genotypes in a specific environment. The percentage of polymorphic loci can be used as indicator to measure the level of genetic diversity (Chen et al. 2010). In the present work, H. fomes exhibited a lower level of diversity percentage (as revealed from RAPD and ISSR data), which might be ascribed to their passive sustainability in the elevated saline regime. From the genetic perspective, a higher level of genetic diversity results in a greater ability to adapt and evolve (Li and Chen 2004). Low genetic diversity can result in reduced adaptability and increased occurrence of less beneficial genes, leading to eventual extinction of the species and thus the lower level of diversity within populations should be paid special attention. The level of genetic diversity can provide very important information about the status of a species, an assessment of its conservation value, and ex situ conservation. Different genotypes in different habitats have different fitness, which causes the same genotype to clump together into more suitable microhabitats.

Currently there are very limited resources of natural habitats of H. fomes population in Indian Sundarbans and thus the most important aspect in protecting these resources, is maintaining their genetic diversity. The richness of genetic diversity determines the ability to adapt and evolve; it also provides very important information on the status of a species and its conservation value. When selecting the best provenance for introduction and transplantation, quality groups and individuals for genetic improvement, special attention should be paid to the populations and individuals that come from special habitats or demonstrate irreplaceable uniqueness. The Sundarbans have been under systematic management since long back. However, unremitting pilferages of precious plant species are a major risk to sustainability (Naskar 1999). A continuous yield principle under the selection scheme was in practice in the past and weighted was given mainly to two or three timber species, including Heritiera and Xylocarpus. Dasgupta and Shaw 2013 opined that mining of goods and enlarging arable land are the main source of anthropogenic pressure on these protected forests. Although lately, special emphasis has been given on ecosystem management and timber felling has now been prohibited. This alongwith enrichment planting has started to refurbish forest health (Siddiqui 2001). Higher successful conservation extracts adaptation co-benefits and vice versa, as for example in Netherlands bio-embankments and beach nourishment have provided efficient defence against coastal erosion along the coasts (Inman 2010; Kazmierczak and Carter 2010). In the Sundarbans, an interdisciplinary collaboration between natural and social scientists has become mandatory to develop policies addressing conservation and climate change adaptation (Ghosh et al. 2015). The government of West Bengal has recently taken up this issue for the Sundarbans and have announced a number of development measures including ecotourism infrastructure (Dinda 2007). Integrated plans to amplify the supply of freshwater to the Sundarbans are necessary through excavation of riverbeds and review of treaties with our neighbouring countries. Inside the ridge of tidal forest zones in the Sundarbans forest some of the H. fomes are noted, but the growth is relatively much rarer on the river side. The disparity in growth as observed may be due to higher salinity towards the river side forest and more human pressure on the river side trees than the inside forest area.

The present study concentrated on these above endangered plant species with the aim of resource survey analysis. Enhanced salinity level that prevails in the Western Sundarbans (Indian part) has proven to have a deterioration effect on vegetation pattern in terms of structure (species diversity, abundance) and its function (survival, growth and reproduction). Apart from the ecological and economic significance, their sustainability is posing a challenge to the scientific world to uphold biodiversity and ecological equilibrium. Given the marked uniformity of zonation pattern, vegetation array might be advantageous in inferring the effect of minor changes in coastal conditions and as such, mangrove vegetation would be worthwhile as biological indicator. A better understanding and prioritization of the conservation technique towards sustainability of these plant community grown in different inhospitable substrate and microclimate demand to explore their certain biochemical behaviour (like determination of different secondary metabolites in relation to efficient ROS scavenging ability), documentation of stress related isozymes and marker mediated PCR based DNA polymorphism study. The phenotypic changes do not always suffice to infer the extent of hostility the plant is exposed to, whereas, the extent of genotypic shifts even within a population indicate the compatibility of that species with its environment. Thus, a documentary study to the above direction is necessary on the endangered species of the western (Indian) Sundarbans in order to infer a better strategy for their conservation and sustainable utilization.

Acknowledgments

The authors are sincerely indebted to the Director, Sundarbans Biosphere Reserve and Chief Principal Conservator of Forest and Wildlife, Government of West Bengal, for providing required permission to conduct field work in the Sundarbans Reserved Forest time to time.

References

  1. Abeysinghe PD, Triest L, Greef BD, Koedam N, Hettiarachi S (2000) Genetic and geographic variation of the mangrove tree Bruguiera in Sri Lanka. Aquat Bot 67(2):131–141 [Google Scholar]
  2. Alim A (1979) Instruction manual for plantations in coastal areas. In: White KL (ed) Research considerations in coastal afforestation. Food and Agricultural Organization, UNDP/FAO Project BDG/72/005. Forest Research Institute, Chittgong, pp 65–75 [Google Scholar]
  3. Alongi DM (2002) Present state and future of the world’s mangrove forests. Environ Conserv 29:331–349 [Google Scholar]
  4. Arnoud-Haond S, Teixeira S, Massa SI, Billot C, Saenger P, Coupland G, Duarte CM, Serra˜o EA (2006) Genetic Structure at range edge: low diversity and high inbreeding in Southeast Asian mangrove (Avicennia marina) populations. Mol Ecol 15:3515–3525 [DOI] [PubMed] [Google Scholar]
  5. Askari N, Abadi MM, Baghizadeh A (2011) ISSR markers for assessing DNA polymorphism and genetic characterization of cattle, goat and sheep populations. Iran J Biotechnol 9:222–229 [Google Scholar]
  6. Ayala FJ, Kiger JA (1984) Modern genetics, 2nd edn. Benjamin/Cummings, Menlo Park [Google Scholar]
  7. Banerjee LK (1999) Mangroves of Orissa coast and their ecology. Bishen Singh Mohendra Pal singh, DehraDun, p 41 [Google Scholar]
  8. Barbier EB (2007) Valuing ecosystem services as productive inputs. Eco Policy 22:177–229 [Google Scholar]
  9. Chapman VJ (1976) Mangrove vegetation. Strauss and Cramer, Leutershausen [Google Scholar]
  10. Chen JM, Liu X, Gituru WR, Wang JY, Wang QF (2005) Genetic variation within the endangered quillwort Isotoma petraea (Lobeliaceae). Mol Ecol 8:775–789 [Google Scholar]
  11. Chen S-B, Ding W-Y, Qiu J-B, Wang G-Y, Zhou Z-M, Chen J-F, Ai W-M, Wang C-Y, Xie Q-L (2010) The genetic diversity of the mangrove Kandelia obovata in China revealed by ISSR analysis. Pak J Bot 42:3755–3764 [Google Scholar]
  12. Curtis SJ (1993) Working plan for the forests of the Sundarbans Division for the period from 1st April 1931 to 31st March 1961. Bengal Government Press, India, p 175 [Google Scholar]
  13. Das S (1999) An adaptive feature of some mangroves of Sundarbans, West Bengal. J Plant Biol 42(2):109–116 [Google Scholar]
  14. DasGupta R, Shaw R (2013) Changing perspectives of mangrove management in India: an analytical overview. Ocean Coast Manag 80:107–118 [Google Scholar]
  15. Dasgupta N, Nandy P, Tiwari C, Das S (2010) Salinity-imposed changes of some isozymes and total leaf protein expression in five mangroves from two different habitats. J Plant Int 5(3):211–221 [Google Scholar]
  16. Dasgupta N, Nandy P, Sengupta C, Das S (2012) Protein and enzymes regulations towards salt tolerance of some Indian mangroves in relation to adaptation. Trees 26(2):377–391 [Google Scholar]
  17. Dasgupta N, Nandy P, Das S (2013) Salt stress: a biochemical and physiological adaptation of some Indian halophytes of Sundarbans. In Molecular Stress Physiology of Plants .Springer India.pp. 155–177
  18. Dinda A (2007) Evaluation of eco-tourism activity: a case study of Sundarban tiger reserve. In man in biosphere: a case study of Sundarban biosphere reserve; Gyan: New Delhi, India
  19. Dodd RS, Afzal-Rafii Z, Kashani N, Budrick J (2002) Land barriers and open oceans: effects on gene diversity and population structure in Avicennia germinans L. (Avicenniaceae). Mol Ecol 11:1327–1338 [DOI] [PubMed] [Google Scholar]
  20. Duke NC, Meynecke JO, Dittmann S, Ellison AM, Anger K, Berger U, Cannicci S, Diele K, Ewel KC, Field CD, Koedam N, Lee SY, Marchand C, Nordhaus I, Dahdouh-Guebas F (2007) A world without mangroves? Science 317:41–42 [DOI] [PubMed] [Google Scholar]
  21. Food and Agricultural Organization, United Nations (FAO) (2007) The world’s mangroves 1980–2005. FAO Forestry Paper 153, FAO, Rome, p 153 [Google Scholar]
  22. Forest Survey of India (FSI) (2009) State forest report 2009. Ministry of Environment and Forests, Government of India, 226 p
  23. Ge XJ, Sun M (1999) Reproductive biology and genetic diversity of a cryptoviviparous mangrove Aegiceras corniculatum (Myrsinaceae) using allozyme and intersimple sequence repeat (ISSR) analysis. Mol Ecol 8(12):2061–2069 [DOI] [PubMed] [Google Scholar]
  24. Ghosh A, Schmidt S, Fickert T, Nüsser M (2015) The Indian Sundarban mangrove forests: history, utilization, conservation strategies and local perception. Diversity 7(2):149–169 [Google Scholar]
  25. Gilman E, Ellison J, Duke N, Field C (2008) Threats to mangroves from climate change and adaptation options: a review. Aquat Bot 89(2):237–250 [Google Scholar]
  26. Giri C, Zhu Z, Tieszen LL, Singh A, Gillette S, Kelmelis JA (2008) Mangrove forest distribution and dynamics (1975–2005) of the Tsunami affected region of Asia. J Biogeogr 35:519–528 [Google Scholar]
  27. Giri C, Ochieng E, Tieszen LL, Zhu Z, Singh A, Loveland T, Masek J, Duke N (2011) Status and distribution of mangrove forests of the world using earth observation satellite data. Global Ecol Biogeogr 20:154–159 [Google Scholar]
  28. Hiraishi T, Harada K (2003) Greenbelt tsunami prevention in South-Pacific Region. http://eqtap.edm.bosai.go.jp/
  29. Huq S, Karim Z, Asaduzzaman M, Mahtab F (1999) Vulnerability and adaptation to climate change for Bangladesh. Kluwer Academic Publishers, The Netherlands [Google Scholar]
  30. Inman M (2010) Working with water. Nat Rep Clim Chang
  31. IUCN (2013) IUCN red list of threatened species. Version 2013.2. <www.iucnredlist.org>
  32. Jaccard P (1998) Nouvelles researches sur la distribution forale. Bull Soc Sci Nat 44:223–270 [Google Scholar]
  33. Juncosa AM (1988) Floral development and character evolution in Rhizophoraceae. In: Leins P, Tucker SC, Endress PK (eds) Aspects of floral development. GebrüderBornträger, Stuttgart, pp 83–101 [Google Scholar]
  34. Juncosa AM, Tomlinson PB (1988) Systematic comparison and some biological characteristics of Rhizophoraceae and Anisophylleaceae. Ann Mo Bot Gard 75:1296–1318 [Google Scholar]
  35. Karim A (1994) Vegetation. In: Hussain Z, Acharya G (eds) Mangroves of Sundarbans, vol 2. IUCN, The World Conservation Union, Bangladesh [Google Scholar]
  36. Kathiresan K (2008) Threats to Mangroves. Degradation and destruction of mangroves. Centre of Advanced Study in Marine Biology. Annamalai University, India, pp 476–483 [Google Scholar]
  37. Kathiresan K, Bingham BL (2001) Biology of mangroves and mangrove ecosystems. Adv Mar Biol 40:81–251 [Google Scholar]
  38. Kazmierczak A, Carter J (2010) Adaptation to climate change using green and blue infrastructure. A database of case studies; GraBS project. University of Manchester, Manchester [Google Scholar]
  39. Kimura M, Crow JF (1964) The number of alleles that can be maintained in a finite population. Genetics 49(4):725 [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Lacerda LD, Conde JE, Kjerfve B, Alvarez-Leon R, Alarcon C, Plania J (2002) American mangroves. In: Lacerda LD (ed) Mangrove ecosystems: function and management. Springer, New York, pp 1–61 [Google Scholar]
  41. Lakshmi M, Rajalakshmi S, Parani M, Anuratha CS, Parida A (1997) Molecular phylogeny of mangroves I. Use of molecular markers in assessing the intraspecific genetic variability in the mangrove species Acanthus ilicifolius Linn. (Acanthaceae). Theor Appl Genet 94(8):1121–1127 [Google Scholar]
  42. Lakshmi M, Parani M, Parida A (2002) Molecular phylogeny of mangroves IX: molecular marker assisted intra-specific variation and species relationships in the Indian mangrove tribe Rhizophoreae. Aquat Bot 74(3):201–217 [Google Scholar]
  43. Lewontin RC (1972) The apportionment of human diversity. Evol Biol 6:381–398 [Google Scholar]
  44. Li H-S, Chen G-Z (2004) Genetic diversity of Sonneratia alba in China detected by Inter-simple Sequence Repeats (ISSR) analysis. Acta Bot Sin 46:512–521 [Google Scholar]
  45. Li F, Xia N (2005) Population structure and genetic diversity of an endangered species, Glyptostrobus pensilis (Cupressaceae). Bot Bull Sin 46:155–162 [Google Scholar]
  46. Maguire TL, Peakall R, Saenger P (2002) Comparative analysis of genetic diversity in the mangrove species Avicennia marina (Forsk.) Vierh. (Avicenniaceae) detected by AFLPs and SSRs. Theor Appl Genet 104(2–3):388–398 [DOI] [PubMed] [Google Scholar]
  47. McCoy ED, Heck KL (1976) Biogeography of corals, seagrasses, and mangroves: an alternative to the centre of origin concept. Syst Biol 25(3):201–210 [Google Scholar]
  48. Mehta PA, Sivaprakash K, Parani M, Venkataraman G, Parida AK (2005) Generation and analysis of expressed sequence tags from the salt-tolerant mangrove species Avicennia marina (Forsk) Vierh. Theor Appl Genet 110(3):416–424 [DOI] [PubMed] [Google Scholar]
  49. Muller J, Hou-Liu SY (1966) Hybrids and chromosomes in the Genus Sonneratia (Sonneratiaceae). Blumea 14:337–343 [Google Scholar]
  50. Nandy (Datta) P, Das S, Ghose M, Spooner Hart R (2007) Effects of salinity on photosynthesis, leaf anatomy, ion accumulation and photosynthetic nitrogen use efficiency in five Indian mangroves. Wetl Ecol Manag 15:347–357 [Google Scholar]
  51. Nandy P, Dasgupta N, Das S (2009) Differential expression of physiological and biochemical characters of some Indian mangroves towards salt tolerance. Physiol Mol Biol Plants 15:151–160 [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Naskar KR (1999) Status of mangroves in Indian Sundarbans—in the perspectives of India and world mangals. In: Bakshi DNG, Sanyal P, Naskar Acharya KR (eds) Sundarbans mangals. NayaProkash, Calcutta [Google Scholar]
  53. Naskar KR, GuhaBakshi DN (1983) A brief review on some less familiar plants of the Sundarbans India. J Eco Taxon Bot 4(3):699–712 [Google Scholar]
  54. Nei M (1973) Analysis of gene diversity in subdivided populations. Proc Natl Acad Sci 70(12):3321–3323 [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Nettel A, Dodd RS (2007) Drifting propagules and receding swamps: genetic footprints of mangrove recolonization and dispersal along tropical coasts. Evolution 61(4):958–971 [DOI] [PubMed] [Google Scholar]
  56. Parani M, Rao CS, Mathan N, Anuratha CS, Narayanan KK, Parida A (1997) Molecular Phylogeny of mangroves III Parentage analysis of a Rhizophora hybrid using random amplified polymorphic DNA and restriction fragment length polymorphism markers. Aquat Bot 58(2):165–172 [Google Scholar]
  57. Parani M, Lakshmi M, Zeigenhagen B, Fladung M, Senthilkumar P, Parida A (2000) Molecular phylogeny of mangroves VII.PCRRFLP of trnS–pbsC and rbcL gene regions in 24 mangrove and mangrove associate species. Theor Appl Genet 100:454–460 [Google Scholar]
  58. GBP-IIT-ENB-DAT Report (2012) The status of Sundari (H. fomes) an indicators species in the Sunderbans. GRB EMP: Ganga River Basin Environment Management Plan
  59. Rohlf FJ (1993) Ntsys-PC, Numerical taxonomy and multivariate analysis system Version I. 80-Setauket, NY, Exeter Software
  60. Saenger P, Hegerl EJ, Davie JDS (1983) Global status of mangrove ecosystems. Environmental 3(3):1–88 [Google Scholar]
  61. Schaal BA, Leverich WJ, Rogstad SH (1991) Comparison of methods for assessing genetic variation in plant conservation biology. Genetics and conservation of rare plants. OxfordUniversity Press, New York, pp 123–134 [Google Scholar]
  62. Shen XL, Guo WZ, Zhu XF, Yuan YL, Yu JZ, Kohel RJ, Zhang TZ (2005) Molecular mapping of QTL for fiber qualities in three diverse lines in upland cotton using SSR markers. Mol Breeding 15:169–181 [Google Scholar]
  63. Siddiqui KM (2001) Analysis of a Malakisi barn used for tobacco curing in East and Southern Africa. Energy Convers Man 42:483–490 [Google Scholar]
  64. Sneath PH, Sokal RR (1973) Numerical taxonomy. The principles and practice of numerical classification
  65. Spalding M, Blasco F, Field C (1997) World mangrove atlas. The International Society for Mangrove Ecosystems, Okinawa, p 178 [Google Scholar]
  66. Spiers AG (1999) Review of International continental wetland resources. Global review of wetland resources and priorities for wetland inventory. In Finlayson CM, Spiers AG (eds), Supervising scientist report 144. Canberra, Australia: 63–104
  67. Tomlinson PB (1986) The botany of mangroves. Cambridge University Press, Cambridge [Google Scholar]
  68. Upadhyay VP, Ranjan R, Singh JS (2002) The human mangrove conflicts—the way out. Curr Sci 83:1328–1336 [Google Scholar]
  69. Walter H (1971) Ecology of tropical and subtropical vegetation. Van Nostrand, New York, p 539 [Google Scholar]
  70. Weber-El Ghobary MO (1984) The systematic relationships of Aegialitis (Plumbaginaceae) as revealed by pollen morphology. Plant Syst Evol 144:53–58 [Google Scholar]
  71. Yeh FC, Yang RC, Boyle TB, Ye ZH, Mao JX (1997) POPGENE, the user-friendly shareware for population genetic analysis. Molecular biology and biotechnology center, University of Alberta, Canada, p 10 [Google Scholar]
  72. Zietkiewicz E, Rafalski A, Labuda D (1994) Genome fingerprinting by simple sequence repeat (SSR)-anchored polymerase chain reaction amplification. Genomics 20(2):176–183 [DOI] [PubMed] [Google Scholar]

Articles from Physiology and Molecular Biology of Plants are provided here courtesy of Springer

RESOURCES